ID: 905925239

View in Genome Browser
Species Human (GRCh38)
Location 1:41745052-41745074
Sequence TGGGGGTCCCAGCACTATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905925229_905925239 25 Left 905925229 1:41745004-41745026 CCAGTCTCAGGATTGTGGTTCTG 0: 1
1: 0
2: 4
3: 15
4: 144
Right 905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG 0: 1
1: 0
2: 0
3: 11
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905925239 Original CRISPR TGGGGGTCCCAGCACTATCA AGG Intronic
900203305 1:1420724-1420746 TGGGGGTCCCAGCACTGGGTGGG - Intronic
901940443 1:12657749-12657771 TGGGTGTCCCAGAACTGCCATGG + Intronic
903172559 1:21563133-21563155 TGGCGGTGCCGGCACTGTCAGGG - Exonic
903173934 1:21569708-21569730 CAGGGGTCCCAGCACTACCAAGG - Intronic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
914993433 1:152517816-152517838 TGGAGGTACCACCACCATCAGGG - Intronic
915292780 1:154897561-154897583 AGGGGGTCCCACCACAATCCTGG - Intergenic
917589633 1:176463025-176463047 TGGGTGTTCCCGGACTATCACGG - Intergenic
920656485 1:207879378-207879400 TGGGGGACCCTGGAGTATCAAGG - Intergenic
924282799 1:242454960-242454982 AGGGAGCCCCAGCACAATCAGGG + Intronic
1065779189 10:29151013-29151035 TGGGGGTCTCAGCAGAATGAAGG + Intergenic
1067763607 10:49069211-49069233 TGGAGGTCCCAACACTGTTACGG - Intronic
1072443568 10:95478681-95478703 TGGGGGTCCCAGAACTGTGTTGG - Intronic
1077181815 11:1220300-1220322 TGAGGGTCCCAGCTCTGCCATGG + Intergenic
1081582254 11:44360394-44360416 CAGGGGTCCCAGCATGATCAGGG - Intergenic
1083179733 11:60977411-60977433 TGGGGATCCCAGCCCTACCAGGG - Intronic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1084711581 11:70847130-70847152 TGTGGGTCGCAGCACAGTCAAGG - Intronic
1084731035 11:71073808-71073830 TGGGGGTACCAGAACTATCCTGG + Intronic
1087836228 11:102878061-102878083 TGGGGGTCCCAGCAAAGACATGG - Intergenic
1089683750 11:120133935-120133957 TGGGGGGCCCTGCACTGTCATGG - Intronic
1095749785 12:45697353-45697375 TGGGCATCCCTGCACTCTCAGGG - Intergenic
1096214769 12:49792906-49792928 TGGGGGTCCCACTGCTACCATGG + Exonic
1111405498 13:87799089-87799111 AGAGGGTCCCAGAACTTTCAAGG - Intergenic
1113329759 13:109316796-109316818 TGGGTGTCCCAGCTCTAAAAGGG + Intergenic
1122891164 14:104732913-104732935 TGGGGGTCACAGCACCCTCCTGG - Intronic
1123630533 15:22257538-22257560 TTGGGGACCCGGCACAATCACGG + Intergenic
1124595562 15:31088960-31088982 TGGGGCTCCCAGCACTTTCTTGG + Intronic
1125210428 15:37208547-37208569 TAGGGATCCCAGCACTATGATGG - Intergenic
1129931379 15:79413746-79413768 TGTGTATCCCAGCACTATCTAGG + Intronic
1131300597 15:91196479-91196501 TGCAGGGCCCAGCACTATGAAGG + Intronic
1132331612 15:101015880-101015902 GGAGGGTGCCAGCACTGTCAGGG + Intronic
1136504405 16:30693740-30693762 TGGGGGTTACAGAACCATCAAGG - Intergenic
1139015402 16:62683947-62683969 TGGGTATCCCTGCACTTTCATGG + Intergenic
1141972557 16:87493111-87493133 TTGGGGACCCGGCACAATCACGG - Intergenic
1144600378 17:16607622-16607644 TGGGAGTCCCAGGACAATCCAGG - Intergenic
1147403398 17:40194194-40194216 TGGGGGTCCCAGCCCTGACCAGG - Exonic
1150284645 17:63948065-63948087 TGGGGGCACCAGCACCACCAGGG + Intronic
1152529669 17:80910184-80910206 CGGGGAGCCCAGCACTTTCAGGG - Intronic
1153472987 18:5467930-5467952 TGGGCATCCCTGCACTCTCAGGG + Intronic
1156149375 18:34224173-34224195 TGGGGGTCCCATCATTATTCGGG - Intronic
1157912045 18:51625416-51625438 TGGTGGTCCCAGCATTAACCAGG - Intergenic
1161198839 19:3003019-3003041 GGGGGTGCCCAGCACCATCAGGG + Intronic
1161249978 19:3275385-3275407 TGATGGTCCCCGCACTTTCACGG - Intronic
1161614088 19:5260512-5260534 TGGGGCTCCCAGCACTCTGGGGG + Intronic
1161851464 19:6739941-6739963 TGGGAGTCTCAGCACGCTCAGGG + Intronic
1162163598 19:8737715-8737737 TGAGGGTGCCAGCATGATCAGGG - Intergenic
1162328405 19:10012011-10012033 TGGGGGTCCCAGCACGGTGAGGG - Intergenic
1163126457 19:15246795-15246817 TGGGGGCCCCAGCACTTGCAAGG - Intronic
1163593167 19:18205381-18205403 TGGGCGTCCCAGTACTCCCAGGG - Intergenic
1165746883 19:38234715-38234737 TGGGGGGCCATGCAGTATCAGGG + Intergenic
1168704498 19:58461744-58461766 TGGGTGTCCCACCAGCATCAGGG + Intergenic
927653131 2:24924252-24924274 AGAGGGTCCCAGCAGGATCAAGG - Intergenic
928189383 2:29148170-29148192 TGGGGCTCCCAGGGCTGTCAAGG - Intronic
928427854 2:31193381-31193403 TGGGCATCCCAGCCCTCTCATGG + Intronic
929847247 2:45542366-45542388 TGGGCATCCCTGCACTCTCAGGG - Intronic
930658446 2:54030157-54030179 TGGGGGCCCCAGGACCTTCAAGG + Intronic
931053572 2:58441653-58441675 TGGTGGTCCCAGGACTCCCAAGG + Intergenic
934869567 2:97850461-97850483 TGGTGGTCTCAACACTACCAAGG - Intronic
936462333 2:112722637-112722659 TGAGGGTCCCAGCTCTGTCCTGG + Intronic
937529303 2:122808962-122808984 TGGGGGTCCTAGAACTCCCAAGG - Intergenic
941172307 2:162154302-162154324 TGGGGCTCCCAGTACCATAAGGG + Intergenic
941779483 2:169428468-169428490 TGGAAGTCCCAGCACTAGCTAGG - Intergenic
942045746 2:172098395-172098417 TGCGGGCCCTAGCACTTTCAGGG + Intergenic
1174083720 20:47989751-47989773 GAGGGGTCCCAGCACAAGCAAGG - Intergenic
1175999611 20:62826013-62826035 TGGGGGTCCCACCTCTGCCAAGG + Intronic
1176034480 20:63029517-63029539 GGGGGGTCCCCGCACCTTCACGG - Intergenic
1176148199 20:63574633-63574655 TTGGGGTCCCAGCAGCACCAGGG - Intergenic
1178947279 21:36959111-36959133 TGGGCATCCCTGCACTCTCAGGG + Intronic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
950194297 3:10998419-10998441 GGGGGGTCCCAGCAGTAACCAGG + Intronic
950602759 3:14049364-14049386 TGGGGGTCCCTGTACTACCAGGG + Intronic
954440112 3:50517085-50517107 TGGGGGACCCAGCACCATGGGGG - Intergenic
954647488 3:52140482-52140504 TGGGCTTCCCAGCACCATCAAGG + Intronic
954671586 3:52294009-52294031 TGGGGGTCCCAGCACTGGGATGG + Intergenic
955347278 3:58170463-58170485 TAGGGGCCCCAGCATTATCGTGG + Intronic
957646574 3:82938970-82938992 TGGGCATCCCAGCGCTCTCAGGG + Intergenic
962634871 3:137319986-137320008 TGCGGCTCCCAGCAAGATCAAGG - Intergenic
963253184 3:143120421-143120443 TGGGGGTCCCCGCACCTTCGAGG - Exonic
964927366 3:161975368-161975390 TGGGCATCCCTGCACTTTCAGGG - Intergenic
968055511 3:195688586-195688608 TGGGGGCCTCAGCACTAGGAAGG + Intergenic
968100282 3:195960011-195960033 TGGGGGCCTCAGCACTAGGAAGG - Intergenic
969674627 4:8607992-8608014 GGAGGGTCCCAGCATCATCACGG - Intronic
969876508 4:10139538-10139560 TGGGGGTCCCAGGAGCATCTTGG + Intergenic
971283226 4:25259858-25259880 TGTGGGTCCCTGGACTGTCAGGG + Intronic
982665092 4:158251674-158251696 GGGTGGTCCCAGAACTGTCATGG - Intronic
985186142 4:187318009-187318031 GGGGGGTACCAGCAGTAACAGGG - Intergenic
985503425 5:263362-263384 TGGGGGCCTCAGCACTAGGAAGG + Intergenic
985734268 5:1568923-1568945 TGGGGGCCTCAGCACTAGGAAGG - Intergenic
985815319 5:2124121-2124143 TGGGGGTCCCAGGGCTCACAGGG + Intergenic
985962551 5:3313648-3313670 TGGAGGTCCCAGGTCTACCATGG + Intergenic
986622548 5:9691005-9691027 TGGGCGTCTCTGCACTGTCATGG + Intronic
987911300 5:24149697-24149719 TTGGTCACCCAGCACTATCATGG - Intronic
988695275 5:33615638-33615660 TGGGGGTTTCAGCAATATCTAGG + Intronic
989581201 5:43034700-43034722 TGCTGGTGCCAGGACTATCACGG + Intergenic
989730555 5:44642273-44642295 TGGGCATCCCTGCACTCTCAGGG - Intergenic
993211941 5:84962420-84962442 TGGGCCTCCCTGCACTCTCAGGG - Intergenic
999450772 5:151676182-151676204 TAGGGTTCCCAGCACCATGAGGG - Exonic
1002060386 5:176622119-176622141 TGGGTGTCCCAGCTCCATCCAGG + Intronic
1002692997 5:181063891-181063913 TCAGGGTCCCAGCACGGTCAGGG + Intergenic
1003456939 6:6292045-6292067 TTGAGGTCCCAGCACTTTCCAGG + Intronic
1003631974 6:7795443-7795465 TGGGGATCCCTGAACTAACAGGG - Intronic
1007270148 6:40630201-40630223 TGTGTGTCCCAGCAGTATCCTGG + Intergenic
1010964735 6:82191839-82191861 TGTGGATCTCAGAACTATCATGG - Exonic
1013468216 6:110436252-110436274 TGGTGCCACCAGCACTATCAGGG - Intronic
1015516081 6:134083807-134083829 AGGGGATCCCATCAGTATCAGGG + Intergenic
1017658878 6:156654945-156654967 TGGGTGTCCTAGTACTGTCAGGG - Intergenic
1019270345 7:143627-143649 AGGGGGTCCCAGCCCTGCCAGGG + Intergenic
1020446090 7:8269393-8269415 TGTGGGTCCCAGGACCATGAGGG + Intergenic
1023962237 7:44936482-44936504 TCAGGGTCACAGCACTGTCATGG + Intergenic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1028511016 7:91626435-91626457 TGGAGCTCCCAGGCCTATCAAGG - Intergenic
1029155501 7:98514593-98514615 TGGGTGTCCCAGAAATATCCTGG + Intergenic
1033056571 7:138060232-138060254 TGGGGGTCACACCACCCTCAGGG - Intronic
1036638058 8:10564964-10564986 TGGGGGTTCCTGATCTATCAGGG + Intergenic
1038703191 8:29870543-29870565 TGGAGGTCCCCGCTTTATCATGG - Intergenic
1042856522 8:73273269-73273291 TGGGCATCCCTGCACTCTCAGGG + Intergenic
1050941882 9:11471234-11471256 TGGGCATCCCTGCACTCTCAGGG + Intergenic
1053177500 9:35938645-35938667 TGGAGGGCCCAGCACTTTCCAGG + Intergenic
1061070832 9:128309596-128309618 TGGGAGTCCCAGGACCATCCCGG + Exonic
1061712885 9:132499641-132499663 TGGAGGTACCAGCTCAATCAGGG + Intronic
1186801160 X:13093438-13093460 TGGGGGCCCCAGGAGTCTCAGGG - Intergenic
1189772626 X:44441641-44441663 AGGGTCTCCCAGCACCATCAAGG - Intergenic
1189772944 X:44444323-44444345 AGGGTCTCCCAGCACCATCAAGG - Intergenic
1190023792 X:46903779-46903801 TGGGAGTCCCAGCGGTACCAGGG + Intergenic
1191016254 X:55813395-55813417 TGGGTATCCCTGCACTCTCAGGG + Intergenic
1194655688 X:96570531-96570553 TGGGCATCCCAGCACTGTCCAGG + Intergenic