ID: 905926972

View in Genome Browser
Species Human (GRCh38)
Location 1:41758156-41758178
Sequence CCGGGGAAGGCAGCCTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 197}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905926972_905926979 -8 Left 905926972 1:41758156-41758178 CCAACCAAGGCTGCCTTCCCCGG 0: 1
1: 0
2: 3
3: 22
4: 197
Right 905926979 1:41758171-41758193 TTCCCCGGACAGGTTTTGGTGGG 0: 1
1: 0
2: 1
3: 4
4: 79
905926972_905926978 -9 Left 905926972 1:41758156-41758178 CCAACCAAGGCTGCCTTCCCCGG 0: 1
1: 0
2: 3
3: 22
4: 197
Right 905926978 1:41758170-41758192 CTTCCCCGGACAGGTTTTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 105
905926972_905926980 -7 Left 905926972 1:41758156-41758178 CCAACCAAGGCTGCCTTCCCCGG 0: 1
1: 0
2: 3
3: 22
4: 197
Right 905926980 1:41758172-41758194 TCCCCGGACAGGTTTTGGTGGGG 0: 1
1: 0
2: 1
3: 7
4: 123
905926972_905926989 27 Left 905926972 1:41758156-41758178 CCAACCAAGGCTGCCTTCCCCGG 0: 1
1: 0
2: 3
3: 22
4: 197
Right 905926989 1:41758206-41758228 TTCCCAGGGCTCTGGTGTGAGGG 0: 1
1: 0
2: 2
3: 48
4: 332
905926972_905926985 13 Left 905926972 1:41758156-41758178 CCAACCAAGGCTGCCTTCCCCGG 0: 1
1: 0
2: 3
3: 22
4: 197
Right 905926985 1:41758192-41758214 GGGTCTGAAGACCATTCCCAGGG 0: 1
1: 0
2: 1
3: 14
4: 133
905926972_905926984 12 Left 905926972 1:41758156-41758178 CCAACCAAGGCTGCCTTCCCCGG 0: 1
1: 0
2: 3
3: 22
4: 197
Right 905926984 1:41758191-41758213 GGGGTCTGAAGACCATTCCCAGG 0: 1
1: 0
2: 1
3: 18
4: 199
905926972_905926988 26 Left 905926972 1:41758156-41758178 CCAACCAAGGCTGCCTTCCCCGG 0: 1
1: 0
2: 3
3: 22
4: 197
Right 905926988 1:41758205-41758227 ATTCCCAGGGCTCTGGTGTGAGG 0: 1
1: 0
2: 3
3: 39
4: 336
905926972_905926986 19 Left 905926972 1:41758156-41758178 CCAACCAAGGCTGCCTTCCCCGG 0: 1
1: 0
2: 3
3: 22
4: 197
Right 905926986 1:41758198-41758220 GAAGACCATTCCCAGGGCTCTGG 0: 1
1: 0
2: 1
3: 23
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905926972 Original CRISPR CCGGGGAAGGCAGCCTTGGT TGG (reversed) Intronic
900569107 1:3349651-3349673 CCGTGAAAGCCAGCCTTGGATGG + Intronic
901010468 1:6199129-6199151 CCGCGGAAGGGCGGCTTGGTCGG - Intronic
901040387 1:6359745-6359767 CCTGGGAAAGCAGCCCTGGTGGG - Intronic
901078646 1:6571294-6571316 AGGGGGCAGGCAGCCTTGGGGGG - Intronic
901324856 1:8360158-8360180 CCGGGGACGGGCTCCTTGGTGGG + Exonic
901922615 1:12547827-12547849 CCTTGGAGGGCAGCTTTGGTGGG - Intergenic
902411108 1:16212108-16212130 CCGAGGAAAGTACCCTTGGTGGG + Intronic
903761333 1:25700874-25700896 GCGGGGAATGCAGGCTTGGAAGG + Intronic
904354926 1:29932842-29932864 TCTGGGAAGGGAGGCTTGGTGGG - Intergenic
905926972 1:41758156-41758178 CCGGGGAAGGCAGCCTTGGTTGG - Intronic
906206911 1:43991854-43991876 CCGGGGACGGCGGCGTCGGTGGG + Exonic
907360989 1:53914781-53914803 CTGGGGGAGGCATCCTTTGTGGG - Intergenic
911706946 1:101025304-101025326 GTAGGGAAGGAAGCCTTGGTAGG - Exonic
912248843 1:107990225-107990247 CCGTGGCATGCAGTCTTGGTGGG + Intergenic
914412608 1:147445847-147445869 CTGGGAAAGGCAGCCTTCGTAGG - Intergenic
914870579 1:151470528-151470550 CTGGAGGAGGCAGCCTTAGTAGG - Intergenic
914922807 1:151859088-151859110 GAGGGCAGGGCAGCCTTGGTGGG - Intergenic
917523016 1:175763511-175763533 CCAGGGCAGACAGCCTTGGAAGG + Intergenic
920399837 1:205669868-205669890 TGGGGCAGGGCAGCCTTGGTGGG - Intronic
922619104 1:226979693-226979715 CCCCAGAAGGCAGCGTTGGTGGG - Intronic
922747628 1:228054077-228054099 CCAGAGATGGCACCCTTGGTGGG - Intronic
922802645 1:228371354-228371376 CCGGGGCACGCAGCCCTGGGCGG - Exonic
923363061 1:233231731-233231753 ACTGGGAAGGCAGGGTTGGTAGG + Intronic
1063954798 10:11255942-11255964 CAGGGGAAGGAATCCTTGGCTGG + Intronic
1067208301 10:44238298-44238320 ACTGGGCAGGCAGCCTTGGAGGG + Intergenic
1067247282 10:44557512-44557534 CCGGGAAAGGCAGCAGGGGTAGG - Intergenic
1067469132 10:46523521-46523543 CCCAGCCAGGCAGCCTTGGTAGG + Intergenic
1067772053 10:49133742-49133764 CCTGGGAAGGAAGCCCTGATGGG - Intronic
1067801267 10:49361061-49361083 CGGTGGAAAGCAGCATTGGTTGG - Intergenic
1072964129 10:99956517-99956539 CCCAGGAAGGCAGCCTTGCCAGG - Exonic
1075970681 10:126649785-126649807 CAGGGGGAGGCAGACCTGGTTGG - Intronic
1076727358 10:132419845-132419867 CCTGGGAAGACAGCCAGGGTTGG - Intergenic
1082296094 11:50442470-50442492 CCGGGGCAGGCATGCTGGGTTGG - Intergenic
1083195237 11:61082111-61082133 CTGGGGGAGGAAGCCTTGGCAGG + Intergenic
1083937839 11:65879748-65879770 AAGGGGAAGACAGGCTTGGTGGG - Intergenic
1084088493 11:66865643-66865665 CGCGAGATGGCAGCCTTGGTGGG - Intronic
1084544085 11:69805274-69805296 CAGGGGAAGACAGCCTTGCCTGG - Intergenic
1085508013 11:77071147-77071169 CTGGGGAAGCCAGCCTCGGTGGG - Intronic
1085714038 11:78856004-78856026 CTGGGAAAGGCAGCCCTGGTTGG - Exonic
1086120961 11:83304140-83304162 CAGAGGAAGGCAGACATGGTGGG + Intergenic
1090159335 11:124475717-124475739 CCAGGGAACCCAGTCTTGGTGGG - Intergenic
1092929745 12:13304730-13304752 CAGGGGACGGCATCTTTGGTAGG + Intergenic
1093079093 12:14788960-14788982 CAGGGGGAGGTAGCCTTGGTGGG + Exonic
1093261323 12:16940901-16940923 GCCAGGCAGGCAGCCTTGGTAGG + Intergenic
1093514984 12:19974846-19974868 CCAGGGTAGGCCGTCTTGGTAGG + Intergenic
1096428042 12:51520830-51520852 GCGGGGAAGAAAGCCTGGGTGGG + Intergenic
1097394763 12:59060320-59060342 CCTGGGAAGGCAGTGTTGGAGGG - Intergenic
1100694312 12:97075038-97075060 CCTGGGAAGGCAGCCTTCCTGGG - Intergenic
1102197106 12:111033868-111033890 CCGGGGGAGGCAGCCGGGGATGG - Intergenic
1102963904 12:117111829-117111851 CTGGGGCAGGCAGCCGGGGTGGG + Intergenic
1105018252 12:132799182-132799204 CCAGGGAAGACAGCCTTTGCTGG + Intronic
1105055413 12:133094432-133094454 CCGGAGAGGGCAGCCCAGGTTGG + Intronic
1106225838 13:27786367-27786389 CCGTAGAAGGCAGCATTGTTAGG - Intergenic
1106250052 13:27976306-27976328 GCGGGGAACCCAGCCCTGGTGGG + Intergenic
1110356520 13:74573873-74573895 CAGCCTAAGGCAGCCTTGGTGGG + Intergenic
1112664298 13:101551935-101551957 GCAGGGAGGGCAGCCTTGATGGG + Intronic
1114752438 14:25219999-25220021 CAGGAGAAAGCAGCCCTGGTTGG + Intergenic
1119702668 14:76765831-76765853 ACGGGGCAGGCAGGCCTGGTAGG - Intronic
1122314913 14:100820251-100820273 CGGTGGAAGGCAGCAGTGGTAGG + Intergenic
1123538312 15:21261533-21261555 CTGAGGAGGGCAGCCCTGGTGGG - Intergenic
1126679126 15:51187060-51187082 CCGGAGAAGGAAGCCAGGGTTGG - Intergenic
1127219869 15:56867927-56867949 CAGGGGAAGGCAATCTGGGTAGG + Intronic
1127696377 15:61451975-61451997 TACGGGAAGGCAGCCTTGGGAGG + Intergenic
1128072550 15:64806794-64806816 CTGGGAAAGGCAGCTCTGGTGGG + Intergenic
1130023582 15:80251737-80251759 CAGGGGACAGCAGCCTCGGTGGG - Intergenic
1131271355 15:90949440-90949462 CCAGGTGAGCCAGCCTTGGTAGG + Exonic
1132346377 15:101111483-101111505 CCGAGGAAGGCAGCCGAGGCAGG - Intergenic
1132580837 16:683986-684008 CAGGGGAAGGCGGCCTTGGGCGG + Intronic
1132710876 16:1266661-1266683 CCGGGGAAGGCAGGCAGGGATGG + Intergenic
1132839999 16:1974290-1974312 CAGGTGAGGGCAGCCTGGGTGGG + Exonic
1139515677 16:67451153-67451175 CTGGGGAAGCCAGCCTTGAGTGG - Intronic
1140528880 16:75647486-75647508 CCCGGCACAGCAGCCTTGGTGGG + Intronic
1141165020 16:81654586-81654608 CCGGGTCAGGCAGCCTGGGCTGG - Intronic
1141596681 16:85101158-85101180 CCAGGGATGGCAGGCTTTGTGGG + Intronic
1141674249 16:85509285-85509307 CGTGGGAAGGCAGTGTTGGTGGG + Intergenic
1142033968 16:87852386-87852408 CTGGGGACGGCAGCCTGGGAGGG + Intronic
1142107862 16:88315900-88315922 CCGGAGCAGGCAGCCTGGGCGGG - Intergenic
1142131389 16:88433074-88433096 CCGGGGCAGGGAGGCTTGGTTGG + Exonic
1142852548 17:2711337-2711359 CCGTGGAGGGCAGCCTCGGCTGG - Intronic
1143448716 17:7023248-7023270 TCGGGGAAGGGAGCCTCGGCTGG + Intronic
1143617326 17:8060454-8060476 CCGGAGATGGCAACCCTGGTTGG - Intergenic
1143870867 17:9956611-9956633 CAGGGGCTGGCAGCCTTGCTGGG - Intronic
1144094044 17:11883770-11883792 TCTGGGAAGGCAGCCTAGGCTGG + Intronic
1145193345 17:20866945-20866967 CGGAGGAGGGCAGCCTTGGTGGG - Intronic
1145298675 17:21614136-21614158 TGGAGGAGGGCAGCCTTGGTGGG + Intergenic
1145351604 17:22089154-22089176 TGGAGGAGGGCAGCCTTGGTGGG - Intergenic
1145403763 17:22568959-22568981 CTGAGGAGGGCAGCCTTGGTGGG - Intergenic
1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG + Intronic
1148872785 17:50668530-50668552 CTGGGGCAGGCAGCCCAGGTAGG - Intronic
1151969708 17:77451345-77451367 CCTGGGAAGGGAGGCTCGGTGGG - Intronic
1153276662 18:3374248-3374270 CCAGGGAATGCAGGCTGGGTGGG + Intergenic
1154105203 18:11516905-11516927 CCAGTGAAGTCAGCCTTGGCTGG - Intergenic
1156012758 18:32513241-32513263 CAGGGGGAGGTATCCTTGGTGGG - Intergenic
1159884559 18:73891760-73891782 CCGAGAAAGCCAGCCTTGGCTGG - Intergenic
1160554458 18:79716902-79716924 CAGGGATAGGCAGCCATGGTGGG - Intronic
1160764722 19:802365-802387 TCGGGGAGGCCAGCGTTGGTGGG + Intronic
1161343223 19:3753932-3753954 GCGGGAGAGGCAGCCTGGGTGGG + Intronic
1164938247 19:32231340-32231362 ACTGAGAAGGCACCCTTGGTGGG - Intergenic
1165606684 19:37111868-37111890 CCGGAGAGGGCAACCCTGGTTGG + Intronic
1167527784 19:49995711-49995733 CCAGGGAAGGCAGTCCTGATGGG + Intronic
926430063 2:12776547-12776569 ACAGGGAAGCCAGCCTTGATGGG + Intergenic
926757395 2:16247104-16247126 CCGTGGGAGGCAGCCTGGGAAGG + Intergenic
927870103 2:26617933-26617955 CTGGGGAGGGAAGCCTGGGTTGG + Intronic
930089749 2:47523135-47523157 CCTGGGCAGACAGCCTTGTTAGG + Intronic
931516800 2:63054914-63054936 CTCGGGAAGGAAGCCTGGGTGGG - Intronic
932220199 2:69993303-69993325 CTGGGGATGGCAGGCCTGGTGGG - Intergenic
934757213 2:96832579-96832601 CGGTGGAAGGCAGCCCTGGGCGG + Exonic
938092103 2:128440852-128440874 CCTGGGGAGGCGGCCTTGGCTGG + Intergenic
939700163 2:145381508-145381530 CAGAGGAAGGCAGCCTCAGTTGG + Intergenic
940116900 2:150219365-150219387 CCAGGGCAGGGGGCCTTGGTTGG + Intergenic
948219481 2:236258220-236258242 CCTGGGAAGGCAGTGTGGGTCGG + Intronic
948330071 2:237157520-237157542 CAGGTGCAGGCAGCCTTGGAGGG - Intergenic
948497481 2:238361556-238361578 CGGGGTAAGGAAGCCTTGGCTGG - Intronic
948503566 2:238411824-238411846 CCGGGGAAGGCAGGATCGGGGGG + Intergenic
948801849 2:240436618-240436640 CCAGCAAAGGCAGCCTAGGTGGG + Intronic
948826175 2:240574361-240574383 CCGGGGAGGGCAGCCACGGGGGG + Intronic
949009722 2:241671616-241671638 CCCGGGCAGGCAGCGCTGGTGGG - Intronic
1171561906 20:26134439-26134461 GCGAGGAGGGCAGCCTTGGTGGG - Intergenic
1173231832 20:41204497-41204519 CCGGGGAAGCCAGCTTTGTGTGG - Exonic
1173868827 20:46329484-46329506 CAGGGGAGGGCACCCTTGGAGGG + Intergenic
1174087721 20:48020762-48020784 CCGGGAAGGGCAGCCTTGGTGGG + Intergenic
1175408916 20:58753238-58753260 CCGGGGCAGGGAGCCTTTTTGGG + Intergenic
1176171332 20:63697678-63697700 CCTGAGAGGGCAGACTTGGTGGG - Intronic
1176649405 21:9531195-9531217 CGGAGGAGGACAGCCTTGGTGGG + Intergenic
1180274429 22:10631765-10631787 CCGAGGAGTGCAGCCCTGGTGGG + Intergenic
1181590543 22:23882528-23882550 CCGGGCACGGCAGCCCTGGCAGG - Exonic
1182675455 22:32035741-32035763 CTGGGGAAGGTAGGCTGGGTGGG + Intergenic
1182715314 22:32353226-32353248 CCGAGGAACGCAGCCAGGGTGGG - Intergenic
1183317395 22:37144191-37144213 CCGAGGAAGGAAGCCCTGGTGGG + Exonic
1183648094 22:39138417-39138439 CCGGGGAAGACAGCCTGGGTGGG - Intronic
1184093752 22:42305677-42305699 CCAGGGAAGGCAGTCTGGGGAGG - Intronic
1184894926 22:47401266-47401288 CCGTGGAAGGCACACATGGTGGG + Intergenic
1185249261 22:49791177-49791199 CCGGGGAAGTCAGCCCTGGCAGG + Intronic
949414520 3:3800307-3800329 CCGGGGAAGGCAGCTGGGGCTGG + Intronic
953346198 3:42177999-42178021 ACGTGGCAGGCTGCCTTGGTTGG + Intronic
953348086 3:42192787-42192809 TCTGGGGAGACAGCCTTGGTTGG + Intronic
954394762 3:50287628-50287650 CTGGGGAAGACTGCCTTGGAGGG + Exonic
954638719 3:52085496-52085518 GCAGGGAAGGCAGTATTGGTGGG - Intronic
954985333 3:54785711-54785733 CCACTGAAGACAGCCTTGGTTGG + Intronic
960519367 3:118637349-118637371 CCAGGGAAGGCAGTCTTCCTTGG + Intergenic
961125071 3:124409946-124409968 CCAGGGAGGGCAGCCTTAGGAGG + Intronic
961297175 3:125894477-125894499 CCGGAGAGGGCAACCTAGGTTGG - Intergenic
961619544 3:128212904-128212926 CCCAGGAAGGCAGCCCTGGAAGG - Intronic
962274129 3:133999478-133999500 CTGGGGGAGGCAGCCCTGCTCGG - Intronic
962284610 3:134075588-134075610 CCTGGGAAGGCCGCCGTGGATGG - Intronic
964201519 3:154122640-154122662 CCTGGGAGGGCAGCCTTTGGAGG - Exonic
965747038 3:171936720-171936742 CAGGGGAAGGCAGCCTGGGGAGG + Intronic
968739059 4:2318192-2318214 CTGGGGAAGGGAGCCTTTGGAGG - Intronic
969111946 4:4849729-4849751 CAGGGGAAGGCTGCCTTGTGGGG + Intergenic
973538287 4:51906828-51906850 CTGAGGGAAGCAGCCTTGGTAGG + Intronic
982127380 4:152196190-152196212 CCTAGGAAGGCAGCCTTGCTGGG - Intergenic
983139869 4:164136708-164136730 CATGGGAAGCCAGCCTTGGGGGG - Intronic
985929701 5:3047323-3047345 CAGGGTGAGGCAGACTTGGTGGG + Intergenic
989584612 5:43064912-43064934 CCGGGGAAAGTAGCCGTGCTAGG + Intergenic
999302750 5:150501280-150501302 ATGGGGTAGGCAGCCTTGGATGG + Intronic
1000328857 5:160192148-160192170 CCAGGGAAGGCTGGCTGGGTAGG - Intronic
1000672208 5:164076935-164076957 AGGAGGAAGGCAGCCCTGGTGGG - Intergenic
1002058537 5:176612482-176612504 GGGTGGAAGGCAGCCATGGTGGG + Intergenic
1006295295 6:33167487-33167509 CCGGGGAAGACAGGCCCGGTGGG - Exonic
1007476412 6:42122634-42122656 CCAGGCAAGGCAGCCATGATTGG - Intronic
1007663585 6:43501327-43501349 CCTGGGAACACAGCCTGGGTTGG - Intronic
1009642996 6:66362110-66362132 CCAGGGATGCCAGCTTTGGTGGG + Intergenic
1010169841 6:72961655-72961677 CTGGGGAAGGCAGGGTTGGTGGG + Intronic
1015924029 6:138291948-138291970 TCCGGGAAGGCAGCCGGGGTCGG + Exonic
1017421202 6:154274817-154274839 CTGGGGAAGGGAACCTTGATTGG - Intronic
1017850617 6:158302380-158302402 CAGGGGCAGGCATCCTGGGTTGG + Intronic
1018386570 6:163309770-163309792 CCGGGGAAGGCAGAGTTGTCAGG - Intronic
1018906629 6:168079568-168079590 GGGAGGAAGGCAGCCTGGGTGGG + Intronic
1019104941 6:169660249-169660271 CTGGGGAAGGGAGCCAGGGTTGG + Intronic
1019144753 6:169969585-169969607 CCGGGGAGGGCAGCTTTGCTGGG - Intergenic
1020093161 7:5352677-5352699 CTGGGGAAGCCAGCAGTGGTGGG - Intronic
1022055144 7:26723360-26723382 CCCGGGAAGGAAGCCGTTGTAGG - Intronic
1024555759 7:50602302-50602324 ACGGGGACGGTAGCCTTGGTGGG + Intronic
1025121528 7:56308061-56308083 CTGTGGAAGGCAACCCTGGTGGG + Intergenic
1025275965 7:57581254-57581276 CCAAGGAGGGCAGCCTTGGGGGG + Intergenic
1025713275 7:63931141-63931163 CCGGGGAAGGCGACCCTGGCAGG + Intergenic
1026739056 7:72967059-72967081 ACTGGGGAGGCAGCCTTTGTTGG + Intronic
1026790076 7:73325691-73325713 ACTGGGGAGGCAGCCTTTGTTGG + Intronic
1027104677 7:75398014-75398036 ACTGGGGAGGCAGCCTTTGTTGG - Intronic
1027263745 7:76482761-76482783 CCGGGTAAGGCGGCCCTGCTTGG - Exonic
1028964987 7:96792146-96792168 CCGAGGAAAGCACACTTGGTGGG + Intergenic
1033711247 7:143948650-143948672 CCAAGGAAGGCAGACTTGGTAGG + Intergenic
1034269146 7:149795288-149795310 CCCAGGAGGGCAGCCTGGGTGGG - Intergenic
1034345118 7:150381242-150381264 CCGGTGAAGGAAGTCTTGGAAGG + Intronic
1035174469 7:157040357-157040379 TTGGGTAAGGCAGCCTTGGCTGG - Intergenic
1035320374 7:158025419-158025441 CTGGGGAAGGCGGCCGTGCTGGG - Intronic
1035353079 7:158260259-158260281 CTTGGGAAGGCAGCCTAGGGCGG - Intronic
1038498362 8:28023330-28023352 CCGGGGGGGCCAGCCTTGCTGGG + Exonic
1039244686 8:35595870-35595892 CCTTGGTAGGCAGCCTGGGTAGG + Intronic
1039983562 8:42429010-42429032 CAGGAAAATGCAGCCTTGGTGGG - Intronic
1040317149 8:46269989-46270011 CTGGGGAGGGCAGCCCAGGTTGG + Intergenic
1045054604 8:98358289-98358311 CCGGGTCAGGCAGCCATGGCAGG + Intergenic
1045413447 8:101943255-101943277 TCTAGGATGGCAGCCTTGGTGGG - Intronic
1047351473 8:124078690-124078712 CCTGGGAAGGCATCCCAGGTGGG + Intronic
1049192318 8:141295180-141295202 CCAGGGAAGGCAGCCCCTGTGGG + Intronic
1049209452 8:141378829-141378851 CTGGGGGAGGCAGCTCTGGTGGG - Intergenic
1049618385 8:143586566-143586588 TCGGGGCAGGCGGCCTTGGCCGG - Intronic
1049664066 8:143835360-143835382 CCCGGCCAGGCAGCCTGGGTAGG + Exonic
1049760576 8:144330400-144330422 CTGGGGAGGGCAGGCTTGGCAGG - Intergenic
1049762658 8:144338097-144338119 CCGGGGAAGGCGGCCTGCGGGGG + Intergenic
1050121122 9:2308326-2308348 TTGGGGAAGGGAGCCTTGCTGGG - Intergenic
1050241916 9:3645571-3645593 ACTTGGAAGTCAGCCTTGGTTGG - Intergenic
1051245015 9:15101291-15101313 AGGGGGAAGGGAGCCTTGGCAGG - Intergenic
1053596742 9:39570117-39570139 ATGGGGAAGGTACCCTTGGTAGG + Intergenic
1053854712 9:42326764-42326786 ATGGGGAAGGTACCCTTGGTAGG + Intergenic
1054569512 9:66794885-66794907 ATGGGGAAGGTACCCTTGGTAGG - Intergenic
1056547544 9:87625359-87625381 CCAGGGGAGAGAGCCTTGGTTGG + Intronic
1056587429 9:87937885-87937907 CCGAGGAAGGCAGCCCTGGCGGG - Intergenic
1056609447 9:88115057-88115079 CCGAGGAAGGCAGCCCTGGTGGG + Intergenic
1056779715 9:89539994-89540016 CCAGGGAAAGCAGCCCTCGTGGG - Intergenic
1056847824 9:90055917-90055939 CCGAGGCAGGCTGCCTGGGTTGG - Intergenic
1057303416 9:93899306-93899328 CTGGGGAAGGCAGCCAAGGCAGG + Intergenic
1057889819 9:98861114-98861136 CCCGGGATGGCAGACTTGGAAGG + Intergenic
1059692367 9:116698235-116698257 CGGCGGAAGGCAGCCTTGGAAGG + Exonic
1061200648 9:129136629-129136651 CCACAGAACGCAGCCTTGGTTGG - Intronic
1062533936 9:137013429-137013451 CCAGCGGGGGCAGCCTTGGTGGG - Intronic
1203627146 Un_KI270750v1:34743-34765 CGGAGGAGGACAGCCTTGGTGGG + Intergenic
1186506005 X:10092799-10092821 CCGGGGCAGGCAGCCCTGCTTGG - Intronic
1187532207 X:20107187-20107209 CAGGGGAAGCCAGGATTGGTTGG + Intronic
1192318270 X:70068036-70068058 CTGGGGAAGGAAGCCTAGCTGGG + Intergenic
1193085585 X:77446184-77446206 CCTGGGAAGGCAGCCATCGCCGG + Intergenic
1200257352 X:154590670-154590692 CCGGAGAGGGCAGCCTGCGTTGG - Intergenic
1200260418 X:154613732-154613754 CCGGAGAGGGCAGCCTGCGTTGG + Intergenic