ID: 905925922

View in Genome Browser
Species Human (GRCh38)
Location 1:41749746-41749768
Sequence CAACTTATTTGTTTTGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 658
Summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 602}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905925922_905925930 27 Left 905925922 1:41749746-41749768 CCATCTGCAAAACAAATAAGTTG 0: 1
1: 0
2: 4
3: 51
4: 602
Right 905925930 1:41749796-41749818 CTACGGAGCTCCGGGGGCACAGG 0: 1
1: 0
2: 0
3: 4
4: 84
905925922_905925924 -10 Left 905925922 1:41749746-41749768 CCATCTGCAAAACAAATAAGTTG 0: 1
1: 0
2: 4
3: 51
4: 602
Right 905925924 1:41749759-41749781 AAATAAGTTGGACTTGTGAGTGG 0: 1
1: 0
2: 0
3: 10
4: 173
905925922_905925929 21 Left 905925922 1:41749746-41749768 CCATCTGCAAAACAAATAAGTTG 0: 1
1: 0
2: 4
3: 51
4: 602
Right 905925929 1:41749790-41749812 TGTGCTCTACGGAGCTCCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 54
905925922_905925925 10 Left 905925922 1:41749746-41749768 CCATCTGCAAAACAAATAAGTTG 0: 1
1: 0
2: 4
3: 51
4: 602
Right 905925925 1:41749779-41749801 TGGCTTCAGCATGTGCTCTACGG 0: 1
1: 0
2: 0
3: 9
4: 174
905925922_905925932 29 Left 905925922 1:41749746-41749768 CCATCTGCAAAACAAATAAGTTG 0: 1
1: 0
2: 4
3: 51
4: 602
Right 905925932 1:41749798-41749820 ACGGAGCTCCGGGGGCACAGGGG 0: 1
1: 0
2: 0
3: 11
4: 135
905925922_905925926 18 Left 905925922 1:41749746-41749768 CCATCTGCAAAACAAATAAGTTG 0: 1
1: 0
2: 4
3: 51
4: 602
Right 905925926 1:41749787-41749809 GCATGTGCTCTACGGAGCTCCGG 0: 1
1: 0
2: 0
3: 4
4: 73
905925922_905925931 28 Left 905925922 1:41749746-41749768 CCATCTGCAAAACAAATAAGTTG 0: 1
1: 0
2: 4
3: 51
4: 602
Right 905925931 1:41749797-41749819 TACGGAGCTCCGGGGGCACAGGG 0: 1
1: 0
2: 1
3: 5
4: 69
905925922_905925928 20 Left 905925922 1:41749746-41749768 CCATCTGCAAAACAAATAAGTTG 0: 1
1: 0
2: 4
3: 51
4: 602
Right 905925928 1:41749789-41749811 ATGTGCTCTACGGAGCTCCGGGG 0: 1
1: 0
2: 0
3: 1
4: 57
905925922_905925927 19 Left 905925922 1:41749746-41749768 CCATCTGCAAAACAAATAAGTTG 0: 1
1: 0
2: 4
3: 51
4: 602
Right 905925927 1:41749788-41749810 CATGTGCTCTACGGAGCTCCGGG 0: 1
1: 0
2: 0
3: 4
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905925922 Original CRISPR CAACTTATTTGTTTTGCAGA TGG (reversed) Intronic
901264598 1:7900774-7900796 CAATTTTTTTTTTTTGGAGATGG - Intergenic
902161867 1:14536876-14536898 CAACTTTTTTTTTTTTGAGACGG - Intergenic
902444623 1:16454358-16454380 CTACTTATTTATTTTTAAGAAGG + Intronic
903051759 1:20606328-20606350 CCGCTTTTTTGTTTTGGAGACGG - Intronic
903587789 1:24429448-24429470 CAGCTTATATATTTTTCAGAAGG - Intronic
904046557 1:27612746-27612768 CAACCTACTTGTTTTACAGATGG - Exonic
904135609 1:28310084-28310106 TAACATAATTGCTTTGCAGAAGG - Intergenic
904176713 1:28634923-28634945 CTACTTATTTATTTTTTAGATGG - Intronic
904238602 1:29129679-29129701 CTACTTGTTTGTTTTTGAGATGG + Intergenic
904367186 1:30020982-30021004 CAACTTCATTCCTTTGCAGATGG + Intergenic
904559311 1:31386096-31386118 CAACTTTTTTGGTTTATAGATGG + Intergenic
905195720 1:36275717-36275739 CAACTTTGTTGTTTTGCATGTGG - Intronic
905375467 1:37517233-37517255 CAACTTTTTTTTTTTTAAGATGG - Intergenic
905925922 1:41749746-41749768 CAACTTATTTGTTTTGCAGATGG - Intronic
907725055 1:57012377-57012399 TAACTTTTTTGTTTCCCAGATGG + Intronic
908376109 1:63543135-63543157 CAAATTTATTCTTTTGCAGATGG + Intronic
908760918 1:67511113-67511135 CAACTTTTTTTTTTTTGAGATGG + Intergenic
909284507 1:73797827-73797849 CATTTTATTTGTTTTGGAAAAGG - Intergenic
909402887 1:75254040-75254062 CAACTTTTTTTTTTTTTAGACGG + Intronic
910345835 1:86236594-86236616 CAACTTTTTTGTTTCCCTGAAGG - Intergenic
911506600 1:98760240-98760262 CAAGTTGTTGGTTTTCCAGATGG - Exonic
911589237 1:99727441-99727463 TAATTTATTTTTTTTGCTGAAGG - Intronic
914338714 1:146739873-146739895 GGGATTATTTGTTTTGCAGAAGG + Intergenic
914867822 1:151447365-151447387 CAATTTTTTTGTTTTTAAGATGG - Intronic
915154711 1:153865454-153865476 TAAATTATTTGTTTTTGAGATGG - Intronic
917672947 1:177290873-177290895 CAACTTTATTATTTTGCACATGG + Intergenic
918074167 1:181157323-181157345 CAACTTAATTTTTTTCCAGATGG - Intergenic
918407344 1:184223966-184223988 CACCTGATTTATTTTGGAGATGG + Intergenic
918928471 1:190819795-190819817 CAAATTATCTTTTTTGCAAATGG + Intergenic
920076246 1:203339214-203339236 CATCTTACTTTTTTTGGAGATGG - Intergenic
921091746 1:211850070-211850092 CAACTTTATTCTTTTGCATATGG + Intergenic
922018454 1:221676837-221676859 CAATTTCTTTGTGTTGCAGAAGG + Intergenic
922115785 1:222612444-222612466 CAACTTAATTCTTTTGCACATGG + Intergenic
922356691 1:224783029-224783051 CACCTTATTTGTGTTGGAGGTGG - Intergenic
922873815 1:228924245-228924267 CAAGTTATGTTTTTTGCAAATGG - Intergenic
924111894 1:240708395-240708417 CAACTTTTTTTTTTTTGAGACGG + Intergenic
924316200 1:242800046-242800068 CAAATTAATTGATTTGCACAAGG + Intergenic
924333148 1:242960476-242960498 CAACTTCATTGTTTTGCATGTGG + Intergenic
924374793 1:243394141-243394163 CTATTTCTTTTTTTTGCAGAAGG + Intronic
924568135 1:245214834-245214856 TTACTTATTTATTTTTCAGACGG - Intronic
924645564 1:245874207-245874229 CAAATTCTTGGTTTGGCAGAAGG - Intronic
924684259 1:246271495-246271517 CAACTTCATTCTTTTGCATATGG + Intronic
1063237701 10:4135545-4135567 CAAGTGATTGGTTTTGCACAGGG + Intergenic
1063390511 10:5647329-5647351 CAACTTAAATGTTTTGTTGAGGG - Intronic
1063402196 10:5756901-5756923 CAAGTTATTTGTAGGGCAGATGG + Intronic
1063999218 10:11649438-11649460 CAACTTTTTTCTTTTTGAGACGG - Intergenic
1064181918 10:13124790-13124812 CAACTTATTTGTGTTGGGCAAGG + Intronic
1064540685 10:16402495-16402517 CAACTTTTTTTTTCTTCAGATGG + Intergenic
1064807435 10:19152006-19152028 CAAGGTACCTGTTTTGCAGAAGG + Intronic
1064809424 10:19178180-19178202 CAACTGATTTGGTGTTCAGATGG - Intronic
1064830078 10:19453870-19453892 CAATTTTTTTTTTTTTCAGACGG - Intronic
1065057300 10:21859786-21859808 CAACTTTTTTTTTTTTGAGACGG + Intronic
1065511377 10:26481645-26481667 CAGCTAATTTTTTTGGCAGAGGG + Intronic
1066609598 10:37227329-37227351 CAACTTTTTTCTTTTGCATATGG + Intronic
1067818306 10:49501469-49501491 CAACTTCTGTTTTTTGCAGGGGG - Intronic
1068330910 10:55567223-55567245 CAACTTTATTATTTTGCATATGG - Intronic
1069088305 10:64168268-64168290 CAACTTCATTCTTTTGCATATGG + Intergenic
1069165333 10:65151040-65151062 CAACATCATTGTTTTGCACATGG - Intergenic
1069327566 10:67250218-67250240 CAACTTTTTTTTTTTTGAGATGG + Intronic
1070167256 10:73908186-73908208 CAACTAATTTGTATTACAGCGGG + Intergenic
1070224417 10:74485980-74486002 CATCTTATTTGTCTTGAAGATGG - Intronic
1070389823 10:75959922-75959944 CCACTTATATTTTTTGCAAAAGG - Intronic
1070529938 10:77327776-77327798 AAACTTTTTTTTTTTGCAGTGGG - Intronic
1071209740 10:83325939-83325961 CAACTTAATTCTTTTGCATATGG + Intergenic
1071235105 10:83636417-83636439 GAGCTTACTTTTTTTGCAGAGGG + Intergenic
1071440941 10:85693728-85693750 CAACTTCATTCTTTTGCATATGG - Intronic
1071934615 10:90514589-90514611 TAATTTATTTGTTTTGCTCAGGG - Intergenic
1072310915 10:94154264-94154286 CAACTTCATTGTTTGGCATATGG - Intronic
1072423026 10:95305545-95305567 CAATTTATTTATTTTTTAGATGG + Intergenic
1073365004 10:102932526-102932548 CAACTTTATTGTTTTGCATGTGG + Intronic
1073711109 10:106042842-106042864 CAACTTCATTATTTTGCATATGG - Intergenic
1073732767 10:106310215-106310237 CAATATATTTCTTTTGGAGATGG + Intergenic
1074305861 10:112278032-112278054 CACCTTTTTTTTTTTGGAGATGG + Intergenic
1074419293 10:113294925-113294947 CAAATTATTTGTTTCCTAGAAGG + Intergenic
1074619266 10:115101865-115101887 CAACTTATTTAATATACAGAAGG + Intronic
1074842663 10:117371187-117371209 TTACTTATTTATTTTGGAGACGG + Intronic
1074991324 10:118711082-118711104 CAACATTTTTGTTTTTGAGATGG + Intronic
1075840950 10:125502777-125502799 TAATTTATTTGTTTTTGAGACGG + Intergenic
1077403735 11:2372527-2372549 CAACTTCATTCTTTTGCACATGG + Intergenic
1077532209 11:3102687-3102709 CCACTTCTTTATTGTGCAGATGG - Intronic
1077627046 11:3781452-3781474 CAAAATTTTTTTTTTGCAGAGGG + Intronic
1077955427 11:7014356-7014378 CAACTTATCTGTTTTGTTGTTGG - Intronic
1077957366 11:7035318-7035340 CAACTTCGTTTTTTTGGAGATGG - Intronic
1078311136 11:10244315-10244337 CAATTTCATTGTTTTGCATATGG + Intronic
1078426598 11:11256050-11256072 CAACTTATTTATTTTCCAAATGG + Intergenic
1078632924 11:13019948-13019970 CAACTTTATTCTTTTGCATATGG + Intergenic
1078804915 11:14689072-14689094 CCACATATTTGTTTTAGAGAGGG + Intronic
1079274084 11:19017385-19017407 ATACTTAATTGTTCTGCAGATGG + Intergenic
1079426636 11:20348812-20348834 CAAATTATGTTTTTGGCAGATGG - Intergenic
1080428799 11:32179648-32179670 CCACTTTTTTGTTTTTGAGACGG + Intergenic
1080543226 11:33289436-33289458 CACTTTATTTTTTTTTCAGAGGG - Intronic
1081228656 11:40557303-40557325 CAACTTACTTGATTGTCAGAAGG + Intronic
1081283339 11:41238628-41238650 TAACTTATTTGTTTTGAACATGG + Intronic
1081637467 11:44729963-44729985 CAACATATTCATTTTACAGACGG - Intronic
1081853387 11:46289372-46289394 CATCTTTTTTGTTTTGGAGATGG - Intronic
1083348046 11:62007380-62007402 CAACTTCTTTCTTTTGAACATGG - Intergenic
1083798376 11:65031890-65031912 CAACTTTTTTTTTTTTGAGATGG - Intronic
1084266837 11:68009352-68009374 TGACCTCTTTGTTTTGCAGAAGG + Intronic
1085017089 11:73181153-73181175 CAACTTTGTTCTTTTGCAGGTGG + Intergenic
1085119807 11:73959765-73959787 TTACTTATTTTTTTTGGAGATGG + Intronic
1085733458 11:79018878-79018900 CAACTTATTCATTTCACAGAGGG + Intronic
1086228091 11:84536755-84536777 CAACTTATTAAATTGGCAGATGG - Intronic
1086339324 11:85831432-85831454 CAGTTTAATTGTTTTTCAGATGG - Intergenic
1086780897 11:90904661-90904683 CAAATTCCTTGTTTTGCACAGGG - Intergenic
1087590544 11:100182592-100182614 CTATTTATTTATTTTGCAAATGG - Intronic
1088502992 11:110501742-110501764 TAACTTATTTGTTTTAGATAGGG - Intergenic
1088512199 11:110589260-110589282 CACCTCATCTGTTTTGCACAGGG - Intronic
1089511565 11:119001394-119001416 TAACTTTTTTTTTTTGGAGAGGG + Intronic
1089528050 11:119109585-119109607 CATCTTATTTATTTGGAAGAAGG + Intronic
1090328281 11:125907601-125907623 CAACTTTTTTTTTTTTGAGACGG - Intronic
1091364826 11:135009062-135009084 CAACTTTTTTTTTTTGGAGATGG - Intergenic
1092034351 12:5318237-5318259 CCACTTTTTTGTTGTACAGATGG + Intergenic
1092346782 12:7721800-7721822 CTACTTAATTCTTTTGCATATGG + Intergenic
1092851226 12:12628818-12628840 CAACTTAATTATTTTGCAAGTGG + Intronic
1093954651 12:25202226-25202248 CAACTTTTTTTTTTTTGAGATGG - Intronic
1094714228 12:32996101-32996123 CAACTTATTTGGCTTGCATATGG - Intergenic
1095457541 12:42404731-42404753 AAAAATATTTGTTTTGCAGCCGG + Intronic
1095582075 12:43812073-43812095 AAACTTTTTTTTTTTGCAGATGG - Intergenic
1095670233 12:44850732-44850754 CAAATTATTTGTTTTGTTGCTGG - Intronic
1096740159 12:53687449-53687471 CAATCTGTTTGTTTTGCTGAGGG + Intergenic
1097021784 12:56025938-56025960 CAACTTTTTTCTTTTTGAGATGG + Intronic
1097259021 12:57703449-57703471 CAACTTCATTGTTTTGAATATGG + Intronic
1098328296 12:69325482-69325504 CAAGTTTTTTTTTTTGCATATGG - Intergenic
1098607233 12:72406218-72406240 CAACTGATCTATTTTGGAGAAGG - Intronic
1099399944 12:82191881-82191903 CAAATTATCTCTTTTGCAGAAGG + Intergenic
1099426626 12:82531537-82531559 CCACTTACTTGTTTTAAAGATGG - Intergenic
1099705334 12:86145387-86145409 CAATTTATTTTTCTTGCACAAGG - Intronic
1100364944 12:93911430-93911452 AAACTTAGATGATTTGCAGAGGG + Intergenic
1100794436 12:98165218-98165240 CCTCTCTTTTGTTTTGCAGATGG - Intergenic
1100841564 12:98618173-98618195 CAATTTTTTTGTTTTAGAGATGG - Intronic
1101499266 12:105287035-105287057 CAACTTTATTGTTTTGGAGATGG + Intronic
1101753304 12:107601154-107601176 CATCTTCCCTGTTTTGCAGAGGG + Intronic
1104338389 12:127923105-127923127 TTACTTATTTGTTTTTTAGAAGG - Intergenic
1104445762 12:128832119-128832141 CACCTTTTTTTTTTTGGAGATGG - Intergenic
1104776772 12:131393976-131393998 CAATTCATCTGATTTGCAGATGG + Intergenic
1105328512 13:19392395-19392417 CAACATTTTTCTTTTCCAGATGG + Intergenic
1105357664 13:19673804-19673826 GAACTGCTTTGTTTTCCAGAGGG - Intergenic
1105411162 13:20172843-20172865 CAACTTGATTGTTTTGCATGTGG - Intergenic
1105474770 13:20720527-20720549 CAACTTGTTCATTTTGCAGGCGG + Intronic
1105774784 13:23647777-23647799 CAACTTCATTCTTTTGCAGGTGG + Intronic
1105863360 13:24437158-24437180 CAACTTTATTCTTTTCCAGATGG - Intronic
1106050424 13:26185170-26185192 CAAATTATTTTTTGTACAGATGG + Intronic
1106588817 13:31080612-31080634 CAACATATGTGTTTTGGGGAAGG - Intergenic
1106740163 13:32632008-32632030 CAACTTAATTCTTTTGCATGTGG - Intronic
1106814478 13:33392030-33392052 CAACTTCTTCGTTTTGCAGGTGG + Intergenic
1106825073 13:33511306-33511328 CAACTTTTTTTTTTTTGAGATGG - Intergenic
1106837717 13:33653472-33653494 CAACTTCATTCTTTTGCAAATGG - Intergenic
1106928294 13:34635849-34635871 GAACTTAATTATTTGGCAGAGGG - Intergenic
1107065840 13:36213997-36214019 CAACTTATTTTTCGAGCAGAAGG - Intronic
1107257668 13:38448077-38448099 CAACTTCATTCTTTTGCATATGG + Intergenic
1107311574 13:39083743-39083765 CCACTTTTTTGTTTTGCAGTTGG + Intergenic
1107610861 13:42111571-42111593 CAACATATTTTTTTTTGAGATGG - Intronic
1107844327 13:44495800-44495822 CAACTTAATTTTTTTGCATATGG - Intronic
1108299387 13:49059159-49059181 CAACTTCATTGTTTTGCATGCGG - Intronic
1108336514 13:49447323-49447345 TAACTTATTTGTTCTACAGATGG + Intronic
1109406857 13:61911563-61911585 CATGTTAAGTGTTTTGCAGAAGG + Intergenic
1110382472 13:74869530-74869552 GCACTTTTTTGTTATGCAGATGG + Intergenic
1110432736 13:75443971-75443993 CAGCTTTTTTTTTTTTCAGATGG - Intronic
1110617345 13:77555665-77555687 CAACATATTTGTTTTACAGATGG - Intronic
1111040555 13:82741541-82741563 AAAATTATTTTTGTTGCAGATGG - Intergenic
1111996198 13:95168260-95168282 CAAGTAATTTCTTATGCAGAGGG - Intronic
1112017209 13:95341229-95341251 CCACTTATTTTATTTGCAGTTGG - Intergenic
1112160154 13:96858780-96858802 CAACATATTCATTTTACAGATGG - Intergenic
1113298028 13:108983840-108983862 CAACATAACTGTTTTGCAAATGG - Intronic
1113568096 13:111331755-111331777 CAACTTCATTATTTTGCATATGG + Intronic
1114168410 14:20246017-20246039 CAACTTCTTTCTTTTGCGTATGG - Intergenic
1114507663 14:23230815-23230837 CAACTTTATTCTTTTGCATATGG + Intronic
1114530892 14:23395529-23395551 CAACTTTTTTTTTTTTGAGATGG + Intronic
1114831677 14:26150507-26150529 CACCTTTTTTTTTTTCCAGAGGG - Intergenic
1115112075 14:29836182-29836204 AAACGTGTTTGTTTTGCAGTTGG - Intronic
1115419497 14:33177699-33177721 CAACTTCATTGTTTTGCATGTGG + Intronic
1115466650 14:33722261-33722283 CAACAAATTTGTTTTGCCCATGG + Intronic
1115577031 14:34721818-34721840 CAACTTCATTCTTTTGCATATGG + Intergenic
1116101216 14:40439237-40439259 CATCTTATTTGATATGGAGATGG + Intergenic
1116690782 14:48102987-48103009 ATACTTATTTGATTTGCAAAGGG + Intergenic
1117151829 14:52896980-52897002 TGTTTTATTTGTTTTGCAGATGG - Intronic
1117507557 14:56418100-56418122 ACACTTTTTTGTTTTTCAGACGG - Intergenic
1117660965 14:58004459-58004481 CAACATATATGTTTTTCAGTAGG - Exonic
1118115886 14:62776260-62776282 CAACTTTTTTTTTTTTGAGATGG - Intronic
1118551281 14:66953521-66953543 CAACTTCATTCTTTTGCATATGG + Intronic
1118940766 14:70334510-70334532 CAATTTATTTATTTTTGAGATGG - Intronic
1120956120 14:90083825-90083847 CAACTTAATTCTTTTGCATGTGG + Intronic
1121186578 14:91977445-91977467 CAACTTCATTCTTTTGCACATGG + Intronic
1122308579 14:100780676-100780698 CCACTTGTTTGTTAGGCAGAGGG - Intergenic
1122586728 14:102812912-102812934 CAACTTTTTTTTTTTTGAGACGG - Intronic
1123727164 15:23114635-23114657 CAACTTTTTTTTTTTTGAGATGG + Intergenic
1124418355 15:29492997-29493019 AAACTTTTTTTTTTTGGAGACGG - Intronic
1125054992 15:35348346-35348368 CAACTTCATTGTTTTGCATGTGG + Intronic
1126384658 15:48081889-48081911 CAACTTTATTGTTTTCCAGATGG + Intergenic
1126739168 15:51760389-51760411 CAATTTTTTTGCTTTGAAGATGG - Intronic
1126772638 15:52073144-52073166 CTACTTATTTTTTTTTGAGACGG + Intergenic
1127048935 15:55059654-55059676 GAACTCATTTGTTTTACAGCTGG - Intergenic
1127844247 15:62855849-62855871 CAAATTATTCTCTTTGCAGAAGG - Intergenic
1127917653 15:63468377-63468399 CAACTTTTTTTTTTTTGAGACGG - Intergenic
1128015822 15:64345795-64345817 AAACTTATTTTTTTTTGAGATGG + Intronic
1128592717 15:68916048-68916070 CAACTTAATTCTTTTGCATATGG - Intronic
1128696511 15:69768234-69768256 TAATTTATTTGTTTTGAAAAGGG + Intergenic
1130123579 15:81073229-81073251 CTGCTTATTTGTTTTACAGGTGG + Intronic
1130262529 15:82368504-82368526 CAACTTTTTTCTTTTGCATGTGG + Intergenic
1130278701 15:82500443-82500465 CAACTTTTTTCTTTTGCATGTGG - Intergenic
1130623267 15:85486448-85486470 CAACTTTTTTCTTTTGCATGTGG + Intronic
1131225342 15:90620342-90620364 AAACTTTTTTGTATTGCAAATGG - Intronic
1131246796 15:90801142-90801164 CAACTTTTTTTTTTTTGAGATGG - Intronic
1131297824 15:91167523-91167545 GAAGTGATGTGTTTTGCAGATGG - Intronic
1132892577 16:2211420-2211442 CAACTTTTTTTTTTTTGAGACGG + Exonic
1133245965 16:4448999-4449021 CAACTTCTTTTTTTTTGAGATGG + Intronic
1133789815 16:9000963-9000985 GAGCTTTTTTGTTTTGGAGATGG + Intergenic
1134896425 16:17891406-17891428 TAACTTCTTTCTTTTGCATATGG + Intergenic
1135418058 16:22284066-22284088 CAACTTATTTAGTTTGGGGAGGG + Exonic
1135515319 16:23127465-23127487 CAACTGATTTTTTTTTGAGATGG + Intronic
1135596215 16:23745303-23745325 CAACATATGAGTTTTGCTGAGGG - Intergenic
1136160354 16:28415743-28415765 CAACTTTTTTTTTTTGGAGACGG - Intergenic
1136168412 16:28472023-28472045 CAACTTTTTTTTTTTGGAGACGG - Intergenic
1136582373 16:31160778-31160800 CACCTCCTTTGTTTTCCAGAGGG - Intergenic
1136923923 16:34353734-34353756 CAACTTTTTTTTTTTCGAGATGG + Intergenic
1136980651 16:35058072-35058094 CAACTTTTTTTTTTTCGAGATGG - Intergenic
1137280127 16:46969580-46969602 CAACTAAATTGCCTTGCAGAGGG - Intronic
1137776841 16:51062409-51062431 TAACTTCTTTATTTTACAGATGG - Intergenic
1137968716 16:52962382-52962404 AAACTTATTGGTTTTGGGGAAGG - Intergenic
1138031533 16:53563120-53563142 CTACTTATTTATTTTTGAGAGGG + Intergenic
1138357915 16:56400137-56400159 CTACTTTTTTGTTTTTTAGATGG + Intronic
1138476477 16:57273253-57273275 CAACTTTTTTTTTTTTGAGATGG - Intronic
1139021340 16:62753579-62753601 CAACATAATTGTTTTGGAAATGG + Intergenic
1139412041 16:66770500-66770522 CAACTTATTTTTTCACCAGATGG - Intronic
1139791037 16:69435640-69435662 TAATTTATTTGTTTTTGAGACGG + Intronic
1139995563 16:70977481-70977503 GGGATTATTTGTTTTGCAGAAGG - Intronic
1141467124 16:84213744-84213766 TAACTTTTTTTTTTTGTAGAGGG + Intergenic
1143237320 17:5414197-5414219 GAACTTCTTTTTTTTGCAGATGG + Intronic
1143315765 17:6032347-6032369 CAGCTTATTTAGTTTTCAGATGG + Intronic
1143357752 17:6343188-6343210 CAACTTTTTTTTTTTTGAGATGG - Intergenic
1143879382 17:10018442-10018464 CAAATTCTGTGTTTGGCAGATGG + Intronic
1144338300 17:14291999-14292021 AATCTTATTTGTTTTTCAGAAGG - Intergenic
1144441851 17:15290297-15290319 CAACTTTTTTTTTTTTGAGATGG - Intergenic
1144499793 17:15776012-15776034 CAACTTACTTGTTTGGTAGAAGG - Intergenic
1144518000 17:15932643-15932665 CAACTTAATTCTTTTGCATGTGG + Intergenic
1144694270 17:17291172-17291194 TAACTTTTTTTTTTTTCAGACGG + Intergenic
1145405711 17:22589704-22589726 AAACTTATTTGTATTTCAGGAGG - Intergenic
1146194407 17:30799266-30799288 TAACTTATTTATTTTTGAGATGG - Intronic
1146203620 17:30882250-30882272 CAATTTTTTTTTTTTTCAGATGG - Intronic
1147788374 17:42996793-42996815 CAATTTTTTTTTTTTTCAGACGG - Intergenic
1147934447 17:44003810-44003832 AAAATTATTTTTTTTGAAGACGG - Intronic
1148862772 17:50613215-50613237 CAACCCCTTTGTTTTTCAGAGGG - Intronic
1149159831 17:53678700-53678722 CAATTTGATTGTTTTGCAGGTGG + Intergenic
1150077377 17:62204019-62204041 CAATTTTTTTTTTTTGGAGATGG - Intergenic
1151746189 17:76013190-76013212 CAACTTATTTGGTCTGGGGAGGG + Intronic
1152096506 17:78275172-78275194 TAAATTATTTGTTTTACATATGG - Intergenic
1154508770 18:15071226-15071248 CAACTTAATTTTTTTATAGAGGG + Intergenic
1154949564 18:21195746-21195768 CTACTCATTTGTATTGCAAAGGG - Intergenic
1155257217 18:24009387-24009409 CTACTGACTTGTTCTGCAGAGGG - Intronic
1155520980 18:26668843-26668865 CAACATTTGTGTTATGCAGAGGG + Intergenic
1155684170 18:28527197-28527219 CAACTTCTTTCTTTTGCATGTGG + Intergenic
1155736702 18:29233086-29233108 CAACTTTATTCTTTTGCATATGG - Intergenic
1156256743 18:35405268-35405290 CAACTTTATTCTTTTGCATATGG - Intergenic
1156437862 18:37153051-37153073 CTAATTTTTTATTTTGCAGATGG - Intronic
1156723070 18:40093996-40094018 CAAATGATTTGTTTTGAATAAGG - Intergenic
1157500823 18:48189497-48189519 CCACTCCCTTGTTTTGCAGATGG - Intronic
1158266804 18:55667825-55667847 GAAGTTAATTGTTTTGCATATGG - Intergenic
1158995727 18:62917120-62917142 CAAGTTCTCTGTTTTGCTGAAGG + Intronic
1159723086 18:71918231-71918253 TAACTTAATTATTTTGCATATGG + Intergenic
1159827315 18:73229736-73229758 CACATTAAATGTTTTGCAGATGG - Intronic
1159933832 18:74344061-74344083 CAACTTACTTGATTTGGTGAGGG - Intronic
1160667480 19:338847-338869 CAACTTCATTCTTTTGCACATGG - Intronic
1161032249 19:2062968-2062990 CAGCTAATTTGTTTTGGAGACGG + Intergenic
1161171577 19:2814890-2814912 GAACTTATTTTTTTTAGAGATGG - Exonic
1162205426 19:9052497-9052519 CAACTTTTTTTTTTTTCAAACGG + Intergenic
1162264261 19:9558298-9558320 AAACTTTTTTTTTTTGGAGACGG + Intergenic
1162618765 19:11823120-11823142 CCACTTCCTGGTTTTGCAGATGG + Intronic
1162726357 19:12691757-12691779 AAACTTTTTTTTTTTGGAGACGG + Intronic
1163395809 19:17060415-17060437 CACCTTTTTTGTTTTTGAGACGG + Intronic
1164448920 19:28342577-28342599 CAAGCACTTTGTTTTGCAGATGG + Intergenic
1164905946 19:31968179-31968201 CAGCTTGTGTCTTTTGCAGAGGG - Intergenic
1165005730 19:32804889-32804911 CAACTTTTTTTTTTTTGAGATGG - Intronic
1165345444 19:35245946-35245968 CAACTTCATTTTTTTGCATATGG - Intergenic
1165826846 19:38710417-38710439 CACCTCATTTCTCTTGCAGACGG + Intronic
1166704669 19:44902083-44902105 CATTTTATTTTTTTTGGAGATGG - Intronic
1166839363 19:45687293-45687315 CAAACTGTTTGCTTTGCAGATGG + Intergenic
1166953328 19:46445099-46445121 AAACTTTTTTTTTTTTCAGACGG + Intergenic
1167114800 19:47483038-47483060 CAACCTCTTTATTTTCCAGAAGG + Intronic
1167431229 19:49455591-49455613 CAACTTCTTTTTTTTTCAGGGGG - Intronic
1167676516 19:50889771-50889793 TAACTTATTTGTTTGCCAGTTGG - Intergenic
1167819265 19:51911063-51911085 CAACTTTTTTTTTTTTGAGATGG - Intronic
925379026 2:3411022-3411044 CATTTTATTTGTTTTTGAGATGG - Intronic
925848400 2:8055080-8055102 CAAGTAATTTGTTTGGCAGGTGG + Intergenic
925986587 2:9220852-9220874 CAACTTCATTCTTTTGCATATGG + Intronic
927157436 2:20229140-20229162 TAACTTTTTTGTTTTGGAGGAGG + Intergenic
927782695 2:25952294-25952316 TAACTTATTTTTTTTTGAGACGG - Intronic
928107281 2:28478807-28478829 CAACTTTTTTTTTTTTGAGATGG + Intronic
928468497 2:31548038-31548060 TAATTTATTTATTTTGCATATGG - Intronic
928513133 2:32020199-32020221 CAGCCTATTTGTTTTTGAGACGG - Intronic
929126505 2:38527194-38527216 TAACTTTTTTGTTTTTGAGATGG - Intergenic
930167453 2:48217207-48217229 CAACTTATTTTTTTGGCAGATGG - Intergenic
931059841 2:58515191-58515213 CAGCATATTTATTTTGCTGATGG - Intergenic
931153941 2:59606800-59606822 CAAATTAATTGTTTTGCATATGG + Intergenic
933538223 2:83604067-83604089 CAAGTTATATGTATTTCAGAGGG + Intergenic
933681278 2:85103456-85103478 CAACTTCATTCTTTTGCATATGG - Intergenic
933753056 2:85615634-85615656 CAGCTTCTTTGTTTTTGAGACGG + Intronic
933867229 2:86531663-86531685 CAACTGAATTCTTTTGCATATGG + Intronic
934911650 2:98262465-98262487 CAACTTCATTCTTTTGCATATGG + Intronic
935195127 2:100809244-100809266 CATCTTTTTTTTTTTGGAGATGG - Intergenic
935423201 2:102892294-102892316 CCACTTATTTGTATTCCATAAGG - Intergenic
935783686 2:106530383-106530405 CAGCTTTTTTGTTTTGGAGATGG + Intergenic
936434532 2:112492723-112492745 CAAATTTTTTTTTTTGGAGATGG - Intronic
937795975 2:126020670-126020692 CAACTTCATTATTCTGCAGATGG + Intergenic
938219769 2:129555922-129555944 CAACTTCATTCTTTTGCATATGG + Intergenic
938492407 2:131768819-131768841 CAATTTTTTTTTTTTGGAGATGG - Intergenic
939118310 2:138087267-138087289 CAACATAATTGTATTGCAGTGGG + Intergenic
939173336 2:138721333-138721355 CAATTTTTTTTTTTTTCAGACGG - Intronic
939467306 2:142574956-142574978 CAACTTAATTTGTATGCAGAAGG - Intergenic
939555883 2:143672733-143672755 CACATTATTTGCTTTGCCGATGG + Intronic
939580359 2:143939153-143939175 CACCTTACTTATTTTACAGAAGG - Exonic
939846602 2:147254502-147254524 GAATTTATTTGTTTTGCAACAGG + Intergenic
940118268 2:150234609-150234631 CTACTTATTTGTTTTGGGGTAGG + Intergenic
940941442 2:159566013-159566035 TGACTTTTTTGTTTTTCAGAAGG + Intronic
941073601 2:160982632-160982654 TAACTTCATTGTTTTGCATATGG - Intergenic
941280658 2:163546957-163546979 CAACTTTTTTTTTTTTGAGACGG + Intergenic
941881435 2:170484308-170484330 CAATTTATTTATTTTGAGGATGG - Intronic
941961854 2:171261685-171261707 ACACTGATTTGTTTTGGAGATGG - Intergenic
941989812 2:171544627-171544649 CAACTTCATTTTTTTCCAGATGG + Intronic
942049730 2:172128160-172128182 CACCTTTTTTTTTTTGGAGACGG + Intergenic
943249310 2:185496356-185496378 CCACTTATTTACTTTGCAGGTGG + Intergenic
943322248 2:186459181-186459203 CAAGTCATTTGTTTTACAAAAGG + Intergenic
943336041 2:186615997-186616019 CAAATTATTTTTTTTGCATATGG + Intronic
943439894 2:187915645-187915667 AATCTTCTTTGTTTTGGAGACGG - Intergenic
943467758 2:188250283-188250305 CAATTTATTTATTTTACAGGTGG - Intergenic
944225180 2:197342381-197342403 AAACTTTTTTTTTTTGGAGATGG - Intergenic
944237853 2:197456456-197456478 CAACTTTTTTTTTTTTGAGATGG - Intronic
945021125 2:205572739-205572761 CAATTTATTTATTTAGGAGATGG - Intronic
945514217 2:210742724-210742746 CAACTTCATTCTTTTGCATATGG + Intergenic
945592320 2:211748684-211748706 TCACTTATTTATTTTACAGAGGG - Intronic
945790748 2:214302483-214302505 CAGTTTTTTTGTTTTGGAGATGG + Intronic
945843858 2:214919671-214919693 CAACTTCTTTCATTTGCATATGG - Intergenic
946675993 2:222160130-222160152 GAACACATTTGCTTTGCAGAGGG + Intergenic
946964458 2:225023037-225023059 CAACTTTTTTTTTTTTGAGACGG + Intronic
947265922 2:228281016-228281038 CAATTTATTATTTTTGCACATGG - Intergenic
948249039 2:236510793-236510815 CAACTTTTTTTTTTTTGAGATGG + Intergenic
948679200 2:239621087-239621109 TAACTTATTTCTTCTGCAGTTGG + Intergenic
948780195 2:240316241-240316263 CAACTTCATTCTTTTGCATATGG - Intergenic
1169169848 20:3456153-3456175 TAGCTTATTTGATTTGCGGAAGG + Intergenic
1169472490 20:5899656-5899678 CAACTTCATTCTTTTGCATATGG - Intergenic
1169653908 20:7900855-7900877 CAACTTAGCTGTTTGGCACAAGG - Intronic
1169765023 20:9139708-9139730 CCACATTTTTTTTTTGCAGAAGG + Intronic
1169814713 20:9644454-9644476 CAACTTTTATCTTTTGCAGCTGG - Intronic
1170098491 20:12672904-12672926 ATTCTTATTTGTTTTGCATAAGG + Intergenic
1170432563 20:16290020-16290042 CATCTTTTTTGTTTTCCAAATGG - Intronic
1171027804 20:21648051-21648073 CAACTTCGTTCTTTTGCACATGG - Intergenic
1171139167 20:22725948-22725970 CAACATATGAGTTTTGGAGAAGG + Intergenic
1171319663 20:24230903-24230925 CAACTTCTTTCCTTTGCAGGTGG - Intergenic
1172775155 20:37402972-37402994 CAACTTCTTTGTTTTACGGGTGG - Intronic
1173296894 20:41767598-41767620 CAACTTCTTTTTTTTAAAGATGG + Intergenic
1173769301 20:45644509-45644531 CAGCTAATTTTTTTTGTAGAGGG + Intergenic
1174241312 20:49137667-49137689 CAACTTTTTTTTTTTTGAGATGG + Intronic
1174852889 20:54013238-54013260 CAAGTTAATTTTTTTCCAGATGG - Intronic
1175302245 20:57951237-57951259 CAACCCCTTTGTTATGCAGATGG - Intergenic
1176182112 20:63754602-63754624 CAACTTTTTTTTTTTTTAGACGG + Intronic
1176882462 21:14213964-14213986 CAACTTTTTTTTTTTTGAGATGG - Intergenic
1177172465 21:17669563-17669585 CAACTTTTTTTTTTTTGAGATGG + Intergenic
1177379473 21:20320598-20320620 CAACTTTTATGTTTTATAGATGG + Intergenic
1178332530 21:31711327-31711349 GAACTTTTTTGTCTTGCAAAAGG - Intronic
1178437730 21:32574673-32574695 TAACTTATTTGCTTTTTAGACGG - Intergenic
1178604075 21:34020081-34020103 CAAGTTAAATGTTTTGCTGAAGG + Intergenic
1179125005 21:38582749-38582771 CAACTTTTTTTTTTTTGAGACGG + Intronic
1181894666 22:26096461-26096483 CATCTTCTGTGTTCTGCAGAGGG - Intergenic
1182161356 22:28125145-28125167 CTAATCATTTGTTTTCCAGATGG + Intronic
1183222685 22:36526902-36526924 GATCTTGTTTATTTTGCAGATGG - Intronic
1183337428 22:37258208-37258230 CAACTTTATAGTTTTACAGATGG + Intergenic
1183790382 22:40063121-40063143 CAACTTAATTCTTTTGCATGGGG + Intronic
1183887787 22:40899516-40899538 CAACTTCATTCTTTTGCATATGG - Intronic
1184267552 22:43357332-43357354 CATATCCTTTGTTTTGCAGACGG + Intergenic
1184493078 22:44821422-44821444 CAACTTTTTTTTTTTCGAGATGG - Intronic
1184525935 22:45022785-45022807 CACCTTTTTTGTTTTTGAGATGG + Intergenic
1184614739 22:45630416-45630438 CAATTTATTTATTTTTGAGATGG - Intergenic
1203294395 22_KI270736v1_random:27407-27429 CAACTTAATATTTTTGCAGCTGG + Intergenic
950001931 3:9663469-9663491 CAACTTTTTTTTTTTTGAGATGG + Intronic
950471952 3:13191977-13191999 CAACATATTTATTATGAAGAGGG - Intergenic
951704740 3:25532627-25532649 CAACTGATTTGGTTAGCAAATGG + Intronic
952360361 3:32625125-32625147 CAACTTCATTCTTTTGCATATGG + Intergenic
952616752 3:35282455-35282477 CAAATTATCTTGTTTGCAGATGG + Intergenic
953329462 3:42040489-42040511 CAACTTTATTGTTTTACATATGG + Intronic
953682384 3:45049572-45049594 CATCTTAATTTTTATGCAGAAGG - Intergenic
953734630 3:45482041-45482063 CAACTTCATTCTTTTGCACATGG + Intronic
953764367 3:45724886-45724908 CAACTTCATTCTTTTGCATATGG + Intronic
954436072 3:50497033-50497055 CAGCCTAATTGTTTAGCAGAGGG - Intronic
955307213 3:57845844-57845866 CACCTTTTTTTTTTTGGAGATGG + Intronic
955383207 3:58458035-58458057 GAACTTTTTTTTTTTGGAGACGG - Intergenic
955601196 3:60647263-60647285 CAGGTAATTTGTTTTTCAGAAGG + Intronic
955960688 3:64338457-64338479 CAACTTCTTTATTTTGCATGTGG - Intronic
956031820 3:65046144-65046166 CAACTTAATTCTTTTGCAGGCGG + Intergenic
956126091 3:66012259-66012281 GAAATTATTTTTTTAGCAGAGGG + Intronic
956263430 3:67370943-67370965 AAAATTATTTGTTTTGCTCAGGG + Intronic
956695136 3:71912339-71912361 AAAGTTATTTGATTTGGAGAGGG + Intergenic
956812161 3:72874069-72874091 CAACTTAATTTTTTTTCAGGTGG - Intergenic
957037152 3:75304350-75304372 CATCTTTTTTGGTTTGGAGATGG + Intergenic
957094202 3:75762986-75763008 CAACTTCATTGTTTTGCATGTGG - Intronic
957541666 3:81578587-81578609 CAACTTATTTTCTCTGCTGAGGG - Intronic
957926044 3:86812614-86812636 CAACTTCATTGTTTTACAGGTGG - Intergenic
958107072 3:89089302-89089324 CAACTTAATTCTTTTGCATATGG - Intergenic
958173649 3:89967847-89967869 AAACTCTTTTGTTTTGTAGAAGG - Intergenic
959135010 3:102407244-102407266 CAACTCTATTGTTTTGCAGCTGG + Intronic
959179928 3:102965655-102965677 CAAGTTATATATTTTACAGATGG - Intergenic
960344431 3:116514978-116515000 CAAATAATGTGTTTTGCATATGG + Intronic
960646900 3:119895607-119895629 CAACTTCATTCTTTTGCATATGG + Intronic
961026785 3:123565352-123565374 CCACTTATTACTTTTGCAGTGGG - Intronic
961343040 3:126243047-126243069 CAATGTAATTGTTTTGCAAATGG - Intergenic
961546090 3:127634419-127634441 CAACTTTTTTTTTTTTGAGATGG - Intronic
962321735 3:134396238-134396260 TCACTTATTTGTCTTGCATATGG + Intergenic
962583198 3:136817104-136817126 CAGATTTTTTGTTTTGGAGAAGG - Intergenic
963212065 3:142703771-142703793 CATCATAATTGTTTTTCAGATGG + Intronic
963276443 3:143335704-143335726 CAAATTAGTTCTTTTGCATATGG - Intronic
963893859 3:150664640-150664662 CATCTTTTTTTTTTTTCAGATGG - Intronic
964009969 3:151880936-151880958 CAAACTCTTTCTTTTGCAGAAGG - Exonic
965546625 3:169922884-169922906 CATCTTACTTGCTCTGCAGATGG - Intronic
966716146 3:183014874-183014896 CAGCTTATTTTTTGTGGAGACGG + Intergenic
967937806 3:194742982-194743004 CAACTTTTTTCTTTTAGAGATGG + Intergenic
969086380 4:4659618-4659640 CAACTTCTGTATTTTGCTGATGG - Intergenic
969117718 4:4882408-4882430 TAATTTATTTATTTTTCAGATGG - Intergenic
969861972 4:10043862-10043884 CAACTTCATTCTTTTGCAGGTGG - Intronic
970191145 4:13520553-13520575 AAACATACTTGTTTTTCAGATGG - Intergenic
970380187 4:15499716-15499738 AAACTTATTAGTTTTGAAAAAGG + Intronic
970566440 4:17336521-17336543 CAACTCAGTAGTTTTCCAGAAGG + Intergenic
970845012 4:20527290-20527312 CATCTTTTTTTTTTTGGAGATGG + Intronic
971683777 4:29737446-29737468 GAACTAATTTGTTTTGCTGCTGG + Intergenic
972512976 4:39786720-39786742 CAATTTATTTATTTTTGAGATGG - Intergenic
972538050 4:40015430-40015452 CATCTTTTTTTTTTTTCAGAGGG - Intergenic
972823547 4:42730279-42730301 CACGTTATTTTTTTTGGAGATGG + Intergenic
973754111 4:54055645-54055667 GAACATATTGGTTATGCAGATGG + Intronic
974541454 4:63243848-63243870 CAACTTTATTTTTTTGCATATGG - Intergenic
974668044 4:64991407-64991429 CAACTTTATTGTTTTGCATGTGG + Intergenic
976240565 4:82951916-82951938 CAACTTCACTGTTTTGCACACGG - Intronic
977166245 4:93702264-93702286 ACAATTATTTGTTTTACAGAAGG - Intronic
977590322 4:98818907-98818929 CAACTTCATTCTTTTGCATATGG - Intergenic
978231081 4:106400797-106400819 GAACTTGTTTGTTTTTGAGACGG - Intergenic
979485060 4:121261859-121261881 CAACCTCTTTATTTTACAGATGG + Intergenic
979764041 4:124444056-124444078 CAAATTATTTATATTCCAGAAGG - Intergenic
980188586 4:129494519-129494541 CAACTTAATTGTGTTGAAGGAGG + Intergenic
980435702 4:132770160-132770182 CATCTCCTTTATTTTGCAGATGG - Intergenic
981267380 4:142802827-142802849 CAACTTCATTATTTTGCACAGGG - Intronic
981760973 4:148193860-148193882 CAACTTTCTTGTTTTCCAGATGG + Intronic
983343501 4:166497447-166497469 GAACTTATTTATTCTGCATAAGG - Intergenic
983665238 4:170174122-170174144 CAATTTAATTCTTTTGCATATGG + Intergenic
983870280 4:172817414-172817436 CAACTTTTTTTTTTTGCAATAGG - Intronic
983964931 4:173798614-173798636 CAACTTTTTTTTTTTGGAGACGG + Intergenic
984133102 4:175902566-175902588 CAAATCTTTTATTTTGCAGATGG - Intronic
984176190 4:176420355-176420377 CAATTTCTTTCTTTTGCACATGG + Intergenic
984265431 4:177492969-177492991 CTAGTTATTTGTTTTGTTGAGGG - Intergenic
984540561 4:181032226-181032248 GAACACATTTGTTTTGCAAAAGG - Intergenic
984753890 4:183306571-183306593 CAATTTTTTTTTTTTGGAGATGG + Intronic
984980838 4:185279429-185279451 CATCTTTTTAGTGTTGCAGAAGG - Intronic
985138678 4:186815722-186815744 CAACTTCATTCTTTTGCATATGG + Intergenic
985304617 4:188524946-188524968 CACTTTATTTCTTTTCCAGATGG + Intergenic
985420070 4:189776424-189776446 CAATTTTATTGTTTTTCAGATGG + Intergenic
985659512 5:1149570-1149592 TAATTTATTTGTTTTTGAGAGGG - Intergenic
989601402 5:43204020-43204042 CCACTTTTTTTTTTTGGAGATGG - Intronic
990109687 5:52307778-52307800 CATTTTCTTTGTTTTACAGATGG + Intergenic
990265428 5:54070385-54070407 CAACTTTTTTTTTTTTGAGACGG - Intronic
990265710 5:54072786-54072808 CAAGTAATTTGTTTTGGAAAGGG - Intronic
990593993 5:57294847-57294869 CAACTTCCTTGTTTTGCAAGTGG - Intergenic
990959301 5:61377224-61377246 CAACTTTATTTTTTTCCAGATGG - Intronic
991307366 5:65192581-65192603 CAACTTATTTTTTTTTCTTATGG + Intronic
991403157 5:66275152-66275174 CAACACCTTTGTTTTGCAGAGGG + Intergenic
991462033 5:66869220-66869242 CAACTTAATGGTTTATCAGAAGG - Intronic
991521157 5:67498198-67498220 CAACTTAATTTTCTTCCAGATGG + Intergenic
991560331 5:67944433-67944455 CAAATTATTTGTGTTGAAAATGG - Intergenic
992538555 5:77738585-77738607 CTACTTCTTTTTTTTGGAGACGG + Intronic
992598547 5:78371355-78371377 CAACTTTATTGTTTTGCATGTGG + Intronic
992888050 5:81178741-81178763 CAACTTTTTTTTTTTTGAGACGG + Intronic
993057218 5:82995593-82995615 CTACTTAATTATTTTACAGATGG + Intergenic
993811482 5:92483740-92483762 CAACTTTTTTCTTTTGCATGTGG - Intergenic
994320675 5:98391859-98391881 CAACTAAATTGTTTTGCAGCTGG + Intergenic
994436997 5:99748982-99749004 CAAATTATTGTTTCTGCAGAAGG + Intergenic
994943977 5:106361480-106361502 CAACTTTTTTTTTTTTGAGATGG + Intergenic
995013643 5:107286127-107286149 CAAGTTGTTTGTTTTACAGGTGG - Intergenic
995700069 5:114925592-114925614 CAACTTCATTATTTTGCATATGG - Intergenic
996008246 5:118449729-118449751 ACACTTATTTGCTATGCAGAGGG - Intergenic
996157777 5:120123939-120123961 CCACTTTTTTTTTTTGGAGATGG - Intergenic
996432788 5:123400722-123400744 CAACTGAATTGTTTTGTAGCTGG + Intronic
996446327 5:123556172-123556194 AAACTTATAAGTTTTGCAGTGGG + Intronic
996730063 5:126708106-126708128 CAACTTTTTTTTTTTTGAGATGG - Intergenic
996788050 5:127262308-127262330 CAACTTCATTCTTTTGCATATGG + Intergenic
996939881 5:128991806-128991828 CTGCTTATCTGTTTTTCAGATGG - Intronic
997069440 5:130602908-130602930 CAAATTATTTTTTCTCCAGATGG + Intergenic
997895598 5:137713474-137713496 CAACTTCATTATTTTGCATATGG - Intronic
999525666 5:152403485-152403507 AAACTGATTTCTTTTTCAGAAGG - Intronic
999706277 5:154275095-154275117 CAACTCATTCGTTTTATAGACGG - Intronic
1000040075 5:157478974-157478996 TTGCTTGTTTGTTTTGCAGAGGG + Exonic
1000452288 5:161404695-161404717 CAGCGTATGTGTTTTGCTGATGG - Intronic
1001873362 5:175177950-175177972 CAACTTAATTATTTTGCATTTGG + Intergenic
1002627875 5:180544613-180544635 CAGCTTATTTTTCTGGCAGATGG + Intronic
1003606381 6:7565142-7565164 CAACTTTTTTTTTTTTGAGACGG - Intronic
1003661779 6:8069020-8069042 CAAGGTATGTGTGTTGCAGAAGG + Intronic
1004117036 6:12779329-12779351 CAACTTTTTTATTTTTGAGATGG - Intronic
1005000722 6:21238255-21238277 CAACTTTATTCTTTTGCACATGG - Intergenic
1005150569 6:22744546-22744568 CAACTTTATTTTTTTGCATATGG - Intergenic
1005772681 6:29091279-29091301 CAGCTTTTTTTTTTTGGAGATGG - Intergenic
1005911576 6:30314696-30314718 CCACGTTTTTGTTTTGCACAGGG - Intergenic
1006767501 6:36521092-36521114 AACCTTATTTATTTTGCATAAGG + Intronic
1006989895 6:38206219-38206241 CAATTTTTTTTTTTTGGAGATGG + Intronic
1008033946 6:46726648-46726670 AAACTTTTTTTTTTTGGAGATGG + Intronic
1010663639 6:78600284-78600306 CAAATTAGTTATTTTGCTGAAGG + Intergenic
1011046972 6:83095380-83095402 CAACTTTGTTCTTTTGCACATGG + Intronic
1011529614 6:88306557-88306579 CAAGTTTTATGTTTTGCATATGG + Intergenic
1011927070 6:92658971-92658993 CAATTTATTTATATTGCACAGGG + Intergenic
1012930940 6:105315790-105315812 GAACTTTTATGTTGTGCAGATGG + Intronic
1013096932 6:106953607-106953629 CAACTTTTTTTTTTTTGAGATGG - Intergenic
1013254321 6:108369612-108369634 CAATTTTTTTTTTTTGGAGACGG + Intronic
1013669044 6:112378222-112378244 CAACTTTTTTTTTTTTGAGAAGG + Intergenic
1014668050 6:124264137-124264159 CAATTTATGTGTGTAGCAGAGGG + Intronic
1014776777 6:125520062-125520084 CCACATATTTATTTTGCAAAAGG + Intergenic
1016112720 6:140245693-140245715 AAACTTCATTGTTTTACAGAGGG - Intergenic
1016442932 6:144103028-144103050 CAATTTATAAGTTTAGCAGAGGG + Intergenic
1017136190 6:151149433-151149455 CCGCTTGCTTGTTTTGCAGAGGG + Intergenic
1017189800 6:151640815-151640837 CAACTTCTTTCTTTTGCATGTGG + Intergenic
1017334497 6:153239281-153239303 AAACTTTTTTTTTTTTCAGATGG - Intergenic
1017612219 6:156200358-156200380 CAAATTATTTGTTTATCAAAAGG + Intergenic
1018509556 6:164510503-164510525 CAACTAATTTTTTTTGCATGAGG + Intergenic
1018571452 6:165215389-165215411 CAACTTCATTCTTTTGCACAAGG - Intergenic
1018964275 6:168472244-168472266 CAACTTCGTTGTTTTGCATGTGG + Intronic
1019453435 7:1111793-1111815 CAACTTTTTTTTTTTTGAGAGGG - Intronic
1020353788 7:7254666-7254688 AAACTTTTTTGTTGTGGAGATGG - Intergenic
1020456642 7:8381129-8381151 CAACTCATTTTTTCTCCAGACGG + Intergenic
1021088750 7:16455489-16455511 CTACTTTTTTTTTTTTCAGATGG - Intergenic
1021160424 7:17265707-17265729 CAATTTATTTTTTTTGCACGTGG + Intergenic
1022046858 7:26628509-26628531 CAACTAATTTGTTGTCCAGCGGG + Intergenic
1022915142 7:34941365-34941387 AAACTTATTTTTTTTTCAGTTGG - Intronic
1023030031 7:36083339-36083361 CAACTTATTTTTTTTTAAGATGG + Intronic
1023877815 7:44298333-44298355 CAACTTCATTGTTTTGCATGTGG - Intronic
1024480905 7:49861691-49861713 CAACTTCATTCTTTTGCACATGG + Intronic
1024488910 7:49954237-49954259 CAACTTCATTCTTTTGCAGTTGG - Intronic
1024760125 7:52585741-52585763 CAACTTATTAGGTTAACAGATGG - Intergenic
1024778202 7:52813628-52813650 CAATTTTATTATTTTGCAGATGG + Intergenic
1024779481 7:52830596-52830618 CAAATGTTTTGTTTTGGAGAGGG + Intergenic
1025612052 7:63083311-63083333 TTACTTGTTTGTTTTTCAGATGG + Intergenic
1026371668 7:69705820-69705842 CAATCTCTTTGTCTTGCAGATGG + Intronic
1028196022 7:87909069-87909091 CAACTTTTTTTTTTTTGAGATGG - Exonic
1028911758 7:96215579-96215601 CAACTTCATTATTTTGCATATGG - Intronic
1029101278 7:98132253-98132275 CAACTTTTTTTTTTTTGAGACGG + Intronic
1029317775 7:99729940-99729962 GAAATTATTGCTTTTGCAGAGGG + Intronic
1029964317 7:104722917-104722939 CTACTTATTTTTTTAACAGAAGG - Intronic
1030197085 7:106863077-106863099 AAAATTATTTGTTTTGAGGAAGG - Intergenic
1030208009 7:106969189-106969211 CAACTTTTTTTTTTTTGAGACGG - Intergenic
1030479978 7:110090858-110090880 CAACTTTTTTTTTTTTGAGATGG - Intergenic
1030662459 7:112235971-112235993 CAGCTTTTTTATTTTGCATATGG + Intronic
1030691068 7:112534304-112534326 CAACTTCATTCTTTTGCATATGG + Intergenic
1030808254 7:113944076-113944098 CAACTTAATTATTTTGCATGTGG - Intronic
1030989003 7:116277481-116277503 CCAATATTTTGTTTTGCAGAAGG - Intergenic
1031034830 7:116777368-116777390 CAAGTTCTTTCTTTTGCACAGGG + Exonic
1031313982 7:120233980-120234002 CAACTTATATGTTTAGCAACAGG - Intergenic
1031553630 7:123144810-123144832 AAAGTTATTTGTTTTGCAGTGGG - Intronic
1031930592 7:127681680-127681702 CAACTTCATTCTTTTGCACATGG + Intronic
1032217583 7:129969534-129969556 CAATTTTTTTTTTTTCCAGATGG + Intergenic
1032959385 7:137013925-137013947 CAAACTTTTTGTTTTGTAGAAGG - Intronic
1033373688 7:140736429-140736451 CCACTTTTTTTTTTTGGAGATGG + Intronic
1033383256 7:140845191-140845213 CAACTTCGTTCTTTTGCATATGG - Intronic
1033995080 7:147335664-147335686 TAAATTATTTATTTAGCAGAGGG + Intronic
1034852587 7:154508926-154508948 CAACTTCATTATTTTGCACATGG - Intronic
1035792891 8:2323740-2323762 CTATTTATTTTTTTTGGAGATGG + Intergenic
1035799913 8:2397965-2397987 CTATTTATTTTTTTTGGAGATGG - Intergenic
1036040368 8:5072921-5072943 CAACTTATTACTTTTAAAGAGGG + Intergenic
1037628581 8:20630935-20630957 CAAGCTATGTGTTTTGCAGGAGG + Intergenic
1037937109 8:22922295-22922317 AAATTTATTTGATCTGCAGATGG + Intronic
1038196337 8:25371727-25371749 CAGCTGATTTGTTTTACATAAGG + Intronic
1038815087 8:30894652-30894674 CAACTTCATTCTTTTGCACATGG - Intergenic
1038923762 8:32115033-32115055 TAACTTTTTTTTTTTTCAGATGG + Intronic
1039277552 8:35950529-35950551 CAACTTTTTTTTTTTTGAGATGG + Intergenic
1039622163 8:39007969-39007991 TAACTTACTTGTTTTGAATAGGG - Exonic
1041033945 8:53767760-53767782 CAACTTCTTTCTTTTGCATGTGG - Intronic
1041297897 8:56378803-56378825 CAACTTCGTTGTTTTGCATATGG + Intergenic
1042272305 8:66966778-66966800 CAATTTTTTTTTTTTGGAGACGG - Intronic
1042517006 8:69670190-69670212 CAAATTACTTGTTTTGGAAAAGG - Exonic
1042838232 8:73097141-73097163 TAACTTACTTGTTTTGCTGAAGG + Intronic
1043326050 8:79052841-79052863 CAACCCATTTCTTTTGGAGAAGG - Intergenic
1044508006 8:93042978-93043000 TAACTTATTTGTGTTTCAGGTGG + Intergenic
1044893575 8:96863554-96863576 GAGCTTATTTCTTTTGCATATGG + Intronic
1045060562 8:98407192-98407214 CAACTTCCTTTTTTTACAGAAGG - Intronic
1045518550 8:102882611-102882633 CAACTTCATTCTTTTGCATATGG - Intronic
1045894736 8:107201764-107201786 CAACTTCATTTTTTTGCACATGG + Intergenic
1046350056 8:112997651-112997673 CAATTAATTAGTTTTGAAGAGGG - Intronic
1047005258 8:120613345-120613367 CAACTTTTTTTTTTTTGAGATGG - Intronic
1048647195 8:136435265-136435287 CTACTTATATATTATGCAGATGG - Intergenic
1048667384 8:136678196-136678218 TAACTTCTTTCTTTTGCATATGG - Intergenic
1048944566 8:139432353-139432375 CAACTTTTCTGTTTTCCAAATGG - Intergenic
1048996563 8:139797696-139797718 CAACTTCATTCTTTTGCATAAGG + Intronic
1049106647 8:140617999-140618021 CAACTTTTTTTTTTTGTAGACGG - Intronic
1049626839 8:143627397-143627419 TAACTTTTTTGTTTTTGAGATGG + Intergenic
1049715442 8:144087729-144087751 CAACTGTTTTGTTTTTGAGATGG + Intergenic
1050096298 9:2070399-2070421 CGACATTGTTGTTTTGCAGAAGG + Exonic
1050342328 9:4653302-4653324 CAACTTCATTCTTTTGCATATGG - Intronic
1050582992 9:7080530-7080552 CAATTTATTTGAATTGCAAAAGG + Intergenic
1050715520 9:8520531-8520553 CAACTTAAGTTTTCTGCAGATGG - Intronic
1051155334 9:14137555-14137577 CAACTTTGTTATTTTACAGATGG + Intronic
1051532948 9:18125620-18125642 CAACTTAATTCTTTTGCATGTGG + Intergenic
1051740409 9:20246361-20246383 TGAATTATTTGTTTTGCAGAAGG - Intergenic
1052401720 9:28009184-28009206 CAACTTTATTCTTTTGCATATGG - Intronic
1052468360 9:28859108-28859130 CATCTTAGTTGTTTTTCTGAAGG + Intergenic
1052519476 9:29526658-29526680 CAACTTTTTTCTTTTGCATGTGG + Intergenic
1052793281 9:32898045-32898067 CAGCTTCTTTCTTTTGCAAAGGG - Intergenic
1053148274 9:35726783-35726805 CAACTCTTGTGTTTTGGAGAAGG + Intronic
1053211862 9:36236203-36236225 CAACTTTTTTTTTTTTGAGATGG + Intronic
1054936499 9:70694281-70694303 AAACTTATTTTTTTTGCAGATGG - Intronic
1055313445 9:75009109-75009131 CAACTTTATTCTTTTGCATATGG - Intronic
1055436101 9:76293762-76293784 CAGGGTATTTGTTTTTCAGAGGG - Intronic
1055588853 9:77788070-77788092 CATTTTGTTTATTTTGCAGAAGG - Intronic
1055707934 9:79028034-79028056 CCACTTATTTCTTTAGGAGAAGG + Intergenic
1056202294 9:84288552-84288574 CAACTTTTTTTTTTTTGAGATGG + Intronic
1056469291 9:86889598-86889620 TAGCTTGTTTGTTTTGCACATGG - Intergenic
1057394995 9:94671963-94671985 CAACTTTTTTATTTTGCATATGG - Intergenic
1057525802 9:95799583-95799605 CAACTTAGTTTTTTTGCGTACGG - Intergenic
1057530866 9:95844734-95844756 CAACTTCATTCTTTTGCATATGG + Intergenic
1057897410 9:98920595-98920617 CAACTTCATTCTTTTGCATATGG - Intergenic
1058022365 9:100102855-100102877 TAACTAATTTTTTTTTCAGATGG + Intronic
1058123655 9:101167252-101167274 CAAGCTGTTTGTTTTTCAGAAGG - Intronic
1058454095 9:105123310-105123332 CAATTTTTTTTTTTTGGAGACGG - Intergenic
1058817122 9:108694670-108694692 AAACTTTTTTTTTTTGGAGACGG - Intergenic
1059933247 9:119282410-119282432 CAACTTCCTTGTTTTCCAGATGG - Intronic
1060394820 9:123308538-123308560 GAACTTTTTTTTTTTTCAGATGG + Intergenic
1061138357 9:128749736-128749758 CAACAAATTTTTTTTTCAGATGG - Intronic
1061145515 9:128795761-128795783 CAACTAATTTTTTTTACAGATGG + Intronic
1061295509 9:129674809-129674831 CAACCTTCTTGTCTTGCAGATGG - Intronic
1062061428 9:134497829-134497851 CATTTTATTTGTTTTGATGATGG + Intergenic
1062329697 9:136033011-136033033 CAACTTATTTTTTTTTGAGATGG - Intronic
1186365849 X:8892591-8892613 CAATTTCTTTGTTTAGCAAAGGG - Intergenic
1186946051 X:14568750-14568772 CAACTTCATTGTTTTGCATGTGG - Intronic
1186971841 X:14854517-14854539 CAATCTATTGGTTTTGCAAACGG - Intronic
1187740210 X:22347640-22347662 CAACTTCATTCTTTTGCATATGG + Intergenic
1187776356 X:22762966-22762988 CAACTTCATTGTTTTGCATATGG + Intergenic
1189057245 X:37711021-37711043 CAACTGAGTGGTTTTGCCGAAGG - Intronic
1189549224 X:42075899-42075921 CAACCCATTTGTTTTGCAGATGG - Intergenic
1190191925 X:48284009-48284031 CAATTTATTTGTTTTCCTTATGG + Intergenic
1190428852 X:50358691-50358713 CAACTTCATTCTTTTGCATATGG + Intergenic
1190822081 X:53983021-53983043 CAGCTTATTTTTTGTACAGATGG - Intronic
1191129950 X:56996974-56996996 CAAATTCATTGTTTTGCACATGG + Intergenic
1191708779 X:64124523-64124545 CAATTTTATTGTTTTGCATATGG - Intergenic
1191980673 X:66921386-66921408 CAACCTAATTCTTTTGCATATGG + Intergenic
1192138237 X:68626503-68626525 CAACTTAATTCTTTTGCATGTGG + Intergenic
1192596839 X:72418832-72418854 CAACTTAATTCTTTTGCATGTGG + Intronic
1192608554 X:72544887-72544909 CAAAGTTTTTGTTTTGTAGAAGG + Intronic
1193730847 X:85100993-85101015 CAACTTCATTATTTTGCATATGG - Intronic
1193974838 X:88104613-88104635 CAACTTACTTATTTTACATAAGG + Intergenic
1194151671 X:90332580-90332602 CAACTTCATTGTTTTGCATGTGG - Intergenic
1194430297 X:93795180-93795202 TAACTTATTTGTTTTTAAAAAGG - Intergenic
1195033857 X:100952948-100952970 CAACTTAATTATTTTGCAGGTGG - Intergenic
1195143848 X:101993070-101993092 CATCTTATTTTTTGTGGAGAAGG - Intergenic
1195329926 X:103788491-103788513 CACCTCAGCTGTTTTGCAGATGG - Exonic
1195390511 X:104357306-104357328 TAACTTTTTTTTTTTGAAGAGGG + Intergenic
1195606551 X:106811730-106811752 CAATTTATTTGCTTTTCTGAGGG + Intronic
1195828272 X:109026538-109026560 CAACTTTTTTCTTTTGCATGTGG - Intergenic
1196750349 X:119111233-119111255 CAACTTAATTCTTTTGCATGTGG - Intronic
1196799172 X:119526949-119526971 CAACTTCTTTTTTTTTGAGACGG + Intergenic
1197711159 X:129669354-129669376 CAACTTCATTGTTTTGCATGTGG + Intergenic
1197822642 X:130556735-130556757 CAACTAATTTGTTTAGCACCAGG + Intergenic
1197955045 X:131937373-131937395 AAGCTTACTTTTTTTGCAGATGG - Intergenic
1198297252 X:135299813-135299835 CAACTTCTTTTTTTTGCATATGG + Intronic
1198720735 X:139616745-139616767 CAACTAATTTATTCTGCAGCAGG + Intronic
1198788416 X:140315975-140315997 CATCTTATGTGGTTGGCAGAAGG + Intergenic
1199751029 X:150817857-150817879 CAACTTATGTTTTTTAGAGATGG - Intronic
1199931190 X:152524399-152524421 CAACTTAATTCTTTTGCGTATGG - Intergenic
1200498035 Y:3909348-3909370 CAACTTCATTGTTTTGCATGTGG - Intergenic
1202391645 Y:24376892-24376914 CAACTTCATTGTTTTGCAGGTGG - Intergenic
1202479140 Y:25293225-25293247 CAACTTCATTGTTTTGCAGGTGG + Intergenic