ID: 905922144

View in Genome Browser
Species Human (GRCh38)
Location 1:41726931-41726953
Sequence CTGTACATATGGACTCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905922135_905922144 23 Left 905922135 1:41726885-41726907 CCTCTGTGCTGGGCATGGGGGCA 0: 1
1: 0
2: 6
3: 63
4: 529
Right 905922144 1:41726931-41726953 CTGTACATATGGACTCCAGAGGG 0: 1
1: 0
2: 0
3: 8
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905922144 Original CRISPR CTGTACATATGGACTCCAGA GGG Intronic
901417069 1:9124550-9124572 CTGTCCATATGGACAACATAGGG + Intronic
901480470 1:9521479-9521501 CTGTCCATCTGGACTCAAGAAGG - Intergenic
902156872 1:14494735-14494757 CTGGACATATTTACTCCTGAAGG - Intergenic
905922144 1:41726931-41726953 CTGTACATATGGACTCCAGAGGG + Intronic
912686187 1:111767738-111767760 CTGTATAGATGAACTTCAGAGGG - Exonic
918974141 1:191459559-191459581 CTGTACTCATGGACTCTATAAGG + Intergenic
923029631 1:230237521-230237543 CATTACATATGCACTCCAGCTGG + Intronic
923233339 1:232009057-232009079 CTTTTCACATGGCCTCCAGAGGG + Intronic
924500461 1:244633589-244633611 CTGCACATGTGTCCTCCAGAGGG - Intronic
1063854571 10:10234421-10234443 CTGTTCATATTGACTCAAGATGG - Intergenic
1067926346 10:50512518-50512540 GTGCACAGAGGGACTCCAGAGGG - Intronic
1070640423 10:78164944-78164966 CTGTCCATATGGACAGCAGAAGG - Intergenic
1071065357 10:81627170-81627192 CTGTTCATCTGGAGTCCAGTTGG - Intergenic
1076502466 10:130948063-130948085 CTGTACATTAGCCCTCCAGATGG - Intergenic
1077831915 11:5882061-5882083 CTTTTCAGATGGACTCCAGTAGG + Intronic
1081612747 11:44572854-44572876 CTTTACATCTGGGGTCCAGAGGG + Intronic
1083814138 11:65122562-65122584 GTGTACATATAGAATCGAGAGGG + Intronic
1087489491 11:98805760-98805782 CTGTACATGTTCACTACAGATGG + Intergenic
1103857562 12:123984040-123984062 CTGTTCACAAGGCCTCCAGAGGG - Intronic
1104048772 12:125182897-125182919 CTGGACATATGGACCCATGATGG - Intergenic
1104483875 12:129132528-129132550 CTGCACATTAGGTCTCCAGAAGG + Intronic
1106212690 13:27665413-27665435 CTGTACATATGAACTTCAGTAGG + Intronic
1107246346 13:38300894-38300916 ATGTACATATGCACTCAACATGG + Intergenic
1108624366 13:52212630-52212652 CTTTACGGATGGCCTCCAGAGGG + Intergenic
1110644668 13:77868735-77868757 GTGAACACATGGACTCCTGAGGG + Intergenic
1111307938 13:86440415-86440437 CTGTAAATATTGAATCCAGGTGG - Intergenic
1115646260 14:35370142-35370164 CTGTACATCTGGACACCTGGAGG - Intergenic
1117293041 14:54352228-54352250 CTGTACACATGGACACAGGAGGG + Intergenic
1119203453 14:72776497-72776519 CTGTGGAGATGGACTCCAGGGGG + Intronic
1125503064 15:40251637-40251659 CAGTACATGTGGACTCCAAATGG - Exonic
1126136796 15:45400514-45400536 CTGTGCATATGGATTCTATAAGG + Intronic
1127369007 15:58318773-58318795 CTACACATATGGGCTCAAGACGG + Intronic
1138433853 16:56986240-56986262 CAGGAGATATGGAGTCCAGAGGG + Intergenic
1142102458 16:88282544-88282566 CTGTGCATGTTGGCTCCAGATGG - Intergenic
1146097752 17:29948242-29948264 CTGTACATATGTATTCCATCAGG + Intronic
1150594657 17:66593522-66593544 CTGTGCATGTGGCCTCCAGCTGG - Intronic
1153247483 18:3087423-3087445 CTCCACATGTGGACTCCTGAGGG + Intronic
1155303144 18:24451789-24451811 CTTTCCATCTGCACTCCAGACGG + Exonic
1155922907 18:31621004-31621026 CTGTAAACATGTACTTCAGAAGG - Intergenic
1156177500 18:34564059-34564081 CTGTACATTAGGTCTCCAGAAGG + Intronic
1159686386 18:71425661-71425683 ATGTACATATGCACTTCAAAAGG + Intergenic
927089398 2:19699086-19699108 CTGAACATATTGATACCAGAAGG - Intergenic
927741424 2:25572876-25572898 TTGTTCATATGGCCTCCAGGTGG - Intronic
927888808 2:26735476-26735498 CTGTTCATATGGATTCTCGAGGG - Intergenic
929050449 2:37832015-37832037 CTGCACACCTGGGCTCCAGATGG - Intergenic
929210418 2:39350869-39350891 CTGGACCTGTGGCCTCCAGAGGG - Intronic
931597611 2:63967060-63967082 AAGAACATATGGTCTCCAGAGGG - Intronic
938771243 2:134502948-134502970 CTATACATATGGATGACAGAAGG + Exonic
943895621 2:193355524-193355546 ATGTACATATCAATTCCAGATGG - Intergenic
1170769516 20:19319828-19319850 CTGTACATGTGTACCCCAGCTGG + Intronic
1181791219 22:25268326-25268348 ATGGACATATAGACTCCACAGGG - Intergenic
951547577 3:23843782-23843804 CTGAAAATACTGACTCCAGAAGG - Intronic
952819657 3:37475159-37475181 CTGGACAAATGGGCCCCAGAGGG + Intronic
956893072 3:73631670-73631692 ATGCAAATATGGACTGCAGAAGG - Intergenic
959733066 3:109626123-109626145 ATCTGCATATGAACTCCAGAAGG - Intergenic
960692862 3:120365316-120365338 ATGAAAATATGGACTCCAGTAGG - Intergenic
961055162 3:123781343-123781365 CTGGACAAATGGAATCCTGAGGG + Intronic
970024645 4:11610537-11610559 CTGTACTTATGGAGCACAGAAGG + Intergenic
973689923 4:53417112-53417134 CTTTACTTTTGGACACCAGATGG + Intronic
973913559 4:55609405-55609427 CGGTACATATGCACTCATGAAGG + Intronic
975825185 4:78312167-78312189 ATATATATATGGACTTCAGATGG - Intronic
978458558 4:108924379-108924401 CTTTACATATGGAATCTAGCGGG - Intronic
979434009 4:120667666-120667688 CTGCACATATGGAGACCACAGGG - Intergenic
979744046 4:124187553-124187575 CTGTACATGTTTACTACAGATGG + Intergenic
983235377 4:165173222-165173244 ATACAAATATGGACTCCAGATGG - Intronic
985187315 4:187331665-187331687 TTGGACATATGGGCTTCAGAGGG + Intergenic
993407875 5:87534546-87534568 CTGTACAGATGAAAGCCAGAAGG - Intergenic
999851034 5:155539368-155539390 TTGTACACATGGGCTACAGAAGG + Intergenic
1004789439 6:19007780-19007802 CTGTATATCTGCAATCCAGATGG - Intergenic
1005265326 6:24106463-24106485 CTTTGCATATGGACTGCATATGG + Intergenic
1005505167 6:26463296-26463318 CTCTAGATATGCACTCCAGCCGG - Exonic
1016276356 6:142357800-142357822 CTTTACATATGGTCACCAGAGGG - Intronic
1016302535 6:142648122-142648144 CTTAACATAGGGATTCCAGATGG + Intergenic
1017808846 6:157969423-157969445 CTGTCCTTATGCAGTCCAGAGGG - Intergenic
1022947789 7:35304428-35304450 CTGGAAATATGTACTCCATAGGG + Intergenic
1027953985 7:84856626-84856648 CTGTGGATATGGTCTCCAGGTGG - Intergenic
1028566963 7:92245049-92245071 AGGCACATATGCACTCCAGAAGG + Exonic
1036245736 8:7115170-7115192 CTTTAGATATGGACTCGAGTTGG + Intergenic
1036888531 8:12578856-12578878 CTTTACATGTGGACTCGAGTTGG - Intergenic
1038967494 8:32591481-32591503 CTCTGCATATGGACCCCAAAAGG + Intronic
1041762706 8:61384288-61384310 CTGGACATATGGAAGCAAGATGG + Intronic
1057879810 9:98784638-98784660 CTCTACACATAGACTCCAGACGG - Intronic
1060652490 9:125340630-125340652 CAGTACAAATAAACTCCAGAAGG - Intronic
1062580599 9:137227686-137227708 CAGTCCACATGGACTCCAGGTGG - Exonic
1186265583 X:7830196-7830218 CTATATATATGTACTGCAGAAGG + Intergenic
1188452128 X:30318480-30318502 CTGTACATCAGAACTCCAGCAGG - Intergenic
1192919362 X:75690147-75690169 CTGTCTACATGGACCCCAGAAGG + Intergenic
1194414519 X:93593910-93593932 CTGTACGTATGCACAACAGAAGG + Intergenic
1197574697 X:128197571-128197593 CTGTACATATGGGTTCCTGTAGG + Intergenic
1197990541 X:132312401-132312423 CTCCACATTTGGACCCCAGAGGG - Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1199313198 X:146345641-146345663 CTGTATATATGGACACAAGGTGG + Intergenic