ID: 905921481

View in Genome Browser
Species Human (GRCh38)
Location 1:41722336-41722358
Sequence CTAGTTTTCCACATATATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905921479_905921481 21 Left 905921479 1:41722292-41722314 CCTGGGATGTAGCTCGTGCTTGT 0: 1
1: 0
2: 0
3: 13
4: 175
Right 905921481 1:41722336-41722358 CTAGTTTTCCACATATATCAGGG 0: 1
1: 0
2: 2
3: 23
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905921481 Original CRISPR CTAGTTTTCCACATATATCA GGG Intronic
901250795 1:7777854-7777876 CAAGTTTTCCACATATGGAAAGG - Intronic
905921481 1:41722336-41722358 CTAGTTTTCCACATATATCAGGG + Intronic
907336575 1:53703672-53703694 TTACTTTTCCAAATAGATCAAGG + Intronic
908672388 1:66562668-66562690 CAAGTTTTCCACATCTAAGAAGG - Intronic
911405456 1:97432517-97432539 TTTTTTTTCCACATTTATCATGG + Intronic
919419440 1:197352907-197352929 CTAGTTTAGCACATAAACCAGGG - Intronic
921322063 1:213951586-213951608 CTGGTTTCACATATATATCATGG + Intergenic
1064861395 10:19830148-19830170 ATAGCTTTCCACCTATCTCAAGG + Intronic
1065412019 10:25439733-25439755 CAAGCTTTCCACATGTTTCAAGG - Intronic
1068519814 10:58065811-58065833 CTACTTTTCAAAATATATCTAGG - Intergenic
1069202272 10:65635070-65635092 ATAGTATTCCACACACATCAGGG + Intergenic
1070429594 10:76323975-76323997 CTGGTTTTCCCCATTTATCCTGG + Intronic
1071133821 10:82430200-82430222 CTATTTTTCCACATATGTTTAGG + Intronic
1071221161 10:83465946-83465968 CTACTTTTTCACATTAATCATGG - Intergenic
1072655226 10:97325268-97325290 CTATTTTTCCACCTATAAAATGG - Intergenic
1073388858 10:103154766-103154788 CAAGTTTTACACAAATATGAAGG + Intronic
1073830356 10:107376651-107376673 CTAGTTGGCAACATATTTCAGGG - Intergenic
1076494892 10:130890638-130890660 CAAGTTTTCCTCACCTATCAAGG - Intergenic
1079478388 11:20855915-20855937 TTAGTTTTCCAGATAGATCAGGG + Intronic
1082312926 11:50676141-50676163 ATAGTCTTCCACATATCTCTTGG + Intergenic
1083021486 11:59512125-59512147 CTAGGATGCCACACATATCACGG - Intergenic
1085916117 11:80890281-80890303 ATCATTTTCAACATATATCAAGG + Intergenic
1086218162 11:84408017-84408039 CTAGTTCTTCACATACATCTAGG - Intronic
1087540784 11:99516678-99516700 CTTGTTTTCAAAATATATTATGG + Intronic
1087558429 11:99752658-99752680 ATAGTTTTCTACATAAATAAAGG + Intronic
1089424129 11:118356771-118356793 CTAGTTTCCCAAATATGTAAGGG - Intergenic
1089863113 11:121607848-121607870 CTATTGATCCACAAATATCAAGG - Intronic
1090527201 11:127549597-127549619 CTAGTTTTCCACATTTTTATTGG - Intergenic
1092573239 12:9748124-9748146 CTAGTTTTCAAAAGACATCATGG - Intergenic
1097809046 12:63998648-63998670 CTGGATTTCCAAATATCTCAAGG - Intronic
1099460370 12:82913805-82913827 CCAATCCTCCACATATATCAAGG - Intronic
1099545560 12:83975499-83975521 CAAATTCTCCATATATATCAAGG + Intergenic
1101975884 12:109358445-109358467 CTAATTTTCCAGATAAAACAGGG + Intronic
1105676783 13:22680425-22680447 CTTGTATTCCACAAATATTAGGG - Intergenic
1106787461 13:33121625-33121647 ATAGTTTTCCACATAAAAAATGG + Intronic
1107732977 13:43367114-43367136 CTAGATTTCCACATCTGTGAAGG - Intronic
1109415024 13:62027640-62027662 CTAGTCTTCCATTTAGATCAGGG + Intergenic
1109442467 13:62393832-62393854 ATAGTTTCCCTTATATATCAGGG - Intergenic
1109488227 13:63056955-63056977 TTACTTATCCAAATATATCATGG + Intergenic
1110177526 13:72574594-72574616 CTGGTACTCCACAGATATCATGG - Intergenic
1111121972 13:83864673-83864695 CTATTATTCTCCATATATCAGGG + Intergenic
1112743835 13:102505242-102505264 CCAGTTTTCCCCAAATGTCAAGG + Intergenic
1114719660 14:24867494-24867516 CAAGTTTTCCACATATGTACAGG - Intronic
1115036258 14:28860406-28860428 CTAGTTTTCTATATATTGCAAGG - Intergenic
1116097696 14:40392548-40392570 CTAGATTTCCCCCTTTATCAAGG + Intergenic
1117090112 14:52241184-52241206 TTATTTTTGCACATATATCATGG - Intergenic
1118105742 14:62657471-62657493 CTAGTTTTTCAGATATATTTAGG - Intergenic
1119086783 14:71746452-71746474 CTACTTTTCCTCATTTATCATGG + Intergenic
1119641595 14:76319249-76319271 CTTGTTTGCCACATATTTGATGG + Intronic
1120300247 14:82697081-82697103 CTAGTGTTCAGCATGTATCATGG - Intergenic
1122308817 14:100781939-100781961 CTACGATTCCACATATATGAGGG - Intergenic
1125071130 15:35554478-35554500 TTGTTTTTCCACATATATCTAGG + Intergenic
1125174228 15:36802381-36802403 CTAGATCTCCACAGATTTCAGGG - Intronic
1125272495 15:37954394-37954416 CTAGCATTTCAAATATATCATGG - Intronic
1125407354 15:39367311-39367333 CTTGTGTTCCACTTACATCAAGG + Intergenic
1125992310 15:44121598-44121620 CTAGTTTTCTAGATCTTTCATGG + Intronic
1126014307 15:44335175-44335197 TTAGTTTTGCAAATGTATCATGG + Intronic
1126370664 15:47943197-47943219 CTTGTTTTTCACATATATTTAGG - Intergenic
1131319999 15:91379108-91379130 GTAGTTTTCAACTTCTATCATGG - Intergenic
1131893748 15:97003521-97003543 CTGGTTTTCCACATGCATGAAGG + Intergenic
1132160827 15:99540396-99540418 CTATCTATACACATATATCAGGG + Intergenic
1133866082 16:9644609-9644631 CTCGTTTTCCAGATATATTGTGG - Intergenic
1138627092 16:58261080-58261102 CTAGTTTACCAATTATTTCAAGG - Intronic
1139485013 16:67250534-67250556 GTAGTTTTCCCCATAAATCATGG + Intronic
1144250772 17:13414538-13414560 CATGTTTTGCACATATATCCTGG - Intergenic
1145354581 17:22130234-22130256 TTACTTATCCAAATATATCATGG - Intergenic
1148057082 17:44805836-44805858 GTATTTTTCCACTTTTATCAGGG - Exonic
1155673316 18:28398568-28398590 GTTGTTTTCCACATAAATCTAGG + Intergenic
1156393342 18:36673856-36673878 TTAGTTTAACACATATATGAGGG + Intronic
1156872773 18:41966552-41966574 CTTGTTTTCCATGTATAACAGGG - Intronic
1157018751 18:43753388-43753410 CACATTTTCCACATTTATCAAGG + Intergenic
1157024027 18:43821407-43821429 CTAGTTGTCCATATATATAACGG - Intergenic
1157130520 18:45002964-45002986 CTAGTTTCTCACATATACCAAGG - Intronic
1157976613 18:52334986-52335008 CTGGTCTTCCACATATGTCTTGG + Intergenic
1159259735 18:65998107-65998129 TTAGTTTTCCAAATACATCAAGG + Intergenic
1164472932 19:28550819-28550841 CTAGTTTTCCAGATTTCTCTGGG - Intergenic
1166020099 19:40019810-40019832 CTAGTTTTCCAAATTAATGATGG + Intergenic
928483936 2:31710864-31710886 CTAGTTTTAAATTTATATCAAGG + Intergenic
929956562 2:46462895-46462917 CTAGTTTCCCACAGAATTCAAGG - Intronic
930130594 2:47846080-47846102 CCAGTTTGCCGCATCTATCATGG - Intronic
930339189 2:50090840-50090862 CTAGTTCTCTACTTATCTCACGG + Intronic
931325190 2:61214410-61214432 GATGTTTTCCACATATTTCATGG - Exonic
931638384 2:64360683-64360705 CAAGGTTTCCACACATATCTTGG - Intergenic
932158876 2:69442943-69442965 CTAGTTTCCCATTTTTATCAAGG - Intergenic
934969851 2:98754544-98754566 GTAGTTTTCTACAGATATCATGG - Intergenic
936682386 2:114789006-114789028 CTAATTTTCCAAAGATATAATGG - Intronic
936846057 2:116834957-116834979 CCAATCTTCCACATATACCAAGG - Intergenic
938631683 2:133174401-133174423 CTTGTATTTAACATATATCATGG + Intronic
940491462 2:154367259-154367281 CCATTTTTCCACATAGATAAGGG - Intronic
940848521 2:158666409-158666431 CTAGTTTGCAGCATATATCCGGG + Exonic
943179382 2:184524255-184524277 CCAGTTGTCCACATATCTCATGG - Intergenic
945889524 2:215413637-215413659 AAAGTTTTCCACCTCTATCAGGG + Intronic
946661033 2:221999702-221999724 CTTCTTTTCAACATCTATCATGG + Intergenic
1169977514 20:11346821-11346843 CTAGTTTTCCAAAGTTATCAAGG - Intergenic
1172429864 20:34880719-34880741 CTAGTTTTCTAGGTATATAATGG + Intronic
1174800987 20:53563078-53563100 ATAGTTTTCCATATCTATTAAGG + Intergenic
1177275377 21:18906099-18906121 CTAGTTTTCTACCAACATCAAGG + Intergenic
1177574938 21:22941246-22941268 CTACTTTTCCTTAAATATCATGG - Intergenic
1178559198 21:33622122-33622144 CTCGCTTTCCTCATATATAATGG - Intronic
1182298322 22:29323723-29323745 CTAAATTTCCACATATATCTGGG - Intergenic
949738504 3:7202174-7202196 CTTATCTTCTACATATATCATGG - Intronic
950139379 3:10604675-10604697 CAAGTTTTCCAGAGATGTCAGGG - Intronic
950592957 3:13952034-13952056 ATAGTTTCCTACAGATATCAGGG + Intronic
952267149 3:31797647-31797669 CTATTTTTCCACATAAAAGAGGG + Intronic
956367205 3:68517295-68517317 CCAGTTTTCCACTTATAGTAAGG + Intronic
957124117 3:76135315-76135337 CTAGGTTTCCTCATATGTCAAGG - Intronic
957482275 3:80813635-80813657 CTAATTTTCCTCAAATACCAAGG - Intergenic
957573480 3:81979582-81979604 CTATTTATCCACATCTCTCAAGG - Intergenic
958658421 3:97033433-97033455 GAATTTATCCACATATATCATGG + Intronic
959196643 3:103191905-103191927 AGAGTTTTGCACATATATTAAGG + Intergenic
959330159 3:104995581-104995603 CTAGGATTCCATAGATATCAAGG - Intergenic
959515785 3:107265353-107265375 CTTGTTTTCTAAATATAGCATGG + Intergenic
961112093 3:124293057-124293079 CTAGTTTCCCAGATATAACAAGG + Intronic
962587537 3:136857813-136857835 CTAGTTTCTCACAGATATAATGG + Intergenic
964018412 3:151976790-151976812 CTCTATTTCCACACATATCAAGG + Intergenic
964187298 3:153962021-153962043 TTTTTTTTCCACATATAACATGG - Intergenic
964687482 3:159413191-159413213 CTAATAATCCACATGTATCAAGG - Intronic
964925618 3:161953172-161953194 CTAGTTTTTCACATTAGTCAAGG + Intergenic
965967554 3:174512892-174512914 ATAGGTTTCCACTTAAATCAAGG - Intronic
966035257 3:175404771-175404793 CAAGTTGACCTCATATATCAAGG + Intronic
966049599 3:175598467-175598489 TTAGTTTTCTACATATTTCAAGG + Intronic
967558768 3:190893824-190893846 CTAGTTTTCCATAGATATCATGG - Intergenic
970166585 4:13244320-13244342 CTAGTTTTCAACGTAAAGCATGG - Intergenic
970210214 4:13702063-13702085 ATTGTTTTCCACATAAACCAAGG + Intergenic
970779788 4:19722859-19722881 TTAGTTTTCCACATATTAAATGG - Intergenic
972942361 4:44212384-44212406 CTAATTTCCCACATATACTAAGG - Intronic
975871639 4:78785720-78785742 CCAATTTCCCACACATATCAAGG - Intronic
980379181 4:131989548-131989570 CTAGTTTTTAAAATATAACAGGG - Intergenic
980528735 4:134022801-134022823 CTATTTTTCCCCATATATGCAGG + Intergenic
980918642 4:139059764-139059786 TTAGTTTTTAAAATATATCATGG - Intronic
981084511 4:140669223-140669245 CTAGTTTTATACATCTATCATGG + Intronic
983186692 4:164708687-164708709 CTGGTTTTCCAAAAATATCATGG + Intergenic
983601867 4:169539601-169539623 CTTGTTTCCTGCATATATCAAGG + Intronic
987527107 5:19066544-19066566 CTAGTTTTTCTCATATATTAAGG + Intergenic
989423272 5:41265802-41265824 CTAGTGTTTGCCATATATCAGGG - Intergenic
992055387 5:72983836-72983858 ATAGTTTTGCACATATGTCCTGG + Intronic
994593594 5:101804210-101804232 ATAGTTTGCAACATTTATCAAGG + Intergenic
996100214 5:119437608-119437630 TGAGCTTTCCACATATTTCAGGG + Intergenic
996373721 5:122780203-122780225 CTAGATTTCCACAAAGATCCCGG - Intronic
996960813 5:129246867-129246889 CTCGTTTTACAGATATTTCAGGG - Intergenic
997125302 5:131220599-131220621 CTTGTTTTCTACATCTATAATGG - Intergenic
998682628 5:144487328-144487350 CTAGTTTCCCCCAAAAATCAAGG + Intergenic
998731278 5:145080315-145080337 CTATTTTTCCACAGCTCTCATGG - Intergenic
1001225322 5:169939909-169939931 CTGTTTTTCCACATATAAAATGG - Intronic
1001908517 5:175493985-175494007 CTTCTTTTCCATCTATATCAGGG - Intronic
1004012316 6:11701747-11701769 CTAGGTTTCCTCATATATAGAGG - Intergenic
1007445484 6:41902308-41902330 CTGGCTTTCCTCAGATATCAAGG - Intergenic
1009245301 6:61230614-61230636 CTAGATTTCCAGATATATGTTGG - Intergenic
1009672871 6:66779002-66779024 GTGGTATTTCACATATATCATGG + Intergenic
1010912273 6:81573511-81573533 CTAGTTTTCTACATGAACCATGG + Intronic
1014086732 6:117354712-117354734 CCAGTTTTATACATATATAATGG + Intronic
1014639838 6:123895436-123895458 TTTGTTTTCAAAATATATCAAGG - Intronic
1017021614 6:150143920-150143942 CTCGTTCTCCACAAAAATCAGGG - Intronic
1021755128 7:23844042-23844064 TCAGTTTTTCACATATTTCATGG + Intergenic
1022176448 7:27875834-27875856 CTAGTTTTCCAGGTATAACTAGG - Intronic
1024674045 7:51622249-51622271 CTGGTTTTCCACATAGAGTAAGG + Intergenic
1025578387 7:62677795-62677817 ATAGTCTTCCAAATATATCTTGG - Intergenic
1025939699 7:66066440-66066462 CTTGTTTTCCACATAATTTAAGG - Intergenic
1027500370 7:78942437-78942459 CTAAGTTTCCACATATATCATGG - Intronic
1027519753 7:79190974-79190996 CTATATTTCCACATATATGTGGG + Intronic
1027810192 7:82886661-82886683 CTACTTTCCTATATATATCAGGG + Intronic
1028130813 7:87170552-87170574 CTAGTTTTACAGGTATCTCAAGG - Intronic
1030012322 7:105182409-105182431 CAAGTTTTGCACAAATCTCAAGG - Intronic
1030576670 7:111295744-111295766 ATACTTTTCCACATATCACATGG + Intronic
1032213450 7:129937407-129937429 ACAGTTTTTCAGATATATCATGG + Intronic
1034504793 7:151479822-151479844 CTAATTTTCTTCACATATCAAGG + Intronic
1037238641 8:16751939-16751961 CTATTTCTCCACATACACCATGG + Intergenic
1037845796 8:22281201-22281223 TTAGTTTTCCACATACCTGATGG - Exonic
1038893423 8:31753717-31753739 CTAATTTTTCTCATATATCAGGG + Intronic
1041091425 8:54304670-54304692 CTAGTTTCCTAAATATATCTAGG + Intergenic
1041873721 8:62664002-62664024 CTATTTTTCATCATATATCTGGG + Intronic
1043634897 8:82374007-82374029 CTATTACTCCACATATCTCAGGG + Intergenic
1047685840 8:127303949-127303971 CTGGTTCTCAACAAATATCATGG + Intergenic
1051272152 9:15366016-15366038 CTGCTTTTCCACTTATATCACGG + Intergenic
1051731711 9:20150347-20150369 ATAGGTTACCACATACATCATGG + Intergenic
1051815908 9:21105322-21105344 CTGGTTTTCCACATATATAGTGG - Intergenic
1051938437 9:22473274-22473296 CTAGCTTTCCACATATTTCCTGG + Intergenic
1052656286 9:31365801-31365823 CTAGATTTCCACAGAGATCAAGG - Intergenic
1058388270 9:104463811-104463833 CTAGATTTCCAGATATTTAAGGG + Intergenic
1060558700 9:124524865-124524887 TTTTTTTTCCACAGATATCAGGG - Exonic
1188347326 X:29083009-29083031 CTATTTTTCCACAGCTATCAAGG - Intronic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1193608378 X:83596540-83596562 CTAGTTCTCCATGGATATCAAGG - Intergenic
1194885258 X:99307419-99307441 CTAGTTCTCTACATTTATTAAGG - Intergenic
1199773785 X:150993238-150993260 CTAGTATTCAAAATATATAAAGG + Intergenic