ID: 905921907

View in Genome Browser
Species Human (GRCh38)
Location 1:41725237-41725259
Sequence GGACATGCAGACATGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 250}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905921905_905921907 -3 Left 905921905 1:41725217-41725239 CCTGAATCAAGAACGCTTCGGGA 0: 1
1: 0
2: 0
3: 2
4: 25
Right 905921907 1:41725237-41725259 GGACATGCAGACATGCAGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 250
905921901_905921907 20 Left 905921901 1:41725194-41725216 CCTCTCATGCTGTGAATGGCATC 0: 1
1: 0
2: 0
3: 8
4: 114
Right 905921907 1:41725237-41725259 GGACATGCAGACATGCAGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 250
905921903_905921907 -2 Left 905921903 1:41725216-41725238 CCCTGAATCAAGAACGCTTCGGG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 905921907 1:41725237-41725259 GGACATGCAGACATGCAGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905921907 Original CRISPR GGACATGCAGACATGCAGCT GGG Intronic
900083089 1:873796-873818 GGGCATGAAGAAATGCAGCCGGG - Intergenic
903069836 1:20721720-20721742 GGACGGGCAGAGATGCTGCTGGG + Exonic
905034711 1:34910311-34910333 AGACGTGCAGACATGCAGGCAGG - Intronic
905921907 1:41725237-41725259 GGACATGCAGACATGCAGCTGGG + Intronic
905924190 1:41738214-41738236 AGACATATAGACAAGCAGCTGGG + Intronic
906128769 1:43443423-43443445 GCCCATGCAGCCAGGCAGCTGGG - Exonic
906157135 1:43620319-43620341 GGCCATGCTGACAAGCAGCTGGG - Intronic
906962591 1:50427411-50427433 GGACAGGGAGACGCGCAGCTTGG + Intergenic
908476075 1:64489990-64490012 GGACATTCTGTCATCCAGCTTGG - Intronic
912590411 1:110813251-110813273 GGACAAGCACACATGGAACTGGG + Intergenic
912655978 1:111486713-111486735 TGACAGGCAGAGCTGCAGCTGGG - Intronic
913205952 1:116538953-116538975 GGATATGCACTCAGGCAGCTGGG - Intronic
914234134 1:145792767-145792789 GGATATGCAGACAGGCAGATAGG + Intronic
915639153 1:157208604-157208626 GGACATCCAGCTATGAAGCTGGG - Intergenic
918072339 1:181142119-181142141 AGACATGCAGATGTGAAGCTGGG - Intergenic
918454589 1:184695838-184695860 GGAAATGTAGACATGCAGGAAGG + Intronic
920412085 1:205770164-205770186 GGAGATGCAGAAATGCACATGGG + Exonic
920815455 1:209327207-209327229 TGACATGCAGAAGTCCAGCTGGG + Intergenic
922243342 1:223771350-223771372 GGACATGCAGTCTTGATGCTAGG + Intronic
922703104 1:227773742-227773764 TGCCATGCAGGCCTGCAGCTTGG + Intronic
923415706 1:233757706-233757728 GGACATGGATACATGAATCTGGG + Intergenic
923501673 1:234570568-234570590 GGGCCTGCAGCCAGGCAGCTTGG - Intergenic
924578767 1:245304656-245304678 GGACAGGCAGACAGGCAGACAGG - Intronic
1062763969 10:47588-47610 GGGCATGAAGAAATGCAGCCGGG + Exonic
1067205050 10:44205843-44205865 GGACAAGCAGAGAAGCAGCCAGG - Intergenic
1067302907 10:45030822-45030844 GGAAATGCAGAAATGCAGGAGGG - Intergenic
1067724845 10:48762315-48762337 GGACATGGAGACATGAAACTGGG - Intronic
1069742316 10:70692730-70692752 AGACCTGCAGACAAACAGCTGGG - Intronic
1070241943 10:74690698-74690720 GGACATTTAGAAATGCATCTTGG - Intronic
1072676466 10:97469959-97469981 GGACACGACGATATGCAGCTGGG + Intronic
1072849185 10:98868989-98869011 AGACATGCACACATGCAATTGGG - Intronic
1073806308 10:107102317-107102339 GGACAGTGAGCCATGCAGCTTGG - Intronic
1074715911 10:116218495-116218517 GGAGATACAGACCTGCACCTGGG - Intronic
1075032137 10:119030427-119030449 GAACACGCACACCTGCAGCTCGG - Exonic
1076040976 10:127248290-127248312 GGACTTGCAGACTTGCTTCTAGG + Intronic
1076183990 10:128432267-128432289 CCACATGCACACAGGCAGCTGGG + Intergenic
1077166556 11:1142956-1142978 AGGCATGGAGACATGCAACTGGG + Intergenic
1079287943 11:19156731-19156753 GGAGATGGAGACAGGCAGGTAGG - Intronic
1082167588 11:48965907-48965929 GGACAAGCAGACCTCCAGCCAGG - Intergenic
1082235965 11:49820743-49820765 GGACAAGCAGACCTCCAGCCAGG + Intergenic
1082609474 11:55280671-55280693 GGACAAGCAGGCCTGCAGCCAGG + Intergenic
1082765260 11:57162711-57162733 TCACATGCAGACTTGGAGCTGGG + Intergenic
1084155850 11:67312086-67312108 GGACAGGCAGACATGGGCCTGGG - Exonic
1084367155 11:68709330-68709352 GGACAGGCAGACACCCAGCGTGG - Intronic
1085786795 11:79459199-79459221 GGACTCTCATACATGCAGCTTGG + Intergenic
1086294058 11:85345608-85345630 GGTCTTGCAGCCATGCAGCATGG - Intronic
1086451146 11:86918216-86918238 GTAAATGCAGAGATGAAGCTTGG + Intronic
1087806878 11:102564938-102564960 GGAGATGTATACATGCAACTAGG - Intergenic
1088803827 11:113332700-113332722 TGACATGCAGCCCTGGAGCTGGG - Intronic
1088932566 11:114366640-114366662 GCACATCCAGACATTTAGCTGGG + Intergenic
1089221187 11:116873376-116873398 GGAAATTCAGACATGTAGGTTGG + Intronic
1089871011 11:121672715-121672737 GCTAATGCAGACAGGCAGCTGGG + Intergenic
1092728832 12:11509391-11509413 GGACTTGCAGCCAGGCAGTTGGG + Intergenic
1093056479 12:14560981-14561003 GCACATGCAGACATGGAGTGAGG - Intronic
1094813804 12:34165298-34165320 AGTCATGAAGAAATGCAGCTGGG + Intergenic
1096174279 12:49502013-49502035 TGACAGGAAGACAAGCAGCTAGG + Intronic
1096416871 12:51422114-51422136 GGTCAGGCAGTCATGAAGCTGGG - Intronic
1096710921 12:53454922-53454944 GGAAGAGCAGACATGCATCTTGG + Intronic
1102405657 12:112672127-112672149 GGGCAGGCAGACAGGCAGGTTGG + Intronic
1106506157 13:30372227-30372249 GGTTAACCAGACATGCAGCTAGG + Intergenic
1106706014 13:32280173-32280195 TGACAGGCAGAGATGCAGCTTGG + Intronic
1107962516 13:45571072-45571094 GGATAGGCAGTGATGCAGCTTGG - Intronic
1109999439 13:70175835-70175857 GGGTATGAAGACTTGCAGCTTGG + Intergenic
1110975820 13:81832822-81832844 GGACATGGACACATGTAGGTGGG + Intergenic
1113975858 13:114226800-114226822 AGACATGCACTCATGCAGCGAGG - Intergenic
1114711123 14:24779277-24779299 GGAGATGCAAACAAGGAGCTGGG - Intergenic
1115872211 14:37817126-37817148 GGACAAGCAGGCATCCAGGTTGG - Intronic
1117625629 14:57634840-57634862 GGAGATGAAGACAAGTAGCTAGG + Intronic
1118157399 14:63255314-63255336 GGAAATGCAGAGAGGCAACTGGG - Intronic
1120191022 14:81439433-81439455 GAACATGCAAACTTTCAGCTGGG - Intergenic
1120854883 14:89203660-89203682 GGGCAGGCAGATATGCTGCTGGG + Intronic
1121918760 14:97860745-97860767 GGACATGGAGATATACAGATAGG + Intergenic
1122194542 14:100075149-100075171 GCCCCTGCAGCCATGCAGCTTGG - Intronic
1124720351 15:32106138-32106160 GGACATGCACAAGTGAAGCTGGG + Intronic
1124962302 15:34408081-34408103 TGACAGGCAGACCGGCAGCTGGG - Intronic
1127233001 15:57016946-57016968 GGGCATGCAGACATCCATTTGGG + Intronic
1127314502 15:57781897-57781919 GGACATGAAGAAAGGCACCTGGG - Intronic
1128000598 15:64187625-64187647 GTACATGTAGAAATGCATCTTGG - Intronic
1129136308 15:73555350-73555372 GGGCCTGCAGACATGTGGCTAGG + Intronic
1131719389 15:95150730-95150752 AGACAAGCAGACTTGCAGTTTGG + Intergenic
1132071197 15:98777787-98777809 GGTCATGCAGAGACGGAGCTGGG + Intronic
1132539327 16:501235-501257 GGTCATGCATACAAACAGCTTGG - Intronic
1133868456 16:9665965-9665987 GGATATGCAGAGCTGAAGCTTGG - Intergenic
1133970563 16:10564764-10564786 GGAAATGCAAACAGGCAGCTCGG + Intronic
1138140017 16:54560016-54560038 GGACATGGTGACATGGTGCTGGG + Intergenic
1139431002 16:66911045-66911067 GGAGAGGCAGATATGAAGCTGGG - Intronic
1141005742 16:80349957-80349979 GGACATGCAGAGATGAAGAAAGG - Intergenic
1141594899 16:85091249-85091271 GGACATGTTGACAGGCAGCATGG + Exonic
1142440679 16:90095639-90095661 GGGCATGAAGAAATGCAGCCGGG - Intergenic
1142744413 17:1948539-1948561 GGACAGGCAGACAGGCAGACAGG + Intronic
1144208795 17:12997593-12997615 GGACATGCAATAAAGCAGCTTGG - Intronic
1147326401 17:39671761-39671783 GAACATGCACACAGGCAGCCTGG + Exonic
1148027444 17:44598496-44598518 GGGCATGCGCACTTGCAGCTTGG + Intergenic
1148458873 17:47826400-47826422 GGAAAGGCAGACATGGAGCAGGG - Intronic
1149297478 17:55273667-55273689 GGTCATGCAGGCAGGCAGCCAGG - Intronic
1149972748 17:61235320-61235342 AGACTTGCAGACAGGCAGCCTGG + Intronic
1150918195 17:69457500-69457522 GGACTTGCAGACCAGCAGCCTGG + Intronic
1150918202 17:69457542-69457564 AGAAATGCAGGCTTGCAGCTGGG + Intronic
1152697794 17:81805223-81805245 GGACCCGCAGACCTGGAGCTGGG - Intronic
1152956876 18:47921-47943 GGGCATGAAGAAATGCAGCCGGG + Exonic
1153349967 18:4068697-4068719 GGACCTGAAGAGAAGCAGCTAGG + Intronic
1154353756 18:13609252-13609274 GGACGTGCTGTCATGCAGCCAGG + Intronic
1157576775 18:48748948-48748970 AGAGATGCAGAGATGCAGCCTGG - Intronic
1157772112 18:50358353-50358375 GGACATGAAGACATGCAGAGAGG - Intergenic
1158008119 18:52696600-52696622 GGAGATGCAGATAAGCAACTAGG + Intronic
1160071994 18:75637045-75637067 CGACACGCAGACATGCAGCATGG + Intergenic
1160692938 19:468223-468245 AGACATGTTGACATGCACCTGGG + Intronic
1160751154 19:735292-735314 AGACATCCAGACAAGCACCTGGG - Intronic
1160751175 19:735371-735393 AGACATCCAGACAGGCACCTGGG - Intronic
1160751197 19:735448-735470 AGACATCCAGACAGGCACCTGGG - Intronic
1162337183 19:10069158-10069180 GGACATGCAGACATGGAAGGAGG - Intergenic
1165177167 19:33938940-33938962 GGACGTGCAAACACTCAGCTCGG - Intergenic
1165714265 19:38034444-38034466 GGACAGGGAGGCATGCAGCCTGG + Intronic
1165891732 19:39116635-39116657 GGAGACCCAGACATGCGGCTGGG - Intergenic
1166855883 19:45782445-45782467 GGACAGGCAGACATGCAGCCAGG - Intronic
1167837498 19:52086147-52086169 GGACATGGAGACGTGTAGGTGGG + Intronic
1167920722 19:52781063-52781085 GGACATGGAGTCATGTAGGTGGG + Intronic
1168503782 19:56915866-56915888 GGACACGCAGAGATGCAGGGAGG - Intergenic
1168519283 19:57035708-57035730 GGACAGGTAGAGGTGCAGCTAGG + Intergenic
925844760 2:8025128-8025150 AGACCTGCACACATGCATCTAGG - Intergenic
925901501 2:8512452-8512474 ATACATGCAGATAAGCAGCTGGG - Intergenic
926148304 2:10410386-10410408 AGAAATGTAAACATGCAGCTGGG - Intronic
926449534 2:12985367-12985389 AGACATCCAGCCATACAGCTGGG + Intergenic
928392996 2:30923565-30923587 GGAGATGCAGAGGTGAAGCTGGG + Intronic
928448763 2:31358927-31358949 GGAGATGAAAACATGCAGATTGG + Intronic
928897617 2:36283055-36283077 GCACAAGCAGACATGTTGCTTGG - Intergenic
929813280 2:45210031-45210053 GCACATGTAAGCATGCAGCTGGG - Intergenic
930086086 2:47498236-47498258 GGACTTGCAGCCATGAAGCAGGG - Intronic
932413585 2:71560947-71560969 GGCCATGCAGAAATGCGGCGGGG - Intronic
934050371 2:88205558-88205580 GGACAAGCAGCCTTGCTGCTTGG + Intergenic
934554193 2:95278756-95278778 TGCCATGCAGACATCCAGCGTGG + Exonic
934897570 2:98132164-98132186 GGCCATGCAGCCATGGAGGTGGG + Intronic
936155967 2:110047742-110047764 GGACAGGCAAACATTCAGCCAGG - Intergenic
936188721 2:110323686-110323708 GGACAGGCAAACATTCAGCCAGG + Intergenic
936694695 2:114931752-114931774 GAAGATCCTGACATGCAGCTTGG - Intronic
938655586 2:133429507-133429529 GGGCACACAGACATACAGCTGGG - Intronic
940673567 2:156701089-156701111 AGACATGATGACATTCAGCTTGG + Intergenic
944666612 2:201964231-201964253 GGAAATGAAAACCTGCAGCTGGG - Intergenic
944862079 2:203824695-203824717 GGATATACAGACGTGGAGCTAGG + Intergenic
945829170 2:214762488-214762510 ACAAATGGAGACATGCAGCTTGG + Intronic
946018925 2:216626244-216626266 GGACATGAATCCAGGCAGCTTGG + Intergenic
947877234 2:233475706-233475728 GGACTTGCAGACATTCCGCGAGG + Exonic
948258992 2:236589273-236589295 GGACAATCAAACAAGCAGCTCGG + Intergenic
948619868 2:239227572-239227594 GGACAGACAGACAAGCACCTTGG + Intronic
949055070 2:241923177-241923199 CCACCTGCAGACATGAAGCTGGG + Intergenic
949055115 2:241923483-241923505 CCACATGCAGACATGAAGCTGGG + Intergenic
949055120 2:241923534-241923556 TCACGTGCAGACATGAAGCTGGG + Intergenic
949055136 2:241923636-241923658 CCACATGCAGACATGAAGCTGGG + Intergenic
1168921250 20:1537927-1537949 TGACATGCAGAAACGCAGCTGGG + Intronic
1169992252 20:11516447-11516469 GGACATGCACACAGGCCACTGGG + Intergenic
1170164678 20:13348723-13348745 GGACTTCCAGACATGGAACTGGG + Intergenic
1170639654 20:18140221-18140243 GGACAGGAAGACCTGCAGTTGGG + Intronic
1171404430 20:24900361-24900383 GGACCTGCAGTCAGACAGCTTGG + Intergenic
1172192419 20:33069925-33069947 GGACAGGGAGATGTGCAGCTTGG - Exonic
1172359168 20:34300398-34300420 GGGCAGGCAGTCATGCAGATAGG - Intronic
1172613343 20:36267432-36267454 GGCCCTGCAGAAAGGCAGCTGGG - Intronic
1173155935 20:40608891-40608913 AGAAATACAGACATTCAGCTTGG + Intergenic
1174088668 20:48028746-48028768 GGACAGGTGGACATGCAGCCTGG - Intergenic
1175776289 20:61655890-61655912 GCACATGCAGCCTTGGAGCTCGG - Intronic
1175893381 20:62325122-62325144 GGGCAGGCAGACAGGCAGCAGGG + Intronic
1176007793 20:62875582-62875604 GGAACTGCTGCCATGCAGCTGGG + Intergenic
1177844001 21:26267824-26267846 GAACATGCAGACAGTCAGGTCGG + Intergenic
1178901297 21:36601178-36601200 GGACATGCAGGGATGGAGCTGGG - Intergenic
1180652438 22:17389338-17389360 GGACAGGCAGGCAGGCAGTTGGG - Intronic
1180842132 22:18964380-18964402 GGCCCTGCACACATGCACCTTGG + Intergenic
1181042283 22:20197818-20197840 GGAGAGGCAGCCATGCAGCCAGG - Intergenic
1181059364 22:20274501-20274523 GGCCCTGCACACATGCACCTTGG - Intronic
1181402556 22:22660127-22660149 GGAGATGCTGACATGCAGGGAGG + Intergenic
1181417384 22:22770427-22770449 GGAGATGCTGACATGCAGGGAGG + Intronic
1181423445 22:22817704-22817726 GGAGATGCTGACATGCAGGGAGG + Intronic
1181430647 22:22879614-22879636 GGAGATGCTGACATGCAGGGAGG + Intronic
1181565847 22:23736915-23736937 GGACATGCACACAGGCACCCAGG + Intergenic
950543611 3:13626464-13626486 GGACCTGCACACGTGCAGCCGGG + Exonic
951344210 3:21526526-21526548 GAACATGCAGCCATGGAGATAGG + Intronic
953267366 3:41404722-41404744 GCACATGCACATATGCAGCAGGG - Intronic
953750198 3:45602754-45602776 AGTCATGTAGACATGCAGATAGG - Intronic
953809210 3:46097425-46097447 CGACATGAAGACAGGCAGGTGGG + Intergenic
953904916 3:46863745-46863767 GGACCTGCAGAGAGGCAGCAGGG - Intronic
953918358 3:46935091-46935113 GGTCATGCACACATTGAGCTGGG + Intronic
955425807 3:58788551-58788573 GTTCATCCAGACATGCAGCACGG - Intronic
956890266 3:73606503-73606525 GCACATGATGACATGCAGCCTGG + Intronic
961183108 3:124891625-124891647 TGACATTCTGACATGCAGCTGGG + Intronic
961761540 3:129172606-129172628 AGACAGGCAGACAGGCAGCCAGG + Intronic
962526494 3:136242356-136242378 GGACATGCAGAAATGGGGTTGGG + Intergenic
962602234 3:137001480-137001502 ACACATGTAGAAATGCAGCTAGG - Intronic
962847441 3:139284437-139284459 GGACAGTCTGACAGGCAGCTGGG + Intronic
964186896 3:153956754-153956776 GGATACTCAGAGATGCAGCTGGG - Intergenic
964459017 3:156901310-156901332 GGACACGCAAAGAAGCAGCTGGG + Intronic
966193763 3:177294176-177294198 GGAAGAGCAGAGATGCAGCTGGG + Intergenic
966636903 3:182145097-182145119 AGACATGCATTCATCCAGCTGGG + Intergenic
967486069 3:190032529-190032551 GGAAATGCAGGCAAGCAGGTTGG + Intronic
968357436 3:198120226-198120248 GGGCATGAAGAAATGCAGCCGGG - Intergenic
968672299 4:1858081-1858103 GGACATACAGTCCTACAGCTGGG - Intergenic
968786422 4:2625437-2625459 TGACATGCAGACCTGCATATTGG + Exonic
971268082 4:25112140-25112162 GGACCTGCTGACATGAAGCCAGG - Intergenic
972345136 4:38186432-38186454 GCACATGCAGACATGCACACAGG - Intergenic
972767328 4:42163486-42163508 GGGCATGGTGACATGCACCTTGG + Intergenic
978533945 4:109741263-109741285 AGAGTTGCAGAGATGCAGCTTGG + Intronic
983064763 4:163195443-163195465 GCACATGCAGATAAGCAGCACGG - Intergenic
984173835 4:176391741-176391763 GGTAATTTAGACATGCAGCTAGG - Intergenic
985002015 4:185494797-185494819 GGAAATGTAGACATGCAGAAGGG + Intergenic
985276646 4:188244202-188244224 GGACATTGAAACATACAGCTTGG - Intergenic
985441104 4:189983024-189983046 GGGCATGAAGAAATGCAGCCGGG + Intergenic
985724278 5:1507561-1507583 GGAAATGCAGAGATGAAGATGGG + Intronic
987389291 5:17360901-17360923 GGACACGGACACATGCAGGTGGG + Intergenic
988629849 5:32917157-32917179 GGACACGTAGACCTGCATCTAGG - Intergenic
990564170 5:57012293-57012315 TGACATGGAGATGTGCAGCTGGG - Intergenic
992371761 5:76151167-76151189 GGACTTGCAGAGATGGAGCTGGG + Intronic
996852509 5:127968193-127968215 AGACATTCAGATAGGCAGCTTGG + Intergenic
997468341 5:134102853-134102875 GGACCTCCAGACATGCACCCAGG - Intergenic
998541188 5:142982956-142982978 GCACATGCAGCCTTGCATCTGGG + Intronic
999045952 5:148469692-148469714 GGTTATGCAGACAGGAAGCTGGG - Intronic
999315057 5:150578341-150578363 CGACATGCAGACCTACTGCTGGG - Intergenic
1001398802 5:171434630-171434652 GGACATGCATACAACCAGCAGGG + Intronic
1001677216 5:173528601-173528623 GGATGTGCACACATCCAGCTAGG - Intergenic
1001743181 5:174070408-174070430 GGATATGGAGCCATGAAGCTGGG - Intronic
1002496264 5:179613893-179613915 AGACATGCAGGCATGCAGTGAGG + Intergenic
1018795978 6:167185999-167186021 GGAAATGCAGACAAAGAGCTTGG + Intronic
1019704873 7:2492794-2492816 GGACAGACAGACAGACAGCTAGG - Intergenic
1022962201 7:35438152-35438174 GGACATGAAGAGATGCTGTTTGG + Intergenic
1024131552 7:46357770-46357792 AGACGTGCAGGCATGCAGGTGGG - Intergenic
1024354092 7:48396459-48396481 GGAGATGGTGCCATGCAGCTCGG + Intronic
1024637462 7:51302060-51302082 GGCTGTGGAGACATGCAGCTCGG - Intronic
1026652015 7:72223951-72223973 GTACACGCAGACATGAAGATGGG + Intronic
1027125703 7:75555294-75555316 GGTAATGCTGACATGCTGCTGGG + Intronic
1027420616 7:78014548-78014570 GGACATGCACACAGCCTGCTAGG + Intergenic
1032800209 7:135311791-135311813 GGACATGTAGGCAGGGAGCTGGG - Intergenic
1033345944 7:140525872-140525894 TGGCATGCAGAGAGGCAGCTGGG + Intronic
1033407996 7:141089297-141089319 GGACAGGCAGACTTGGAGGTAGG + Intronic
1033611141 7:142964092-142964114 AGTCATGCAGAAATGCAACTTGG - Intergenic
1034276801 7:149827402-149827424 GTGAATGCAGACATGCAGCATGG + Intergenic
1034516665 7:151586191-151586213 TGAGATGCAGAGCTGCAGCTTGG - Intronic
1034546521 7:151793343-151793365 GGAAAGGCAGAAATGCTGCTGGG - Intronic
1040288084 8:46110563-46110585 GGACATTGAGGCATGCAGATTGG - Intergenic
1040305185 8:46208330-46208352 GGACATACAGCCATGCAGAGGGG + Intergenic
1041151726 8:54942758-54942780 GCACATGTAGACATGGAGCATGG - Intergenic
1041335423 8:56776722-56776744 TGGCATGCAGACATTCTGCTGGG + Intergenic
1041944181 8:63423403-63423425 AGACATGCAGACAGGCCTCTTGG - Intergenic
1042784665 8:72535202-72535224 GGAAATGCAGAGCTGGAGCTTGG + Intergenic
1042960460 8:74298379-74298401 GGACATGAATAAATGCATCTAGG - Intronic
1044326888 8:90868996-90869018 GGACATGGAGCCCTGCATCTTGG + Intronic
1044443349 8:92245706-92245728 GGACATGGTGGCATGCATCTGGG + Intergenic
1045738997 8:105332105-105332127 GAACAGGAAGACAGGCAGCTTGG - Intronic
1051857521 9:21586013-21586035 GGTCATGCAGGCATGAGGCTGGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053619210 9:39798816-39798838 AAGCATGCACACATGCAGCTGGG + Intergenic
1053877368 9:42558165-42558187 AAGCATGCACACATGCAGCTGGG + Intergenic
1053895295 9:42736523-42736545 AAGCATGCACACATGCAGCTGGG - Intergenic
1054234327 9:62543557-62543579 AAGCATGCACACATGCAGCTGGG - Intergenic
1054264947 9:62908613-62908635 AAGCATGCACACATGCAGCTGGG - Intergenic
1055983184 9:82026695-82026717 GGACATGTAGATGTGCAGATTGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058154800 9:101503166-101503188 TGGAATGCAGACATGAAGCTTGG + Intronic
1059386137 9:113965944-113965966 TGAGATGCCGACTTGCAGCTTGG + Intronic
1061587190 9:131576739-131576761 GTAGTTGCACACATGCAGCTGGG + Intergenic
1186332270 X:8547341-8547363 GGACATGAAGAGGTGCAGCTGGG - Intronic
1189016719 X:37292486-37292508 GGACATAAAGACATACACCTGGG + Intergenic
1189445200 X:41074882-41074904 GGAGATGCAGAGAGGCAGGTTGG + Intergenic
1189648507 X:43161467-43161489 GGAAATGAAGGCATGCAGATTGG + Intergenic
1191257102 X:58284307-58284329 GGAGATGAAGACAGGCAGCCAGG - Intergenic
1198520605 X:137448816-137448838 GGACATGCAGGGACGCAGGTGGG - Intergenic
1199672761 X:150160783-150160805 GGTCATGCAGCCAGGCAGCAGGG - Intergenic
1201867925 Y:18674069-18674091 GGACAGGCAGAAATGAAGTTTGG + Intergenic