ID: 905925229

View in Genome Browser
Species Human (GRCh38)
Location 1:41745004-41745026
Sequence CAGAACCACAATCCTGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 144}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905925229_905925233 6 Left 905925229 1:41745004-41745026 CCAGTCTCAGGATTGTGGTTCTG 0: 1
1: 0
2: 4
3: 15
4: 144
Right 905925233 1:41745033-41745055 GTAAGCTCCAGCCAGAACCTGGG 0: 1
1: 0
2: 1
3: 11
4: 140
905925229_905925239 25 Left 905925229 1:41745004-41745026 CCAGTCTCAGGATTGTGGTTCTG 0: 1
1: 0
2: 4
3: 15
4: 144
Right 905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG 0: 1
1: 0
2: 0
3: 11
4: 115
905925229_905925232 5 Left 905925229 1:41745004-41745026 CCAGTCTCAGGATTGTGGTTCTG 0: 1
1: 0
2: 4
3: 15
4: 144
Right 905925232 1:41745032-41745054 TGTAAGCTCCAGCCAGAACCTGG 0: 1
1: 0
2: 0
3: 8
4: 139
905925229_905925234 7 Left 905925229 1:41745004-41745026 CCAGTCTCAGGATTGTGGTTCTG 0: 1
1: 0
2: 4
3: 15
4: 144
Right 905925234 1:41745034-41745056 TAAGCTCCAGCCAGAACCTGGGG 0: 1
1: 0
2: 0
3: 7
4: 152
905925229_905925235 8 Left 905925229 1:41745004-41745026 CCAGTCTCAGGATTGTGGTTCTG 0: 1
1: 0
2: 4
3: 15
4: 144
Right 905925235 1:41745035-41745057 AAGCTCCAGCCAGAACCTGGGGG 0: 1
1: 0
2: 4
3: 29
4: 262
905925229_905925240 26 Left 905925229 1:41745004-41745026 CCAGTCTCAGGATTGTGGTTCTG 0: 1
1: 0
2: 4
3: 15
4: 144
Right 905925240 1:41745053-41745075 GGGGGTCCCAGCACTATCAAGGG 0: 1
1: 0
2: 0
3: 5
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905925229 Original CRISPR CAGAACCACAATCCTGAGAC TGG (reversed) Intronic
905925229 1:41745004-41745026 CAGAACCACAATCCTGAGACTGG - Intronic
907818804 1:57946686-57946708 CGTTACCAGAATCCTGAGACAGG - Intronic
908260334 1:62335337-62335359 CAAAAACAAAAACCTGAGACTGG + Intergenic
908962670 1:69718279-69718301 CTCTACCACATTCCTGAGACTGG - Intronic
909132993 1:71763116-71763138 CAGAACCAAAATCAAGATACAGG - Intronic
910966195 1:92810456-92810478 GAGAGCCACAAGCCTGAGAGTGG + Intergenic
912149018 1:106833436-106833458 CAGAACCACAAGCTTGAGAGGGG - Intergenic
912366838 1:109140742-109140764 CAAAAGGACAATGCTGAGACTGG + Intronic
912697127 1:111849902-111849924 CAGATCCAGAATCCTGTCACAGG - Intronic
915635237 1:157181739-157181761 CAGAACCTCACTGCTGAGAGGGG - Intergenic
918344757 1:183597285-183597307 CACAAAAACTATCCTGAGACAGG - Intronic
923479888 1:234373940-234373962 CAGAACCACAGTTCTCAGCCGGG + Intronic
924625767 1:245695474-245695496 CAGAACCTCAATCCCGTGAATGG - Intronic
1063438680 10:6054703-6054725 CAGAACCACCATTCAGAGCCAGG + Intronic
1063510170 10:6637009-6637031 CAGCTCCTCAATCCTGAGAATGG - Intergenic
1067107264 10:43374564-43374586 CAGAACCAGAACCAGGAGACAGG - Intronic
1068578536 10:58711908-58711930 CAGAAAGACAAGCCAGAGACGGG + Intronic
1073256335 10:102153967-102153989 CAGAATCCTAATCCTGAGGCCGG - Intronic
1074556887 10:114499693-114499715 CAAAACCACAAACCTGAGGGTGG + Intronic
1075048808 10:119166529-119166551 CAGAAACAAAACCCTGAGATAGG - Intergenic
1077225791 11:1438620-1438642 CAGAGCCACCAGCCTGAGGCTGG + Intronic
1078299161 11:10108011-10108033 CAGTACCACAATCATGATAGTGG - Intronic
1078877803 11:15415518-15415540 CAGTAGCCCATTCCTGAGACAGG - Intergenic
1079526240 11:21392108-21392130 CAGAAATACTATACTGAGACAGG - Intronic
1080589405 11:33708386-33708408 TAGAATCTCAATCCTGAGAGAGG + Intronic
1081799824 11:45850366-45850388 GAGAACCTCAGTCCTGAGACGGG + Intronic
1084585965 11:70062636-70062658 CAGAACCCCCTTGCTGAGACAGG - Intergenic
1085642271 11:78200057-78200079 TAGAATCACAAGCCTGAGAGGGG - Intronic
1085762760 11:79256459-79256481 CAGAACCAGAATCCCAAGCCAGG + Intronic
1087522160 11:99252707-99252729 AAGAATCAAAATCCTGAGAAAGG - Intronic
1089914968 11:122145196-122145218 TAGAATCAAAATCCTGACACAGG + Intergenic
1091409496 12:229791-229813 CAGAGGCACAAGCCTGATACGGG + Intronic
1095795915 12:46218632-46218654 CAGAACCACTTTATTGAGACAGG + Intronic
1098572833 12:72008377-72008399 CAGAATCAGAATCCTGAGATGGG + Intronic
1100615006 12:96224264-96224286 CATCACCACAATCCTGAGACAGG - Intronic
1100615021 12:96224417-96224439 CATCACCACAATCCTGAGACAGG - Intronic
1101969562 12:109303529-109303551 GAGAACCACCATCCAGAGAGAGG + Intronic
1103487949 12:121295926-121295948 CAGAGCCCCAATGCTGAGAGGGG + Intronic
1103964457 12:124629806-124629828 CAGAGCCACCATGCTGAGGCAGG - Intergenic
1105398655 13:20066880-20066902 CAGAACTATCATCATGAGACTGG - Exonic
1112889971 13:104217694-104217716 CAGAGCCACACTCCTGAGAGTGG - Intergenic
1121752832 14:96372444-96372466 CAGATACACAATCCTGAAATAGG + Intronic
1122713075 14:103674896-103674918 CAGAATCAATGTCCTGAGACAGG - Intronic
1124720671 15:32108596-32108618 CAGGTCCACAATCCTGAGCCCGG - Intronic
1124832208 15:33160134-33160156 CAGATCCACAATCCACAGGCTGG - Intronic
1129318255 15:74759258-74759280 CAGTCCCACAATCCTGACTCAGG - Intergenic
1129670869 15:77607083-77607105 GAGAACCACAAACCTCAGAGAGG - Intergenic
1131544064 15:93301034-93301056 CAGAAACACAACCCAGAGCCTGG - Intergenic
1132547324 16:539387-539409 GAGAACGTTAATCCTGAGACGGG - Intronic
1133013665 16:2929072-2929094 CAGGCCCACATGCCTGAGACAGG + Intronic
1134694364 16:16212227-16212249 CAGAACCCCTGTCCAGAGACTGG - Exonic
1134977469 16:18582403-18582425 CAGAACCCCTGTCCAGAGACTGG + Intergenic
1141098327 16:81178770-81178792 CAGAACCAGGATCCGGAAACAGG + Intergenic
1141626155 16:85262272-85262294 CAGAACCACTAACAAGAGACGGG - Intergenic
1144167565 17:12627097-12627119 CAGAAATACAATTCTGAGGCCGG - Intergenic
1144740914 17:17581742-17581764 CACCACCACCCTCCTGAGACAGG - Intronic
1145800237 17:27678107-27678129 CAGAACCACACTCCTGCAGCTGG + Intergenic
1146148586 17:30445648-30445670 CAGAACCACACTCCTGCAGCTGG - Intronic
1148202503 17:45758630-45758652 CAGAACTACAGTCCTCAGAGTGG + Intergenic
1148340726 17:46872047-46872069 GAGAGCCACATTCCTGAGAGGGG - Intronic
1152351575 17:79786531-79786553 CAGAACAGAAATCCTGATACTGG - Exonic
1155220174 18:23678056-23678078 CAGGACCAAAAGCCTGAGAATGG + Intergenic
1158630078 18:59104881-59104903 TAAAAACACAATTCTGAGACAGG - Intergenic
1167806870 19:51793111-51793133 CCGAGCCAGAATCATGAGACAGG - Intronic
1168421449 19:56206719-56206741 CAGAAATACCATCCTGAGGCAGG + Intronic
1168492741 19:56824005-56824027 CAGAACCACCATCCTGAGTCAGG - Intronic
926820527 2:16847161-16847183 CAGAACGACAATGGTGAGGCTGG - Intergenic
926863641 2:17335799-17335821 CAGAAGCTCAATCCAGAGAAGGG - Intergenic
927655026 2:24938015-24938037 CAGAAACAAAATCCTTAGAGTGG + Intergenic
928918177 2:36496794-36496816 CAGAACCACAATGCTGACTTGGG - Intronic
933752840 2:85614074-85614096 CATCACCACAATCAAGAGACGGG - Intronic
935350410 2:102147572-102147594 CAGAACCAGAACCCAGAGACAGG - Intronic
939519476 2:143211697-143211719 TGGATCCACAATGCTGAGACAGG - Intronic
942123621 2:172802259-172802281 CAGAAAGACATACCTGAGACTGG + Intronic
949070432 2:242021151-242021173 CAGATCCCCAATCCTCAAACGGG - Intergenic
949070516 2:242021566-242021588 CAGATCCCCAATCCTCAAACGGG - Intergenic
949070564 2:242021811-242021833 CAGATCCCCAATCCTCAAACGGG - Intergenic
1169392535 20:5202290-5202312 AAGAACGACAAACCTGAGAAAGG + Intergenic
1170124332 20:12946573-12946595 CAAAAACACAATCCACAGACAGG - Intergenic
1172405824 20:34688123-34688145 AAGAACCATAATTCTGAGGCCGG + Intergenic
1175530681 20:59672667-59672689 CAGAACCACACCGCTGAGTCAGG - Intronic
1176296336 21:5075397-5075419 CAGATTCACACTCCTGAGGCAGG + Intergenic
1179860713 21:44186724-44186746 CAGATTCACACTCCTGAGGCAGG - Intergenic
1179897016 21:44368914-44368936 GAGAACCGCGATCCTGAGACTGG + Intronic
1181078486 22:20397474-20397496 CAGCACCACAATCATGATATGGG + Intronic
1181491934 22:23265581-23265603 CAGAACCACAACCCAGAGCAGGG - Intronic
1181978481 22:26749461-26749483 CTGAACCAAAATCCTGCGGCTGG - Intergenic
1182720499 22:32394587-32394609 TAGAACCACCATCCTGAGCAAGG + Intronic
1182834047 22:33326987-33327009 CAGACCCAAAACCCTAAGACAGG - Intronic
1184602088 22:45549632-45549654 CATAAACACATTCCTGAGCCGGG + Intronic
1184960671 22:47926201-47926223 CATACCCACATTTCTGAGACTGG + Intergenic
949437274 3:4043084-4043106 CAGAGCCACAGTGCTGAGGCAGG - Intronic
951447048 3:22795035-22795057 CAGAACAACACCACTGAGACAGG - Intergenic
953480160 3:43244401-43244423 GAGAACCACAAAGCTGACACAGG + Intergenic
954656466 3:52197276-52197298 CAGACTGACATTCCTGAGACGGG + Intergenic
956192948 3:66624435-66624457 CAGCACCACAATCAAGACACAGG + Intergenic
958892474 3:99795831-99795853 CAGAACTACAACCCGCAGACAGG + Exonic
960445730 3:117746574-117746596 CCAAACCAAATTCCTGAGACTGG + Intergenic
963936851 3:151062356-151062378 AAAAACCATAATCCTGAGACAGG + Intergenic
965116066 3:164490599-164490621 CAGAACCACAATTTTGAGACAGG - Intergenic
968632330 4:1658521-1658543 CAGCACCACACTCCAGAGCCTGG - Intronic
972966021 4:44510847-44510869 CAGAAACACAATGGTGAGAATGG - Intergenic
973813126 4:54592562-54592584 CAGAATCACATTCCAGAGGCAGG + Intergenic
977757777 4:100693835-100693857 GAGAAAGACAAACCTGAGACTGG - Intronic
978337853 4:107688939-107688961 CACACCCACAATCCTAAGAGTGG + Intronic
981241909 4:142487277-142487299 CATAAACACATACCTGAGACTGG - Intronic
981366837 4:143913591-143913613 CAGAACCTCAACCCTGAGTTAGG - Intergenic
983298142 4:165891937-165891959 AAGAAAGACAAACCTGAGACTGG + Intronic
983797093 4:171877525-171877547 CTGTACCACAATGCTGAGGCTGG - Intronic
984858439 4:184215924-184215946 CAGATCCACACTCCTGATATTGG - Intronic
986533098 5:8759633-8759655 GATAACGACAAACCTGAGACTGG - Intergenic
990391536 5:55326626-55326648 CAGAACAACCATCCTTAGTCTGG - Intronic
990401219 5:55439229-55439251 CAGAAGCACATTCCTGAGTCAGG - Intronic
991402413 5:66266197-66266219 CAATACCAAAATCCTGAGATTGG - Intergenic
992182569 5:74212566-74212588 CAGCTCCACTAGCCTGAGACAGG + Intergenic
992639824 5:78759640-78759662 TAGAACAACATACCTGAGACTGG + Intronic
996304655 5:122033458-122033480 CAGAAGCACAATACTGATATTGG - Intronic
999605877 5:153315302-153315324 AAGTACTACATTCCTGAGACAGG - Intergenic
1001215628 5:169853249-169853271 AAGAAACACATACCTGAGACTGG - Intronic
1003141664 6:3476681-3476703 CAGAACCCCCATTCTGATACTGG + Intergenic
1003268029 6:4583670-4583692 CAGAACCACAATCCTTAGTGGGG + Intergenic
1005753786 6:28907479-28907501 GATAACCACATGCCTGAGACTGG + Intronic
1007339408 6:41181009-41181031 CAGAACCACATCCTTGACACTGG + Intergenic
1007583227 6:42972034-42972056 GAGCACCACCACCCTGAGACTGG + Intronic
1007971624 6:46057457-46057479 GATAAACACAAACCTGAGACTGG - Intronic
1008541257 6:52548213-52548235 CAGGACCAGAATCCAGAGTCAGG + Intronic
1015101805 6:129490440-129490462 CAGAACCACACTACAGAGAGAGG + Intronic
1017009387 6:150053037-150053059 CAGCTCCACAACCCTCAGACAGG + Intergenic
1017376975 6:153782109-153782131 CATAACCACAATACTGTGACAGG - Intergenic
1019684721 7:2374850-2374872 GAGAACCACAACCCGCAGACAGG - Intronic
1019912338 7:4108153-4108175 CAGGAGCACAATGCTGAGACTGG - Intronic
1020092816 7:5350709-5350731 CAGAAGCACAATTCTGACACTGG + Intronic
1023555165 7:41414554-41414576 TAGACACACAATCCTGAGGCAGG + Intergenic
1023899738 7:44466547-44466569 CAGAACCACATGGCTGAGCCTGG - Intronic
1024686173 7:51748241-51748263 AAGAAAGACAAACCTGAGACTGG + Intergenic
1029116747 7:98241496-98241518 GAGACCCACATGCCTGAGACTGG - Intronic
1029564384 7:101325981-101326003 AACAACCACATACCTGAGACTGG + Intergenic
1030267396 7:107634506-107634528 TATAACAACATTCCTGAGACTGG + Intergenic
1031107489 7:117562983-117563005 CACAACCAAATTCCTGAGACTGG - Intronic
1032895847 7:136250025-136250047 CAGAACCACAAGCAAGGGACTGG - Intergenic
1035664886 8:1373470-1373492 CAGAAACACAAACCTGATCCCGG - Intergenic
1037127710 8:15370836-15370858 GAGAACTACAAGCCAGAGACGGG - Intergenic
1041818981 8:62007371-62007393 TAGAACCATAAGCCTGATACTGG - Intergenic
1042811866 8:72834570-72834592 CTGAGCCACAAACCTGAGCCAGG + Intronic
1043241374 8:77939249-77939271 CAGAAAGACACACCTGAGACTGG + Intergenic
1047049807 8:121098313-121098335 CATAAACACATACCTGAGACTGG + Intergenic
1048664732 8:136648163-136648185 CAACAGCACAATCCAGAGACTGG + Intergenic
1049283768 8:141763583-141763605 CAGAATCACAGGCCTGAGCCTGG + Intergenic
1050210628 9:3251724-3251746 CAGAAAAACAATACTGAGTCAGG + Intronic
1051977397 9:22967905-22967927 CAGAACCATAATGAAGAGACTGG - Intergenic
1052322748 9:27185551-27185573 CAGACCCAAACTCCTGAGTCAGG - Exonic
1053833831 9:42112423-42112445 GAGAACCTCACTCCTGAGAAAGG + Intronic
1055655384 9:78445759-78445781 CAGCAGCACAATCTTGACACAGG - Intergenic
1056859161 9:90163720-90163742 CACAACCACAATCAGGATACAGG + Intergenic
1056969419 9:91190160-91190182 CAGAACCACATCACTGAGGCAGG + Intergenic
1059392103 9:114005811-114005833 TAGAACCACCATCCTGGGAGAGG + Intronic
1059506790 9:114806425-114806447 CAGAAGCACACTCCCCAGACTGG - Intergenic
1061941480 9:133886517-133886539 CAGCACCACACACCTGAGCCTGG + Intronic
1062587073 9:137254231-137254253 CACACACACAATCCTGAGCCTGG - Intergenic
1188124611 X:26352186-26352208 CAGTATCCCACTCCTGAGACTGG + Intergenic
1189341219 X:40206058-40206080 CAGAAACACAATCCTGTGTGAGG - Intergenic
1190652168 X:52577913-52577935 AAGAACCAGTGTCCTGAGACTGG + Intergenic
1191169738 X:57431113-57431135 AAGAAACACAAACCTGAAACAGG - Intronic
1196892927 X:120308234-120308256 CAGATACACAATCCTGGGACTGG - Intronic