ID: 905922903

View in Genome Browser
Species Human (GRCh38)
Location 1:41730858-41730880
Sequence TCCCATTAGATCCCCTGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 66}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905922903_905922907 -1 Left 905922903 1:41730858-41730880 CCTATTCAGGGGATCTAATGGGA 0: 1
1: 0
2: 1
3: 5
4: 66
Right 905922907 1:41730880-41730902 ACTAGCTGAGGCTTCCTGTGGGG 0: 1
1: 0
2: 1
3: 10
4: 167
905922903_905922911 21 Left 905922903 1:41730858-41730880 CCTATTCAGGGGATCTAATGGGA 0: 1
1: 0
2: 1
3: 5
4: 66
Right 905922911 1:41730902-41730924 GGGTGAATTTGTTTGTGAAGAGG 0: 1
1: 0
2: 0
3: 18
4: 239
905922903_905922908 0 Left 905922903 1:41730858-41730880 CCTATTCAGGGGATCTAATGGGA 0: 1
1: 0
2: 1
3: 5
4: 66
Right 905922908 1:41730881-41730903 CTAGCTGAGGCTTCCTGTGGGGG 0: 1
1: 0
2: 2
3: 26
4: 202
905922903_905922906 -2 Left 905922903 1:41730858-41730880 CCTATTCAGGGGATCTAATGGGA 0: 1
1: 0
2: 1
3: 5
4: 66
Right 905922906 1:41730879-41730901 GACTAGCTGAGGCTTCCTGTGGG 0: 1
1: 0
2: 2
3: 13
4: 152
905922903_905922909 1 Left 905922903 1:41730858-41730880 CCTATTCAGGGGATCTAATGGGA 0: 1
1: 0
2: 1
3: 5
4: 66
Right 905922909 1:41730882-41730904 TAGCTGAGGCTTCCTGTGGGGGG 0: 1
1: 0
2: 0
3: 16
4: 260
905922903_905922912 28 Left 905922903 1:41730858-41730880 CCTATTCAGGGGATCTAATGGGA 0: 1
1: 0
2: 1
3: 5
4: 66
Right 905922912 1:41730909-41730931 TTTGTTTGTGAAGAGGAGCAAGG 0: 1
1: 0
2: 0
3: 24
4: 324
905922903_905922905 -3 Left 905922903 1:41730858-41730880 CCTATTCAGGGGATCTAATGGGA 0: 1
1: 0
2: 1
3: 5
4: 66
Right 905922905 1:41730878-41730900 GGACTAGCTGAGGCTTCCTGTGG 0: 1
1: 0
2: 3
3: 15
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905922903 Original CRISPR TCCCATTAGATCCCCTGAAT AGG (reversed) Intronic
903952481 1:27004438-27004460 TCTAATCAGATCCCCTGGATGGG - Intergenic
905922903 1:41730858-41730880 TCCCATTAGATCCCCTGAATAGG - Intronic
907546425 1:55263727-55263749 TCCCAATAAATCCCTTGAACAGG - Intergenic
908418157 1:63933391-63933413 TCCCTTTACATCCCCAGAAGTGG + Intronic
909809966 1:79921147-79921169 TCCCATTTCTTCCCCTGAAGTGG - Intergenic
911064387 1:93774670-93774692 TGCCATACGATCTCCTGAATGGG - Intronic
915128407 1:153681002-153681024 TCCCATTGGATCCCCTGCTTTGG + Intronic
916614259 1:166423218-166423240 TCCCATTGGATGCCCTGTGTGGG + Intergenic
922827280 1:228530507-228530529 TCCCATTAGAATGCCTGGATTGG + Intergenic
1068200542 10:53778546-53778568 TCCCCTTAGATCCTGTAAATGGG + Intergenic
1070728723 10:78810167-78810189 TCCCATTAGATACCCACAGTAGG + Intergenic
1072367123 10:94723240-94723262 GCCCATGATTTCCCCTGAATTGG - Intronic
1078556401 11:12330313-12330335 TCCCATTAAATCACTTGAACCGG - Intronic
1082655614 11:55853110-55853132 CCCCATTTGAACCCCTTAATTGG - Intergenic
1108325102 13:49322787-49322809 TCCTATTAGATCCCCTGAAAAGG + Intronic
1120045561 14:79801880-79801902 TCCAATTCCATCCCATGAATGGG - Intronic
1128174650 15:65544333-65544355 TCCAATTTGATCACCTGTATAGG - Intronic
1128905665 15:71465848-71465870 TGCCAATAAATGCCCTGAATAGG - Intronic
1131837170 15:96402377-96402399 TCCCATTAAATTCCCGGATTTGG + Intergenic
1132003800 15:98207702-98207724 TACTATTAGATCATCTGAATGGG + Intergenic
1132738556 16:1399281-1399303 TCCCATTAGAACCCCGGGGTGGG + Intronic
1137052557 16:35726263-35726285 TCCCATTAGAACGCCTGGAGTGG + Intergenic
1139677587 16:68535430-68535452 TCCTATTAGATACCCTGCTTTGG + Intronic
1140489848 16:75326160-75326182 TTTCATTAGGTCCCCTGACTTGG - Intronic
1148203075 17:45762826-45762848 TCCCATGAGCCCCCCTGAGTGGG - Intergenic
1149043282 17:52216017-52216039 TCTCATTGGATCCCATGATTTGG + Intergenic
1161179026 19:2867134-2867156 TCCCCTGAGCTCCCCTGATTGGG - Intergenic
1161533733 19:4805848-4805870 ACCCACCAGATCCCCTGAATAGG - Intergenic
1164375567 19:27680697-27680719 TCCCATTAGAATGCCTGGATTGG + Intergenic
928201257 2:29249173-29249195 TCTCAGGAGATCCCTTGAATGGG - Intronic
928211118 2:29324643-29324665 TCCCATTTCATCCCCTAGATGGG - Intronic
931219928 2:60279895-60279917 TCCCATCAAATCCCCTCACTGGG - Intergenic
934699083 2:96423987-96424009 TCCCCTGAGAGCCCCTGATTGGG - Intergenic
937951103 2:127388290-127388312 TCCGAGTAGATCCCGTGAAAAGG + Exonic
945013013 2:205485052-205485074 TGCCATTACCTCGCCTGAATGGG + Intronic
946053219 2:216880865-216880887 TCCCATTAGATTCCAGGAAATGG + Intergenic
946728143 2:222682505-222682527 TCCCATTAGATCCTATGAGGAGG + Intronic
1171227511 20:23453513-23453535 TCCCATCAGGTCCCCAGGATGGG - Intergenic
1179245345 21:39628700-39628722 TCCCATTAGGTCCCCTGTACAGG - Intronic
949091316 3:32921-32943 TCCTATGAGAGCCCCTGAAGGGG + Intergenic
950851417 3:16065397-16065419 TCCCATCAGTTCTCCTGATTGGG - Intergenic
953019661 3:39105345-39105367 TTCCATTAGGTTCCCTGATTGGG - Intronic
953984195 3:47428731-47428753 GCCCATTAAATCCCTTGAATTGG - Intronic
955343830 3:58146427-58146449 TCCCATTAGAACCACAGATTTGG - Intronic
957031634 3:75249146-75249168 TCCTATGAGAGCCCCTGAAGGGG + Intergenic
958466935 3:94470989-94471011 TACCATTGGATGCCCTAAATGGG - Intergenic
958803402 3:98781804-98781826 TCCCATGAGATAACCTGCATAGG - Intronic
962246735 3:133801650-133801672 TACCATTAGACCTCCTGACTGGG - Intronic
962400004 3:135050181-135050203 TCCTAGAAGATCCCCTCAATCGG - Intronic
964464398 3:156974522-156974544 CCCCATTTGATTCCATGAATAGG - Intronic
971941944 4:33226924-33226946 TCCCACTAGGTCCCCTACATGGG - Intergenic
975653245 4:76615331-76615353 TCCCATCTGATCCCCTGGAAAGG - Intronic
981049142 4:140293749-140293771 TCCCAGCAGATCCCCTTAAAAGG + Intronic
983238907 4:165208989-165209011 TCCCATTAGCTCTCCTAAAAGGG - Intronic
985786982 5:1901458-1901480 TCCCATTAGAGCCACTGGTTGGG - Intergenic
988688284 5:33547311-33547333 CCACCTCAGATCCCCTGAATTGG + Intronic
990983016 5:61618548-61618570 TCTCTTTAGAGCCCCTGAATGGG - Intergenic
997734541 5:136203665-136203687 TGCCATTAGAGCCCCAGAGTGGG - Intergenic
998054862 5:139065724-139065746 TCCCATTAGTTGCCCAGGATTGG - Intronic
999013912 5:148075777-148075799 TCCCATTTCATCCCCTGGCTTGG + Intronic
1004885605 6:20049029-20049051 TTCCATTAGATCGCCTGGTTTGG - Intergenic
1011749480 6:90440429-90440451 TCCCATCAATTACCCTGAATTGG - Intergenic
1029466467 7:100728439-100728461 TCCCATTCAATCCCCTGCCTTGG + Intergenic
1030131230 7:106202534-106202556 TCTCATTAGATCCCAGGAAAAGG - Intergenic
1038038923 8:23707607-23707629 TCGCATTAGATCTCCAGAAAAGG + Intergenic
1044003735 8:86916597-86916619 TCCAATAAGATCCCAGGAATTGG - Intronic
1045018096 8:98016523-98016545 TCCCATTTGATTCTCAGAATTGG + Exonic
1045878932 8:107015063-107015085 TCCCAGTAGATCCCATCACTGGG + Intergenic
1048997792 8:139804867-139804889 TCCCATGAGGACCCCTGTATGGG + Intronic
1049333205 8:142066376-142066398 CCCCATTAGGTTCCCTGGATAGG - Intergenic
1191230334 X:58088566-58088588 TCCCATTAGAATGCCTGAAGTGG - Intergenic
1194703762 X:97148989-97149011 TCCCATTAGGTCCTATGACTTGG - Intronic
1194758852 X:97769832-97769854 TCCCACTAGACTCCATGAATAGG - Intergenic