ID: 905925239

View in Genome Browser
Species Human (GRCh38)
Location 1:41745052-41745074
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905925229_905925239 25 Left 905925229 1:41745004-41745026 CCAGTCTCAGGATTGTGGTTCTG 0: 1
1: 0
2: 4
3: 15
4: 144
Right 905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG 0: 1
1: 0
2: 0
3: 11
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type