ID: 905925929

View in Genome Browser
Species Human (GRCh38)
Location 1:41749790-41749812
Sequence TGTGCTCTACGGAGCTCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905925921_905925929 22 Left 905925921 1:41749745-41749767 CCCATCTGCAAAACAAATAAGTT 0: 1
1: 0
2: 1
3: 42
4: 627
Right 905925929 1:41749790-41749812 TGTGCTCTACGGAGCTCCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 54
905925922_905925929 21 Left 905925922 1:41749746-41749768 CCATCTGCAAAACAAATAAGTTG 0: 1
1: 0
2: 4
3: 51
4: 602
Right 905925929 1:41749790-41749812 TGTGCTCTACGGAGCTCCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905925929 Original CRISPR TGTGCTCTACGGAGCTCCGG GGG Intronic
900373822 1:2344326-2344348 TGTGCTCACCGGAGCTTCTGGGG - Intronic
901266472 1:7914293-7914315 TGTGCACCAGGGAGCTCCGCTGG - Intergenic
903745496 1:25584153-25584175 TGTGCTCTTTGGAGGTCCCGTGG + Intergenic
904304687 1:29580462-29580484 GGTGCTCTACTGAGCACTGGGGG + Intergenic
905925929 1:41749790-41749812 TGTGCTCTACGGAGCTCCGGGGG + Intronic
912449064 1:109758524-109758546 TGTGCTCTAGGGTCCTCTGGTGG + Exonic
922968750 1:229716225-229716247 TGAGCTCTGCGGAGCTGTGGAGG + Intergenic
924943172 1:248826243-248826265 CTTGCTTTACGGAGCTGCGGCGG + Exonic
1063681238 10:8189641-8189663 TGAGATCTACGTAGCTCTGGTGG + Intergenic
1086510542 11:87553150-87553172 TGTGCTCAACTGGGCTCAGGAGG - Intergenic
1094682224 12:32677021-32677043 TGTGCACTACGCAACTCCAGTGG - Intergenic
1095979521 12:47963521-47963543 TGCGCTCTTCGCGGCTCCGGAGG - Intergenic
1097185884 12:57196070-57196092 TGTGCTCTGCGGAGGGGCGGAGG - Exonic
1099148788 12:79081849-79081871 TGTGCTCTTAGAAGCTCCTGGGG - Intronic
1103385496 12:120529101-120529123 TGTGCTCTATGGAGCTATTGCGG - Exonic
1107399561 13:40056041-40056063 AGTGCTCTACTGAGATCAGGAGG + Intergenic
1107818143 13:44262560-44262582 TGAGATCTACGGAGATCCTGTGG - Intergenic
1107987492 13:45787795-45787817 TGTGCTTTAGGGAGCTACTGTGG + Intronic
1109683571 13:65784301-65784323 TGGGCACTAAGGAGCGCCGGAGG - Intergenic
1109994701 13:70108063-70108085 TGAGCGCTCCGAAGCTCCGGAGG + Exonic
1111218763 13:85178411-85178433 TGTGCTCTGCAGAGCTACAGAGG - Intergenic
1117296687 14:54386852-54386874 TGTGCTGTACAGAGCGCAGGGGG - Intergenic
1128706727 15:69842318-69842340 TGTGCTTTCAGGTGCTCCGGAGG + Intergenic
1129098650 15:73236866-73236888 TGTGGGCTGCGGAGCTCCAGGGG + Intronic
1129817380 15:78566387-78566409 TGTGCTCTAAGGAGCTAGTGAGG - Intronic
1141896236 16:86960338-86960360 TGTGCTCCACGAAGCGCTGGGGG - Intergenic
1159947951 18:74457674-74457696 TGCGCTCTACAGAGCGCTGGGGG - Intronic
1161633933 19:5375195-5375217 TGTGCTCTACGGAGTCATGGTGG + Intergenic
1163509693 19:17727313-17727335 TGCCCTCTGCGGGGCTCCGGTGG - Exonic
1163709997 19:18840671-18840693 AGTGCTGTTCGGGGCTCCGGAGG + Intronic
1167445544 19:49535038-49535060 TGTCCTCCACAGGGCTCCGGGGG + Intronic
933355049 2:81199353-81199375 TGTGCTCCTTGGAGCTCTGGAGG + Intergenic
934637782 2:96006856-96006878 TGTGCTCTGCACAGCTCCAGGGG + Intergenic
945525475 2:210883627-210883649 TGTGCTATACTGAGCTATGGTGG - Intergenic
947198892 2:227597228-227597250 TGTGATCTAAGGACCTCTGGAGG + Intergenic
947559779 2:231138793-231138815 TGTGCGCTACGGAGCTGCAATGG + Exonic
948224024 2:236294764-236294786 TCTGCCCTTCGGAGCTGCGGGGG - Intergenic
1175187933 20:57191278-57191300 TGTGCTCTGGGGTGCTCCAGAGG + Intronic
1178267185 21:31154421-31154443 TGTACTCTTCGGAGCACAGGGGG + Exonic
950579008 3:13850694-13850716 AGTGCACCAGGGAGCTCCGGGGG - Intronic
966821844 3:183930949-183930971 TATGCTCCAGGGAGCCCCGGTGG + Intronic
968635276 4:1675293-1675315 TGTGCTTCCCGGAGCTCAGGTGG - Intronic
974800334 4:66809340-66809362 TGTGGTCTAGGGATCTCTGGGGG - Intergenic
981325528 4:143442403-143442425 TGTGCTCTACAGAGCTCAAGGGG - Intronic
988859593 5:35263836-35263858 TGTGGTCCACGGACCTCTGGGGG - Intergenic
991232042 5:64345271-64345293 TGTGCACTGCGGAGCTCCAGAGG - Intronic
992563631 5:77976304-77976326 TTTGCCCTGCGGAGCTCCTGAGG + Intergenic
1001302574 5:170546361-170546383 AGTGCTCTATGCAGCTCAGGTGG - Intronic
1001771617 5:174301339-174301361 TGTGGTCTCCTGAGCTCTGGAGG - Intergenic
1029665429 7:101992194-101992216 TGTGCTTTAAGGAGCTCAGTAGG - Intronic
1038351790 8:26782741-26782763 TGTGCAGGACGGAGCTCAGGTGG - Intronic
1039320226 8:36421877-36421899 TGTGCTTTACTGAGCACTGGAGG + Intergenic
1042367881 8:67957398-67957420 TGTGCTCCCTGGAGCTCCAGAGG + Intronic
1048996023 8:139794172-139794194 TCTGCTCTCAGGAGCTCCTGGGG - Intronic
1055192460 9:73542032-73542054 TGTGCTCTACACAGCTCCAGGGG - Intergenic
1059218087 9:112585516-112585538 TGTCCTCCACGGGGCTCAGGGGG + Intronic
1193671312 X:84389770-84389792 TGTGCACTGGGCAGCTCCGGTGG - Intronic
1201261066 Y:12159321-12159343 TGTGTTCTTCGGATCTCCTGGGG + Intergenic