ID: 905927684

View in Genome Browser
Species Human (GRCh38)
Location 1:41763457-41763479
Sequence GGTGGGGCATCCAACTTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905927684 Original CRISPR GGTGGGGCATCCAACTTGAA TGG (reversed) Intronic
901350091 1:8587705-8587727 GGTGGGGGATAGAACTGGAAAGG - Intronic
902263923 1:15247563-15247585 GGTGGGGCCTGCATCTGGAAAGG - Intronic
905293422 1:36938907-36938929 CGTGGGGAAGCCAACTTGAGAGG + Intronic
905927684 1:41763457-41763479 GGTGGGGCATCCAACTTGAATGG - Intronic
908769842 1:67585971-67585993 GGTCTTGCATCCATCTTGAATGG - Intergenic
909895418 1:81063204-81063226 AGTGGGGCAAACAAATTGAAGGG - Intergenic
911830059 1:102539097-102539119 GCTGGGGAATCCAACTTAATAGG - Intergenic
912418076 1:109524422-109524444 GATGGGGAATCCAACTTGAAGGG + Intergenic
920109960 1:203580867-203580889 GGTGGGGCAGCCGAGTGGAATGG - Intergenic
920114287 1:203609102-203609124 GGTGGTGCATGCTACTTGAGAGG - Intergenic
924709739 1:246522382-246522404 GGTGAGGCATCCAAGGTAAAAGG + Intergenic
1067042630 10:42963017-42963039 GTTGGGCTATCCAACTAGAAGGG + Intergenic
1072095421 10:92173770-92173792 TGTGCAGCATCCAACTAGAATGG + Intronic
1083071214 11:59984288-59984310 TGTGAGGCATCAGACTTGAATGG - Intergenic
1083450699 11:62743132-62743154 GGTGGTGCATGCTACTTGGAAGG - Intergenic
1084887018 11:72217355-72217377 TGTGGGGAAGGCAACTTGAAGGG + Intronic
1091522887 12:1265694-1265716 GGTGGGGCATGATACTTTAAGGG - Intronic
1092881172 12:12888850-12888872 GGTGGGACATCCAAAGTCAATGG + Intergenic
1092999302 12:13980580-13980602 GGTGGGAAAGCCAACCTGAATGG + Intergenic
1093150098 12:15610824-15610846 GTTGGGGCCTTTAACTTGAATGG - Intergenic
1096673720 12:53215117-53215139 GGTGGGGCCTCCTGGTTGAATGG + Intronic
1098023359 12:66177606-66177628 GGTGAGTTATCCAACTTGGAGGG + Intergenic
1098720263 12:73888755-73888777 GGTGGGGCATCCACCTTCTTTGG - Intergenic
1099479315 12:83146193-83146215 GATGGGACATCTAACTTGAGTGG - Intergenic
1102410472 12:112713742-112713764 GGAGAGGCACCCAATTTGAAAGG + Intronic
1106788427 13:33129997-33130019 AGTGGGGCATCCAGCATGACCGG + Exonic
1112192354 13:97190324-97190346 GGTGTGCCATCCAACGGGAAGGG - Intergenic
1112610837 13:100953132-100953154 GTGGGGGCATCCAACATGATGGG + Intergenic
1121675222 14:95746979-95747001 GGTGGGGGATCCAGCTCAAAGGG + Intergenic
1127685159 15:61336327-61336349 GGTGAGTCAGCCTACTTGAAGGG - Intergenic
1128629739 15:69252489-69252511 GGGGGTGCATCCCTCTTGAATGG - Intronic
1129035066 15:72644184-72644206 GGTGGGGGATCCCTCATGAATGG - Intergenic
1129214816 15:74093032-74093054 GGTGGGGGATCCCTCATGAATGG + Intergenic
1129390569 15:75218635-75218657 GGTGGGGGATCCCTCATGAATGG - Intergenic
1129473707 15:75768984-75769006 GGTGGGGGATCCCTCATGAATGG + Intergenic
1133371913 16:5251673-5251695 GGCGGGGAATTCAAATTGAATGG + Intergenic
1135097567 16:19577404-19577426 AGTGGGGGATCCACCATGAACGG - Intronic
1140424230 16:74847311-74847333 GGTGGGGCATTCTTATTGAATGG + Intergenic
1155766649 18:29642772-29642794 GGTGGGGCATCAAGGCTGAAGGG + Intergenic
1165269700 19:34695476-34695498 GGTGGTGGATCCTTCTTGAATGG + Intergenic
926443927 2:12921163-12921185 GGTAGGACATCCACCTTGAGTGG - Intergenic
927258777 2:21064757-21064779 TGTGGGGCATCCAGGTGGAAAGG - Intergenic
931328638 2:61255395-61255417 ATTGGGGCATCCAGCTAGAAAGG - Intronic
931714658 2:65019620-65019642 GGTGGTTTTTCCAACTTGAAGGG + Intronic
931818919 2:65932243-65932265 GGTGGAGCATCCAAATGGATTGG + Intergenic
941294275 2:163716470-163716492 GGTAGGGAATCCAACTGGAGTGG - Intronic
942155306 2:173121722-173121744 GGGGGGGCATCCATGCTGAATGG - Intronic
942364880 2:175215066-175215088 GGTGAGGCATTCACCTGGAATGG - Intergenic
1173216503 20:41089946-41089968 GGTGGGGCAAAGAACTTGAATGG - Intronic
1174564257 20:51453313-51453335 GGTGATGTATCCAATTTGAATGG + Intronic
1179574027 21:42295807-42295829 CGTGGGCCAGCCAACTTGCAAGG - Intronic
1185179398 22:49350365-49350387 GGTGGGGCCTCCAATCTGAGTGG + Intergenic
953458124 3:43060330-43060352 GGTGGGGCATCCTAACTGATTGG - Intergenic
955644907 3:61126793-61126815 GGAGGAGGTTCCAACTTGAATGG + Intronic
958930249 3:100199830-100199852 GCTGGGGCAGCCAACTTGTGGGG + Intergenic
962819870 3:139038212-139038234 GGTGGGGCATCCTATGTGATTGG + Intronic
967968553 3:194983171-194983193 GCTGGGCCTCCCAACTTGAAAGG - Intergenic
972847943 4:43011968-43011990 GGAGGGAGTTCCAACTTGAATGG - Intronic
974134983 4:57803994-57804016 GGTGGGGCATCCAGCATGCTTGG + Intergenic
975304141 4:72828962-72828984 GGTGGGGCATTCAAATAGAGGGG - Intergenic
983977015 4:173947255-173947277 GGTGGGGCACTAAACCTGAAAGG + Intergenic
988422850 5:31027390-31027412 GCTTGGGCATGCTACTTGAAAGG - Intergenic
989755891 5:44953649-44953671 GCTGGGGAACACAACTTGAATGG + Intergenic
996759444 5:126972547-126972569 GGTGTGCCATTCAACATGAAAGG + Intronic
997934685 5:138099984-138100006 GTTGTGACATCCAACTAGAACGG - Intergenic
998350499 5:141497330-141497352 GGTGGGGCTTCCAGGTTCAATGG - Intronic
999267238 5:150274876-150274898 GATGGGGCATCCAAGTTTGAAGG - Intronic
1001040692 5:168333041-168333063 GGTGGGGCTTGAGACTTGAAGGG - Intronic
1005315792 6:24601642-24601664 AGTGGGGCATCCTACGTGACTGG + Intronic
1011124450 6:83992552-83992574 GGTGGGGCATACATATTCAAAGG - Intergenic
1016114949 6:140269554-140269576 GGTGGGGCTTCCTGCTTGTAAGG + Intergenic
1024336941 7:48218362-48218384 AGTGTGGCCTTCAACTTGAATGG - Intronic
1025000263 7:55310142-55310164 TGTGGGGCTTCCACCTAGAAGGG - Intergenic
1025246205 7:57319447-57319469 GGTGGGGCATCCAGCCAGAGGGG + Intergenic
1027251427 7:76400994-76401016 GGTGGGGCACCTACCTTGAAAGG + Exonic
1034881208 7:154763982-154764004 GGTGGGGCATCCAAATCCACAGG - Intronic
1036172534 8:6503222-6503244 TGTGGTCCTTCCAACTTGAACGG - Exonic
1041072899 8:54142491-54142513 TGTGAGTCAACCAACTTGAATGG - Intronic
1042739488 8:72027391-72027413 GGTGGGGTTTCCATGTTGAAGGG + Intronic
1043345509 8:79293469-79293491 AATGGGGCAGCCAAGTTGAAGGG - Intergenic
1045866473 8:106871543-106871565 AGTGGGGAGTCCAATTTGAATGG - Intergenic
1051263862 9:15292140-15292162 GCTGTGGCATCCAACAGGAATGG - Intronic
1055512943 9:77013271-77013293 GAGGAGGCATCCAACTGGAAGGG - Intergenic
1057343642 9:94227239-94227261 GGGGGGGCTTTCAAATTGAAAGG - Intergenic
1187261724 X:17690943-17690965 GCTGCAGCCTCCAACTTGAAAGG - Intronic
1187280858 X:17857801-17857823 GGTGGGGACTCCAAGATGAAAGG + Intronic