ID: 905926348

View in Genome Browser
Species Human (GRCh38)
Location 1:41752504-41752526
Sequence TTCCCTCAGCCCCCTAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 287}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905926348_905926353 -8 Left 905926348 1:41752504-41752526 CCCAGCCTAGGGGGCTGAGGGAA 0: 1
1: 0
2: 1
3: 28
4: 287
Right 905926353 1:41752519-41752541 TGAGGGAAAGACCCAGTGGGAGG 0: 1
1: 10
2: 139
3: 1085
4: 2900
905926348_905926356 19 Left 905926348 1:41752504-41752526 CCCAGCCTAGGGGGCTGAGGGAA 0: 1
1: 0
2: 1
3: 28
4: 287
Right 905926356 1:41752546-41752568 CAAAATACATCCAACACTCCAGG 0: 1
1: 0
2: 0
3: 13
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905926348 Original CRISPR TTCCCTCAGCCCCCTAGGCT GGG (reversed) Intronic
900324987 1:2104331-2104353 TTCCCTCAGCCCGTGGGGCTAGG - Intronic
900472949 1:2863559-2863581 TTCCTTCAGTCCCTTAGCCTTGG + Intergenic
901090071 1:6635037-6635059 TTCCACCGGCCCCCTCGGCTTGG - Exonic
901119930 1:6883007-6883029 TTGCCTCAGCCTCCCAAGCTGGG + Intronic
903548250 1:24140688-24140710 TTCCCTCAGGCCCCCAGGCTTGG + Intronic
903938083 1:26910477-26910499 TTCTCTAAGCCCCCCAGGTTAGG - Intronic
904585155 1:31576080-31576102 TCCACTGTGCCCCCTAGGCTTGG - Intergenic
904753144 1:32753818-32753840 TCCCCTGTGCGCCCTAGGCTGGG + Intronic
905926348 1:41752504-41752526 TTCCCTCAGCCCCCTAGGCTGGG - Intronic
906225617 1:44119025-44119047 TCCCCGCCGCCCCCTAGCCTGGG - Intronic
906356535 1:45111128-45111150 TTTCCTGAGCCCCCTAGACTTGG - Intronic
907178166 1:52545024-52545046 CTCACTCTGTCCCCTAGGCTGGG - Intronic
907667973 1:56449964-56449986 TTCCTTAATCCCCCTGGGCTGGG - Intergenic
907987096 1:59542900-59542922 TTCCCTAAGGCACCTAGGATGGG + Intronic
908060900 1:60347791-60347813 TTCCTCCCTCCCCCTAGGCTAGG - Intergenic
909352564 1:74671997-74672019 TTCCCTTTTCCCCATAGGCTTGG + Intronic
913117891 1:115713491-115713513 TTCCCTCAGCTTCCTACCCTGGG + Intronic
913494578 1:119416627-119416649 TTCCCCCAGTCCCCTGGGTTGGG - Intronic
914084324 1:144439094-144439116 CTGCCTCAGCCTCCTAGGCAGGG + Intronic
914827413 1:151145861-151145883 TTCCTTCAGCCCGCTCGGCCCGG - Intronic
915699796 1:157781050-157781072 TCCCCTCAGACACCAAGGCTGGG - Intergenic
915915369 1:159937451-159937473 TTCAATCAGCCTTCTAGGCTCGG - Intronic
916847723 1:168670498-168670520 TTCCCTAAGCAACCTAGACTGGG - Intergenic
917708540 1:177659631-177659653 TTCTCTGACCTCCCTAGGCTGGG - Intergenic
917869976 1:179232639-179232661 CTCCCTCTGTCACCTAGGCTGGG - Intergenic
920042591 1:203112181-203112203 CTCACTCTGCCACCTAGGCTGGG + Intronic
920293385 1:204940015-204940037 GGCCCTCAGCTCCCCAGGCTGGG - Intronic
920341754 1:205279557-205279579 TTCCCACAGCCCCCAGGGCTTGG - Intergenic
922015143 1:221637669-221637691 ATCCCATCGCCCCCTAGGCTTGG + Intergenic
922314918 1:224434291-224434313 CTCCCTCCGCCGCCGAGGCTCGG + Exonic
922370518 1:224906438-224906460 TTCCCTCAGACCCCAAGGCAAGG + Intronic
922843377 1:228663661-228663683 TTCACTCTGTCCCCCAGGCTGGG + Intergenic
923050410 1:230387785-230387807 TTCCCACACGCTCCTAGGCTCGG + Intronic
923928565 1:238664851-238664873 CTCACTCTGCCACCTAGGCTGGG - Intergenic
924599123 1:245472775-245472797 CTCCCTGAGCCCCTTGGGCTGGG + Intronic
924783919 1:247176903-247176925 TTCCCCCACCCCCACAGGCTTGG + Intergenic
1062760345 10:12529-12551 GTCCCTCAGAGCCCTAGGGTGGG - Intergenic
1065831828 10:29621478-29621500 TTCCCTCTGCACCTTGGGCTTGG - Intronic
1067297355 10:44982451-44982473 TTCCCTGTGCCCCCTAGGGATGG - Intronic
1067478798 10:46582488-46582510 TCCCCTGAGCCCCATAGGCCAGG - Intronic
1067615941 10:47759313-47759335 TCCCCTGAGCCCCATAGGCCAGG + Intergenic
1069404707 10:68086715-68086737 TTGCCTCAGCCTCCTGAGCTGGG + Intergenic
1072077437 10:91991412-91991434 CTCACTCTGCCACCTAGGCTGGG - Intronic
1072257968 10:93638862-93638884 TTCCCCCAGCCCCTGAGCCTGGG - Intronic
1072929624 10:99650705-99650727 TTCCCTGATCCTCCTTGGCTGGG + Intergenic
1073068896 10:100781155-100781177 TTCTCTCTGCCCCCCAGCCTTGG + Intronic
1073390947 10:103175980-103176002 TACCCTCTGCCCCCTTGGCTTGG - Intronic
1073438140 10:103534897-103534919 TCAGCTCAGCCCCATAGGCTGGG + Intronic
1075538358 10:123290652-123290674 TTCCCTCATCTCCCTGGGCCTGG - Intergenic
1075583022 10:123636484-123636506 CTCCCTCAGCCCCTCAGACTTGG - Intergenic
1076692836 10:132232522-132232544 TGCCCTCAGCCCCCCAGGCCTGG - Intronic
1077137542 11:1008489-1008511 TTCCTTCGGCCCCCTGGCCTGGG + Intronic
1077462405 11:2717208-2717230 GTCCCTCAGACCCCACGGCTTGG + Intronic
1078577485 11:12514157-12514179 TGCCCTCATCCCCCTCAGCTGGG - Intronic
1081213953 11:40371396-40371418 TTCCTTCAGTCCCATAGGCATGG + Intronic
1081656897 11:44863335-44863357 TTCCCGCAGGCCTCCAGGCTTGG + Intronic
1081802498 11:45869658-45869680 TGCCCTCAGCCCACTTGGCCAGG - Exonic
1082911644 11:58383077-58383099 TTCCCTCAGCCCCCTGACCCTGG - Intergenic
1083789718 11:64976717-64976739 TTCCCTCAGCCTTGGAGGCTGGG - Intergenic
1087880990 11:103416148-103416170 CTCCCTCAGCCCCCCAGCCTGGG - Intronic
1088882114 11:113980503-113980525 TTTCCTCAGCCTTCTGGGCTTGG - Intronic
1089784476 11:120898353-120898375 TTCCCTCAGCCCCCCAACCCTGG + Intronic
1091139776 11:133224872-133224894 TTCCATCATCCTCCTAGGCTTGG + Intronic
1091772955 12:3165152-3165174 TTCACTCACAGCCCTAGGCTGGG + Intronic
1092013278 12:5134796-5134818 TTTTCTCAGCTCCCTGGGCTGGG - Intergenic
1092124898 12:6068102-6068124 TTCACTCAGTCGCCCAGGCTGGG - Intronic
1092241499 12:6838983-6839005 TGCCCTCATCCCTCCAGGCTCGG + Exonic
1095973803 12:47925273-47925295 CTGCCTCAGCCTCCTAAGCTGGG - Intronic
1097180653 12:57169832-57169854 TCCCCACCGCCCCCGAGGCTGGG - Intronic
1101107170 12:101452292-101452314 CTGCCTCAGCCACCTGGGCTGGG + Intergenic
1102026495 12:109716782-109716804 TTCCCTCATCTCCCTGGGCTTGG + Intronic
1102106746 12:110331209-110331231 TTCACTCTGTCGCCTAGGCTGGG - Intronic
1102414199 12:112746453-112746475 TTCCCTCAACACCTAAGGCTTGG - Intronic
1103171683 12:118825761-118825783 CTACCTCAGCCCCCCAAGCTGGG - Intergenic
1103724058 12:122989234-122989256 TTCCCCCAGGCCTCAAGGCTGGG + Intronic
1104320676 12:127748004-127748026 TGCCCACAGCCCTCTAGGCAGGG - Intergenic
1108315310 13:49231243-49231265 TTCCCTCAGCCTTGTAGGTTTGG + Intergenic
1109935966 13:69284773-69284795 CTCCCTCAGCCTCCCAAGCTGGG - Intergenic
1110952548 13:81514697-81514719 TTCCCTCAGGCCCCCAAACTTGG + Intergenic
1111868075 13:93794931-93794953 TTCCATCAGCCCCCTGAGATTGG + Intronic
1112349090 13:98618128-98618150 ACTCCTCAGCCTCCTAGGCTGGG + Intergenic
1112519782 13:100085205-100085227 CTCCCTCAGTCACCCAGGCTGGG + Intergenic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1113788580 13:113015646-113015668 CTCCCTCAGACCCCAAGGCCCGG - Intronic
1113930293 13:113964749-113964771 TGCCCTCAGTCCCTCAGGCTCGG + Intergenic
1117051165 14:51860772-51860794 TTACCTTAGCTCCCGAGGCTTGG - Exonic
1117996250 14:61480949-61480971 TACCCTCATCCTTCTAGGCTGGG + Intronic
1118142327 14:63097644-63097666 CTCCCTCAGCCTCCTGAGCTGGG - Intronic
1119720303 14:76885490-76885512 TTCCCAGAGCCCTCTGGGCTGGG + Intergenic
1119969402 14:78952541-78952563 TTCCACCAGCCCCTTTGGCTAGG - Intronic
1120340607 14:83216782-83216804 TTTCCTCAGACCCCTGGGCCTGG + Intergenic
1122554009 14:102566931-102566953 TTCCCTCTGTCACCCAGGCTAGG + Intergenic
1122871177 14:104639736-104639758 AACCCTCAGCCCCCGAGGCCAGG - Intergenic
1123042912 14:105497746-105497768 GTCCCTCTGTCCCCTTGGCTTGG + Intronic
1125388085 15:39159545-39159567 TACCCCCAGCCCCCAAAGCTTGG - Intergenic
1126024756 15:44435142-44435164 CTGCCTCAGCCCCCGTGGCTGGG - Intronic
1127901198 15:63342198-63342220 CCCCCTCAGCCCCCCAGACTAGG + Intronic
1128081804 15:64861423-64861445 TTCCCACACTCCCCAAGGCTTGG + Intronic
1128457295 15:67838833-67838855 GTCCCGCAGTCCCCTATGCTCGG + Intergenic
1128514297 15:68332538-68332560 TTCCCTCTGCCCGCGAGGCGAGG - Intronic
1130349765 15:83080607-83080629 TCACCTCAGCCTCCTGGGCTGGG - Intergenic
1131436344 15:92425782-92425804 TACCCTAAGTACCCTAGGCTAGG - Intronic
1131475796 15:92738217-92738239 TTCCCTCTGTCGCCCAGGCTGGG + Intronic
1131512616 15:93057568-93057590 TTGCTTAAGCCTCCTAGGCTGGG + Intronic
1132114235 15:99124122-99124144 TTCTCACAGTCCCCGAGGCTTGG + Intronic
1132403620 15:101529020-101529042 TTCACACAGCCCCATAGCCTGGG + Intergenic
1132671403 16:1103547-1103569 GCCCCTCAGGCCCCCAGGCTGGG + Intergenic
1132698515 16:1212420-1212442 CTCCCTCAGCCCCCGTGTCTCGG - Intronic
1133154531 16:3863789-3863811 TTCCCTCAGCCCTGAAGGGTGGG + Intronic
1134117707 16:11561665-11561687 CTCCCTCAGGCCCCAAGGCCAGG + Intronic
1134154848 16:11834912-11834934 TTCCCTGTGTTCCCTAGGCTGGG - Exonic
1134269696 16:12722818-12722840 TTCCCACGGACCCCAAGGCTGGG + Intronic
1135012624 16:18895524-18895546 TTCCCCCTGCCCCCTAGAGTGGG - Intronic
1135319542 16:21483081-21483103 TTCCCCCCGCCCCCTAGAGTGGG - Intergenic
1135372379 16:21914569-21914591 TTCCCCCCGCCCCCTAGAGTGGG - Intergenic
1135439407 16:22456139-22456161 TTCCCCCCGCCCCCTAGAGTGGG + Intergenic
1136178528 16:28535140-28535162 GTCCCACAGCCCCCTTGGCCTGG + Intronic
1136329774 16:29564803-29564825 TTCCCCCCGCCCCCTAGAGTGGG - Intergenic
1136444401 16:30304507-30304529 TTCCCCCCGCCCCCTAGAGTGGG - Intergenic
1137042714 16:35628084-35628106 CTCCCTCTGTCCCCTAGGCTGGG + Intergenic
1137410101 16:48221126-48221148 TTCCTCCTGCCACCTAGGCTGGG - Intronic
1137709164 16:50554663-50554685 TTCACTCTGCCACCCAGGCTGGG + Intronic
1137913900 16:52407342-52407364 TTACCTCAGACCCTTAGGGTTGG + Intergenic
1138943235 16:61815619-61815641 TTCCCTAAGGACCCTTGGCTTGG + Intronic
1139096085 16:63705840-63705862 CTCCCTCAGTCGCCCAGGCTGGG - Intergenic
1141482806 16:84318198-84318220 TGCCCCCAGCCCCCAAGCCTGGG + Intronic
1142644826 17:1304912-1304934 TACCCTCAGCACACCAGGCTGGG - Intergenic
1142743493 17:1943447-1943469 TCCCCGCAGCCCCCTGGGCAGGG + Intronic
1142788915 17:2247750-2247772 TTCATTCTGTCCCCTAGGCTGGG - Intronic
1143136668 17:4716201-4716223 TTCCCTGGGCCCCCTGGACTTGG - Intronic
1143373191 17:6453179-6453201 TTCCCTGAGAACCCCAGGCTAGG - Exonic
1143529759 17:7496002-7496024 GTCCATCAGCCCCCCAAGCTTGG - Exonic
1144824632 17:18098908-18098930 TTCCCTCAGCCCCTGAGCCCCGG + Intronic
1145061122 17:19734645-19734667 TTGCCTCAGCCTCCTAAGTTGGG + Intergenic
1145226455 17:21132498-21132520 CTCCCTCTGCCACCTAGGCTGGG - Intronic
1145266492 17:21382122-21382144 TTCCTTCAGGCCCCTACTCTGGG + Intronic
1145981419 17:29014418-29014440 TACCCGCAGCCCCATGGGCTGGG + Intronic
1147373919 17:40012935-40012957 GTACCACAGCCCTCTAGGCTGGG + Intergenic
1147848940 17:43426284-43426306 TTTCCTCAGCCCCCTAGACAAGG + Intergenic
1147897284 17:43758881-43758903 TTCCCTCAGCCCCGGAGGGAGGG + Intergenic
1148187679 17:45656293-45656315 TTTCCCCAGCCCCCTAGACTAGG - Intergenic
1148328002 17:46795141-46795163 TTCCCTCAGCACCCGAGGGTGGG - Intronic
1151497206 17:74466179-74466201 TTCCCTCAGCCCCGAAGCCCAGG + Intergenic
1151557575 17:74854390-74854412 TTCCCTCAGCTTCCTAGGTCAGG - Intronic
1151725386 17:75880831-75880853 TTTCCCCAGCTCTCTAGGCTTGG + Intronic
1151757595 17:76083489-76083511 GTCCCTGAGCCCCCTAGTCCTGG - Exonic
1151957286 17:77386703-77386725 TTCCCCCAGCCCCCTGGGGCAGG - Intronic
1152390466 17:80001190-80001212 TTCCCTCAGACCCCTGGCATCGG + Intronic
1152798212 17:82318161-82318183 CTCCCTCAGCCCCTGAAGCTGGG - Intergenic
1152953253 18:12883-12905 GTCCCTCAGAGCCCTAGGGTGGG - Intergenic
1155100677 18:22607237-22607259 TCACCTCAGCCCGATAGGCTGGG - Intergenic
1160377440 18:78423644-78423666 GGCCCTCAGCCCCCATGGCTTGG - Intergenic
1161231448 19:3176927-3176949 TCCCCTCAGACCCCAAGGCAGGG + Intronic
1163039862 19:14594165-14594187 CTGCCTCAGCCCCCTCAGCTGGG - Intronic
1163383365 19:16983284-16983306 CTGCCTCAGCCTCCTGGGCTGGG - Intronic
1165105950 19:33469777-33469799 TTCCCTCCTCCCCCAAGGCAAGG - Intronic
1165315836 19:35054874-35054896 TTCCCACAGCCCCGCAGGTTGGG - Intronic
1165759950 19:38315290-38315312 TTCACTGACACCCCTAGGCTGGG + Intronic
1166160501 19:40949226-40949248 TTCCCTCAGCCCCTTCAGCGGGG - Intergenic
1166169380 19:41016819-41016841 TTCCCTCAGCCCCTTCAGCGGGG - Exonic
1166356563 19:42230675-42230697 TTACCTCTGCCCTCTAGTCTAGG + Exonic
1166938701 19:46350274-46350296 ATCCCTCAGCCCCCAAAGCCCGG - Intronic
1167170257 19:47826181-47826203 TTCCCCCAGCCCCCTAACCTGGG - Intronic
1167260208 19:48453994-48454016 TGCCCCCAGGCCGCTAGGCTGGG + Exonic
1167431648 19:49458664-49458686 TGCCCTCAGGGCCCTAGGCAAGG - Intronic
1168354374 19:55692420-55692442 CTCCCTCAGCTCCCACGGCTCGG - Intronic
926598752 2:14818999-14819021 TTCCCTGAACAGCCTAGGCTGGG + Intergenic
926891092 2:17639339-17639361 TTGTCTCAGCCGCCTTGGCTGGG + Intronic
926935637 2:18084614-18084636 TTCCCTAAGTCCCTAAGGCTTGG + Intronic
927700291 2:25263865-25263887 TTCCCTGAGGCCCTTAGGCAGGG + Intronic
927809981 2:26175379-26175401 TTCCCCCAGGCCCCAGGGCTGGG + Intronic
928231606 2:29503649-29503671 TTCACTCATGCCCCTGGGCTGGG - Intronic
928582077 2:32718995-32719017 CCTCCTCTGCCCCCTAGGCTTGG - Intronic
929065414 2:37968325-37968347 CTGCCTCAGCCCCCCAAGCTGGG - Intronic
931173936 2:59834027-59834049 CTCCCTCAGCACCCCAGGCTGGG + Intergenic
932410888 2:71547059-71547081 TTCCCTCAGCCCAGGAAGCTGGG - Intronic
932479585 2:72031223-72031245 TTCCCCCAGCCCCCTACCCAGGG + Intergenic
934759237 2:96844401-96844423 CTTGCTCAGCCACCTAGGCTGGG - Intronic
935136531 2:100308286-100308308 GTCTCTCTGTCCCCTAGGCTAGG - Intronic
935200735 2:100854312-100854334 TTCCTTAAGCCACTTAGGCTTGG - Intronic
935914933 2:107938723-107938745 CTCACTCAGCCACCCAGGCTCGG - Intergenic
938073657 2:128320851-128320873 TTGCCCCAGCTCCCTAGGCCAGG + Intergenic
938273255 2:129993562-129993584 TTCCCTCGGCCCCCCATGCCCGG + Intergenic
938496514 2:131800859-131800881 GTCCCTCAGAGCCCTAGGGTGGG + Intronic
940428461 2:153557862-153557884 TTCCCACAGTCCCCTCGGCCTGG + Intergenic
941914006 2:170796464-170796486 CTCCCTCAGTCACTTAGGCTGGG + Intronic
942612645 2:177757770-177757792 TCACCTCATCCCCCCAGGCTGGG - Intronic
945137155 2:206641535-206641557 TTGCCTCAGGCCCCTTGGCTGGG + Intergenic
947914508 2:233822758-233822780 TTCCCTCAGTCCCTTGGGCTGGG + Intronic
947979245 2:234395266-234395288 TTCCCTCTACCCCAAAGGCTGGG - Intergenic
948922208 2:241071098-241071120 GTCCTTCAGCCTCCCAGGCTGGG - Intronic
949069556 2:242015929-242015951 TTCCCTCTGCCCCCTGCCCTCGG - Intergenic
1168808644 20:688541-688563 TTCCCTGATCCCTCTGGGCTGGG - Intergenic
1169494612 20:6102644-6102666 TTCACTCTGTCACCTAGGCTGGG - Intronic
1170697781 20:18675235-18675257 TTCCCCCAGAGCCCTAGCCTTGG + Intronic
1170757027 20:19213300-19213322 CTCCATCAGCCCCCAAGGCCAGG + Intronic
1170771831 20:19339676-19339698 GGCCCTCAGCCCCCAAGTCTTGG - Intronic
1171225474 20:23438800-23438822 TTACCTCATCTCCCTAAGCTGGG - Intergenic
1171252165 20:23656613-23656635 TTCCCTCAGCCCCTGAGGTCTGG + Intergenic
1172038663 20:32028625-32028647 TTCCCTAATTCCCCTAGGTTGGG - Intronic
1173162966 20:40665923-40665945 TTCCATTATCCCCCTAGGCTAGG - Intergenic
1175182856 20:57160782-57160804 CTCCCTCATCCCTTTAGGCTTGG + Intergenic
1176061721 20:63175551-63175573 TTCCCCCAGCCCGCCTGGCTGGG + Intergenic
1176067500 20:63206012-63206034 TTCGCTCACCCCCCCAGTCTGGG - Intronic
1178592704 21:33924858-33924880 GTCCCCCAGGCCCCAAGGCTTGG - Intergenic
1178961354 21:37069015-37069037 CTCCCTCAGCCCTCAAAGCTGGG - Intronic
1179243037 21:39608831-39608853 TTTCCTCAGCCCCCTGGGAGGGG + Intronic
1181330671 22:22088182-22088204 TTCCCTCTGCTCTCTAGGCCTGG + Intergenic
1181509271 22:23381794-23381816 CTCCCTCAGCCCCCAACTCTTGG + Intergenic
1182356156 22:29723086-29723108 GTCCCTGAGCCCCCTGTGCTAGG - Intronic
1183357295 22:37366620-37366642 TCCCCTCAGGCCCCTCAGCTGGG - Intergenic
1183393066 22:37556788-37556810 TTCCCTTAGGCCCCTTGCCTTGG + Intergenic
1185086666 22:48744534-48744556 TTCCCTCAGCCCTGCAGCCTTGG + Intronic
950190123 3:10970803-10970825 TTCCCTCACTCCCCTTGGCAGGG + Intergenic
950728061 3:14932111-14932133 CTCACTCTGCCCCCCAGGCTGGG + Intronic
953133894 3:40166550-40166572 TTCCCACGGACCCCAAGGCTTGG - Intronic
953910964 3:46892850-46892872 TTTCCTCAGACCCCTGGGCAGGG - Intronic
954131568 3:48563813-48563835 CTCCCTCAGCCCCCTGGGGTGGG + Intergenic
954426902 3:50448073-50448095 TTCCCTAAGGGCCCTAGGGTAGG - Intronic
954441038 3:50522067-50522089 TTTCCCCAGCCACCTAAGCTGGG + Intergenic
954447713 3:50555547-50555569 TTCCCTTAGCTCCCTTGGGTTGG + Intergenic
961635367 3:128329672-128329694 TGCCCTCAGCACCCTAAGCTTGG - Intronic
962023997 3:131527983-131528005 TTGCCTCAGCCTCCTTAGCTGGG - Intergenic
962312214 3:134334642-134334664 TTCCCGCAGCCTCCTTGGCCTGG - Intergenic
963129154 3:141841937-141841959 CTCTCTCAGCCGCCCAGGCTGGG - Intergenic
966762434 3:183429358-183429380 TACCCTCAGCCCCCTGTGATGGG - Intergenic
966780926 3:183583784-183583806 TTCCCTCAGTTTCCTAGGGTTGG - Intergenic
968289278 3:197526253-197526275 TTCCCACAGCCCTCAGGGCTGGG - Intronic
969657145 4:8504920-8504942 TTCCCCCAGCCTCCTGGTCTGGG + Intergenic
969731223 4:8959209-8959231 GTGCCTCAGCCCCCTGGGATGGG - Intergenic
972670975 4:41214057-41214079 TTCCCTCAGCAGCCCCGGCTTGG - Intronic
973802918 4:54496538-54496560 GTCCATCAGACCCCAAGGCTGGG - Intergenic
974042146 4:56866570-56866592 CTGCCTCAGCCTCCTAGGTTGGG - Intergenic
976076069 4:81300509-81300531 CTCACTCAGCCACCCAGGCTGGG + Intergenic
978410253 4:108417551-108417573 CTCCCTGAGCCCTCTAGTCTTGG - Intergenic
979131974 4:117058700-117058722 ATCCCTCTGTCACCTAGGCTGGG + Intergenic
982111634 4:152061968-152061990 TTCTTGCAGCCCCCTGGGCTGGG + Intergenic
983407955 4:167354662-167354684 TTGCCTCAGCCTCCTGAGCTGGG - Intergenic
983423915 4:167558088-167558110 CTCACTCAGTCACCTAGGCTGGG + Intergenic
985071675 4:186171621-186171643 CTCCCTCAGCCTCCTGGGCCAGG + Intronic
985520530 5:372166-372188 TTCCCTCCTCCCCCAGGGCTGGG + Intronic
985645604 5:1083352-1083374 TTCCCTCAACCCCCTGGGGCAGG + Intronic
989071383 5:37514983-37515005 CTCACTCAGTCACCTAGGCTGGG - Intronic
989685253 5:44078104-44078126 TGCCATCAGCCCTCTAGACTGGG - Intergenic
994044960 5:95297263-95297285 TACCCTGAGCCCTTTAGGCTCGG - Intergenic
997266826 5:132499745-132499767 TTCTCACAGCCCCATGGGCTGGG + Intergenic
997298875 5:132787833-132787855 TTCCATCAGTCGCCCAGGCTGGG + Intronic
997434089 5:133861661-133861683 TTCCCTGAGCCCCCCAAGTTTGG - Intergenic
999456428 5:151720164-151720186 TTCCCCCAGCCCCTTTGCCTAGG + Intergenic
1002140128 5:177133195-177133217 TGCCCTCAGCCCGCTGGGTTCGG - Intronic
1002204070 5:177550858-177550880 TTCCCTCTCTCCCCCAGGCTGGG + Intronic
1003183179 6:3809242-3809264 TTCCCTTAGCTCCCCAGGGTTGG - Intergenic
1005587957 6:27295351-27295373 TTCCCTCCGCCCCATAGTTTGGG - Intronic
1005719496 6:28587229-28587251 TTCCCTCGACCCACTAGTCTGGG - Exonic
1006133616 6:31883004-31883026 TCCCCTCCGCACCCTAGGATGGG - Exonic
1007299111 6:40852985-40853007 GTCCCTCAGCCACTTGGGCTGGG - Intergenic
1011515377 6:88147433-88147455 CTCCTTCAGCCCTCTAGACTGGG - Intronic
1013596085 6:111662289-111662311 TTCCCTCTGGCCCCTTGGCAGGG - Intronic
1014006207 6:116421585-116421607 CTGCCTCAGCCTCCTAAGCTGGG + Intronic
1016915152 6:149237772-149237794 ATCCCTGAGCCCACTATGCTCGG - Intronic
1017360931 6:153570542-153570564 TTGCCTCAGCCCCAGAAGCTGGG + Intergenic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1022902578 7:34825500-34825522 TTACATCAGCCCCCTGGGCTAGG - Intronic
1023996485 7:45161916-45161938 TTCTCTCAGCACCCTTGGGTGGG - Intronic
1024865010 7:53895809-53895831 TTCCCTCAGCCTCTTAGTCCTGG + Intergenic
1026018799 7:66692901-66692923 TTGCCTCAGCCCTCAAGCCTGGG - Intronic
1026827627 7:73594218-73594240 CTCCCTCCACCCCCGAGGCTGGG + Intronic
1027445414 7:78267794-78267816 TTCCCTGAAACCCCTAGGCTAGG - Intronic
1028434449 7:90785754-90785776 CTCACTCAGCCGCCCAGGCTGGG - Intronic
1029100134 7:98122744-98122766 CTCACTCTGTCCCCTAGGCTGGG + Intronic
1029300671 7:99580278-99580300 TTCCATGCGCCCCCTAGGGTGGG + Intronic
1029594253 7:101528436-101528458 TTCCCTCAGGCCCCAAGGGTGGG + Intronic
1033107972 7:138547704-138547726 TTCCCTCTGTCACCCAGGCTTGG + Intronic
1033361687 7:140642444-140642466 CTGCCTCAGCCTCCCAGGCTTGG + Intronic
1035114798 7:156515740-156515762 TTCCCCCAGACCCCTAGGGAAGG + Intergenic
1036595273 8:10206367-10206389 TGCCCTCAGAACCCTGGGCTGGG + Intronic
1037878490 8:22561223-22561245 AGCCCTCAGCCCCCTACTCTAGG + Intronic
1038323030 8:26546889-26546911 CTCCCTCAGTCGCCCAGGCTGGG - Intronic
1038812089 8:30858341-30858363 CTCCCTCTGTCACCTAGGCTGGG + Intronic
1038987637 8:32829697-32829719 CTCCCTCTGTCCCCCAGGCTGGG - Intergenic
1040414006 8:47181365-47181387 TTGCCTCAGCCCACTAGACTGGG - Intergenic
1040501178 8:48006904-48006926 CTCGCTCTGTCCCCTAGGCTGGG + Intergenic
1042345009 8:67718422-67718444 TTGCCTCATTCACCTAGGCTAGG + Intronic
1042353310 8:67800029-67800051 CTCCCTCTGTCACCTAGGCTGGG - Intergenic
1043698055 8:83246056-83246078 TTCACTCTGCCACCTAGGCTGGG - Intergenic
1044659022 8:94577654-94577676 CTCGCTCTGCCACCTAGGCTGGG - Intergenic
1048226502 8:132592296-132592318 TTCCCTGAGCCCCCAAAGCTAGG - Intronic
1049379271 8:142303930-142303952 TTTCCTCAGGCCCCTCGGCAGGG + Intronic
1049443511 8:142619699-142619721 TTCCCGCAGCCCCAGGGGCTGGG - Intergenic
1049698746 8:143996965-143996987 TTCCCGCTGCCCCCAAGTCTGGG - Intronic
1050388428 9:5112878-5112900 CGCCCTCAGCCCCGTGGGCTGGG + Intronic
1052817425 9:33112268-33112290 ACCCCTCAGGCCCCTAGGCTGGG - Exonic
1052947848 9:34182739-34182761 TTCACTCAGTCGCCCAGGCTGGG + Intronic
1056570329 9:87809226-87809248 CTCCCTCTGTCACCTAGGCTGGG + Intergenic
1057212201 9:93206378-93206400 TGCCCTCAGCCACCAAGGCCAGG - Intronic
1059786437 9:117591333-117591355 TTCCCTGAACCCTCCAGGCTAGG - Intergenic
1060498786 9:124137300-124137322 TTCCCTGATCCCCCTGGGTTGGG + Intergenic
1060773947 9:126355294-126355316 TTTCCGCAGACCCCTAGGATGGG - Intronic
1060807847 9:126588662-126588684 TGCCCTCAGCTCCCCAGCCTGGG - Intergenic
1061159578 9:128885480-128885502 TTCCCTGACCCCACTAGTCTGGG + Intronic
1061553153 9:131349620-131349642 TTCACTCAGCCCTCGAGCCTGGG - Intergenic
1061743819 9:132725619-132725641 TGCCCCCAGCCCCCCAGCCTCGG - Exonic
1062211726 9:135368050-135368072 CTCCCTCTGTCCCCCAGGCTGGG - Intergenic
1186105341 X:6199974-6199996 TTCCCTCAGTCTCCCTGGCTTGG + Intronic
1187127674 X:16469303-16469325 TTCCCTCCTCCCCCTCTGCTTGG - Intergenic
1187445218 X:19355201-19355223 TTCCCTCACCACCCAAAGCTCGG + Intronic
1187877925 X:23819425-23819447 CTCCCTCTGCCACCCAGGCTGGG - Intergenic
1190128504 X:47725725-47725747 ATCCCTCAGCCCCCTCGGCATGG - Intergenic
1190295866 X:49027146-49027168 TTCCCTCTGTCACCCAGGCTGGG - Intergenic
1192308526 X:69988915-69988937 TTCCCTCAGCCCCTGGTGCTAGG + Intronic
1194672363 X:96750168-96750190 TTGCCTCAGCCTCCTACGCCTGG + Intronic
1196701966 X:118679488-118679510 CTGCCTCAGCCCCCTAGTGTTGG - Intronic
1196793673 X:119485882-119485904 TTCCCTCTGTCGCCCAGGCTGGG - Intergenic
1197764405 X:130050628-130050650 TTCCCTTAGCCCCGTATGCATGG + Intronic
1198555071 X:137784040-137784062 CTCACTCAGTCACCTAGGCTGGG - Intergenic
1199180525 X:144848680-144848702 TTCCCTTACCCTCCTTGGCTGGG - Intergenic
1200061295 X:153484931-153484953 CACCCTCAGCCCCCGTGGCTAGG - Intronic