ID: 905927694

View in Genome Browser
Species Human (GRCh38)
Location 1:41763492-41763514
Sequence GCTGTAGGGGACATGAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905927694_905927699 4 Left 905927694 1:41763492-41763514 CCTGACTTCATGTCCCCTACAGC 0: 1
1: 0
2: 1
3: 16
4: 166
Right 905927699 1:41763519-41763541 GCACCGTTCATTCACTAGACTGG 0: 1
1: 0
2: 0
3: 2
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905927694 Original CRISPR GCTGTAGGGGACATGAAGTC AGG (reversed) Intronic
900159332 1:1216103-1216125 GCTGTGCTGGACATGAAGGCGGG - Intergenic
900184577 1:1327103-1327125 GCTGGTGGGGACAGGCAGTCGGG - Intronic
900406370 1:2494862-2494884 GCTGAAGAGGACGTGGAGTCTGG + Exonic
900418260 1:2544854-2544876 GCGGTAGGGGGCATGGAGTGGGG + Intergenic
900582314 1:3415271-3415293 TCAGTAGGGGACAGGAGGTCGGG - Intronic
901340988 1:8499197-8499219 GCTCCATGGGACATGAAGCCTGG + Intronic
902583884 1:17426250-17426272 GCTGCTGGGAACATGAAGACAGG - Intronic
902956405 1:19926892-19926914 CCTGTAGAGTACCTGAAGTCCGG + Intergenic
903087809 1:20879120-20879142 TCTGGAGGGGATATGAAGTCTGG - Intronic
903985256 1:27222826-27222848 GCTGTAGCAGATTTGAAGTCTGG + Intergenic
904299364 1:29544106-29544128 GCTGCAGGGGCCATGGAGACTGG + Intergenic
904348913 1:29892346-29892368 GCTGTAGGCAACATGAATGCAGG + Intergenic
905017878 1:34789957-34789979 GCTCTGGGGGAAATGAAGTAGGG - Intronic
905927694 1:41763492-41763514 GCTGTAGGGGACATGAAGTCAGG - Intronic
915401182 1:155623063-155623085 GCTGTGGGGGCTACGAAGTCCGG + Intergenic
915410626 1:155699002-155699024 TCCGTAGGGTACCTGAAGTCCGG + Intronic
916139424 1:161680953-161680975 GCAGTAGGGGAAGTGCAGTCAGG - Intergenic
920841899 1:209562176-209562198 GGGGCATGGGACATGAAGTCAGG + Intergenic
921228517 1:213045139-213045161 CCTGTAGGGTACTCGAAGTCCGG + Intergenic
921302521 1:213764654-213764676 GCTCTTGGGGACAGGGAGTCAGG + Intergenic
921780248 1:219154723-219154745 GCAGTAGTGGCCATGAAGTGGGG - Intergenic
922365178 1:224856531-224856553 CCTGTAGGGGATATGAAGCTAGG + Intergenic
923262046 1:232276787-232276809 GCTGCAGGGGAAAGCAAGTCAGG - Intergenic
923599516 1:235389893-235389915 GCTGTAGATCACTTGAAGTCAGG + Intronic
924876013 1:248105358-248105380 GCTGTGGGGGCTATGAAGTCCGG + Intergenic
1062803559 10:397693-397715 ACTGTAAGAGACATGAAGTGGGG - Intronic
1065564836 10:26997968-26997990 GCCGTGGGGGCTATGAAGTCCGG - Intronic
1067279825 10:44862664-44862686 GGTGCAAGGGACATGAAGCCCGG - Intergenic
1069140850 10:64823436-64823458 CCTGTAAGGGACAGGAAGTGTGG - Intergenic
1069897423 10:71688332-71688354 GCTGAAGGAGACAGGAAGGCTGG + Intronic
1069899013 10:71696303-71696325 CCTGTGGGGGACATGAATCCTGG + Intronic
1070892879 10:79955146-79955168 GCTGTGGGGGCTACGAAGTCTGG - Intronic
1071042694 10:81333749-81333771 GAGGAAGGGGACATGAAGGCAGG + Intergenic
1075604079 10:123791796-123791818 TCTGAGGGGGACATGAATTCTGG + Intronic
1076501760 10:130942734-130942756 GCTGCAGGAGACCGGAAGTCAGG + Intergenic
1076616572 10:131759094-131759116 GCTGTGGGGCTCCTGAAGTCCGG - Intergenic
1078861215 11:15249037-15249059 GCTGTGAGTGACATGGAGTCTGG + Intergenic
1085241653 11:75061740-75061762 GCTGTCAGGGACTTAAAGTCAGG + Intergenic
1089613883 11:119684519-119684541 GCAGAAGGGGACAGGATGTCCGG + Intronic
1090145802 11:124321093-124321115 ACTTTAGGGGAAACGAAGTCAGG - Intergenic
1091567994 12:1662229-1662251 GCTGGGGGCGACAGGAAGTCCGG - Intergenic
1091957361 12:4658002-4658024 GATGTAGCTGACATTAAGTCTGG + Intronic
1092062487 12:5562914-5562936 GCTGTAAGAGAAATGCAGTCAGG - Exonic
1095115214 12:38344520-38344542 GCTGTGGGGGCTACGAAGTCCGG - Intergenic
1095948127 12:47765496-47765518 GCAGTTGGGGAGATTAAGTCAGG - Intronic
1096231437 12:49898934-49898956 GCTGGAGGGGAAATAAAGCCAGG + Intronic
1096575316 12:52549078-52549100 GCTGCATTGGACATGCAGTCAGG + Intronic
1098141641 12:67455831-67455853 CCTATAGGGGACATGAAGTGAGG + Intergenic
1098168659 12:67723285-67723307 GCTGGAGTGGACATGAATTGTGG + Intergenic
1098182435 12:67862261-67862283 GCTTTAAGTGTCATGAAGTCAGG - Intergenic
1099080693 12:78176645-78176667 GCTGTAGGGGATACCAATTCTGG + Intronic
1103690183 12:122766196-122766218 GCTGCAGTGGCCAGGAAGTCAGG - Intronic
1104732571 12:131116104-131116126 GCTGCAGGAGCTATGAAGTCTGG - Intronic
1105805545 13:23949951-23949973 GCTGAAGGGGACCTGCAGTCAGG + Intergenic
1109969102 13:69741670-69741692 GCTCTAAGGAAAATGAAGTCAGG - Intronic
1114473708 14:22980662-22980684 GCTGTCGGGGAAATGGAGCCTGG - Intronic
1121021016 14:90580125-90580147 GCTGTAAGCGACATGAGGGCAGG + Intronic
1122757906 14:103997282-103997304 GCGGTAGGGGACAGGAGGTGGGG + Intronic
1125190743 15:36989884-36989906 GCTGTAGGTCACTTGAAGTGGGG + Intronic
1125826742 15:42682928-42682950 GGTGTAGGAGTCAAGAAGTCTGG - Intronic
1127349364 15:58135024-58135046 GGTGTAGGGGAAGTGAGGTCAGG + Intronic
1127537081 15:59900236-59900258 GCTGTAGAGGATAGGAAGCCAGG - Intergenic
1131133422 15:89914250-89914272 GCAGGTGGTGACATGAAGTCAGG - Intergenic
1131302375 15:91210885-91210907 ACTGTACGGGACATGAGGGCAGG + Intronic
1132298670 15:100763283-100763305 GCAGTAGAGGACATGGAGTGGGG - Intergenic
1135224241 16:20641721-20641743 GTTGTGGGGGCAATGAAGTCTGG - Intronic
1136509816 16:30730205-30730227 GCTGTATGGGAAAAGATGTCTGG + Intronic
1137054468 16:35736802-35736824 CCTGTAGGAGCCAAGAAGTCTGG - Intergenic
1138440826 16:57034103-57034125 GCTGGAGGGGCCATGGAGTAGGG + Intronic
1139220353 16:65175518-65175540 GCGTTAGAGGACATGAACTCAGG - Intergenic
1139511948 16:67432620-67432642 TCTGTAGGGGACAGCCAGTCTGG + Intronic
1142022993 16:87795624-87795646 GCTGTAGGGCACATGAGCTGGGG + Intergenic
1143564248 17:7712010-7712032 GCGGGAGGGGACCTAAAGTCAGG - Intergenic
1148512865 17:48187939-48187961 GCAGTAGGGGACATAAATTCAGG + Intronic
1148784723 17:50140490-50140512 GCTGCAGGGGACATGCACTGAGG + Intronic
1152580908 17:81165324-81165346 GCTGCAGGGGACCTGAGGCCAGG - Intronic
1153545343 18:6199387-6199409 GCTGTTGGGCACTTGAAGTGTGG - Intronic
1154207009 18:12346099-12346121 GCTGGAGGGGACAGGAAATGAGG - Intronic
1157693342 18:49701207-49701229 GCTGGAGGGGACAGGTAATCAGG - Intergenic
1157723992 18:49949003-49949025 GGTGTAGGGTTCATGAACTCAGG + Intronic
1158913856 18:62099520-62099542 GCTGGAGGCATCATGAAGTCAGG + Intronic
1161942653 19:7415349-7415371 GGTGCAGGGGCCATGAAGTGGGG - Intronic
1163823632 19:19510740-19510762 GATGTCGGGGACAAGATGTCAGG - Intergenic
1164093941 19:21987974-21987996 CCTGTAGGGTACAGAAAGTCCGG - Intronic
1164291833 19:23876602-23876624 CCTGTGGGGTACCTGAAGTCCGG + Intergenic
1164467738 19:28502152-28502174 GCTGCAGGGTACAGGAAGTGGGG + Intergenic
1165556436 19:36636567-36636589 CCTGTAGGGTACCTGAAGTCCGG + Intergenic
1165752161 19:38266799-38266821 GCTGTAGGTGACTGGGAGTCAGG + Intronic
1165936342 19:39391138-39391160 GCCTTCGGGGAAATGAAGTCCGG + Exonic
1166069994 19:40381383-40381405 GCTGAAGGGGACTGGAGGTCTGG - Intronic
1166121771 19:40690926-40690948 GCTGGAGGGGATCTGAGGTCAGG - Intronic
1166424734 19:42667580-42667602 CCCGTAGGGTACCTGAAGTCTGG + Intronic
1167730311 19:51249403-51249425 GCTGTAAGGGCCATGGAGTAAGG + Intronic
1167753757 19:51397365-51397387 ACTGTGGGGGCTATGAAGTCCGG + Intergenic
925331067 2:3059410-3059432 ACTGTAGGGGGTATGAAGTCAGG - Intergenic
925632010 2:5904135-5904157 GATTTTGGGGTCATGAAGTCCGG + Intergenic
926218039 2:10917295-10917317 GCTGCAGGGGACCTGGAATCGGG - Intergenic
929654397 2:43716126-43716148 GCTGGAGGGAACCTGGAGTCAGG + Intronic
932109776 2:68987389-68987411 TCTCTTGGGGTCATGAAGTCAGG - Intergenic
934651072 2:96091705-96091727 CCTGCAGGGCACATGCAGTCTGG - Intergenic
940014395 2:149088103-149088125 ACAGTAGGGGACATAAAGTTGGG - Intronic
947926915 2:233929461-233929483 GCTGCAGGGCATAAGAAGTCAGG + Intronic
1171400962 20:24872789-24872811 GCAGGAGAGGAAATGAAGTCGGG - Intergenic
1178419504 21:32432361-32432383 GCTGTAAGGGTCTTGAACTCAGG + Intronic
1178556828 21:33599248-33599270 GCTGTAAAGGACAGGAAATCAGG + Exonic
1180726990 22:17953558-17953580 GCTATAGGGGACATCAGGGCGGG + Intronic
1183091923 22:35528135-35528157 GCTGTTGGGGACAGGTGGTCAGG - Intergenic
1183163021 22:36127484-36127506 ACTGTAGGGGACATGTTCTCAGG - Intergenic
1183869241 22:40728776-40728798 GCTGTGGGGGCAACGAAGTCCGG + Intergenic
1185339439 22:50284935-50284957 GCTGTGGGGGCCACGATGTCAGG - Intronic
951540706 3:23779388-23779410 GCTGTAGGGCACTTGAAATGTGG - Intergenic
955625740 3:60917364-60917386 GCTGAAGGGGACAAGAAGAGAGG - Intronic
957048895 3:75396601-75396623 GGTGAAGGGGAGGTGAAGTCAGG - Intergenic
958575630 3:95947516-95947538 GTTGTGGGGGCTATGAAGTCTGG + Intergenic
959482291 3:106888307-106888329 GCTGAAGGGGAATTGAAGACAGG - Intergenic
960994264 3:123330690-123330712 GCTGTAGGGAACAGGAACCCTGG + Intronic
961560024 3:127722337-127722359 GCAGTGGGGGGCAGGAAGTCAGG + Intronic
961724867 3:128921146-128921168 GCTGTGGGGACTATGAAGTCCGG - Intronic
962708723 3:138068180-138068202 GCTGGAGGGTCCATGCAGTCCGG + Exonic
963300023 3:143587264-143587286 GATGTAAGGAACATGAGGTCAGG - Intronic
964974049 3:162598897-162598919 GCCGTGGGGGCTATGAAGTCTGG - Intergenic
967086413 3:186098859-186098881 GCTGGAGGGGACATGAGGGCAGG - Intronic
967877686 3:194277909-194277931 GCAGTAGGAGAAATGAGGTCTGG + Intergenic
968529109 4:1080877-1080899 GCTGGAGGGAACATGAGGTTGGG + Intronic
968726141 4:2248662-2248684 GCTGTAGGGGGCATGGTGCCTGG - Exonic
969568602 4:7994767-7994789 GGTGTTTTGGACATGAAGTCAGG - Intronic
969685740 4:8673081-8673103 GCTCTGGGGGACATGAATTTGGG + Intergenic
969820323 4:9715261-9715283 GCTGTAAGGGTCTTGAACTCAGG + Intergenic
969953003 4:10858582-10858604 GCAGTATTGGAAATGAAGTCTGG + Intergenic
971108628 4:23556690-23556712 GCAGTAGGGGACATGAGGAGTGG + Intergenic
971306743 4:25489440-25489462 TCTGCAGGGGACAGGAGGTCAGG - Intergenic
971963203 4:33516537-33516559 GCTGTGGGGGCCATGAAGTCCGG + Intergenic
976302936 4:83532492-83532514 GCAGTAGGGTACATGTCGTCAGG + Intergenic
978785150 4:112600983-112601005 GTTGTAGGGGTGATGAAGTCTGG - Intronic
979566126 4:122155928-122155950 GCTTGAGGGAAAATGAAGTCAGG + Intronic
981755671 4:148139508-148139530 GCTGCAGTGGACAGGAAGTGGGG + Intronic
985435052 4:189920701-189920723 GCTGTGGGGGAGAACAAGTCAGG - Intergenic
985921570 5:2981344-2981366 GCAGTTGGGGACCTGCAGTCCGG - Intergenic
986027806 5:3866738-3866760 GCTGTAGGTGGCATTAAGGCTGG - Intergenic
986639446 5:9857992-9858014 GCTGGGGTGGGCATGAAGTCTGG + Intergenic
986833331 5:11606602-11606624 GCTGGAGGTGACAGGAAGGCAGG + Intronic
987282892 5:16428170-16428192 GCTGGAGGGGATTTGCAGTCTGG - Intergenic
990162445 5:52957198-52957220 GCTGTAGGGGACAACAGGGCTGG - Exonic
993745111 5:91587697-91587719 GTTGGGGGGGACATGAAGTCAGG - Intergenic
994246867 5:97488589-97488611 GCTGTAGGCGACAAGAAGGAGGG - Intergenic
995755729 5:115502012-115502034 CCTGGAAGGGACATTAAGTCTGG - Intergenic
1005352561 6:24950610-24950632 GCAGTAGGGGACATGAAACATGG + Intronic
1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1006157416 6:32023267-32023289 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1006442416 6:34060664-34060686 GGAGTAGGGGGCAGGAAGTCAGG + Intronic
1007177314 6:39905801-39905823 GCAGAAGGAGAGATGAAGTCAGG + Exonic
1019205966 6:170362213-170362235 GCAGAAGAGGACATGAACTCTGG + Intronic
1022591385 7:31667021-31667043 GGGATAGGAGACATGAAGTCGGG + Intergenic
1026602846 7:71790879-71790901 GTTGTTGGGGACATGAAATCAGG + Intronic
1027766896 7:82355419-82355441 ACTGTTGGAGACTTGAAGTCAGG - Intronic
1030345304 7:108426609-108426631 GCTGATGGGGAAAAGAAGTCAGG - Intronic
1032896791 7:136260571-136260593 GTTGTGGGGGCGATGAAGTCTGG + Intergenic
1033224113 7:139547309-139547331 GCTGAAGGAGACATGAGCTCTGG - Intergenic
1034735208 7:153422699-153422721 GCTGGAGGGAAAATGCAGTCTGG - Intergenic
1038005641 8:23427649-23427671 GTTGAAGTGGCCATGAAGTCTGG + Intronic
1039196336 8:35035641-35035663 GGTGTTGGGGACATGAGGACAGG - Intergenic
1040086994 8:43353899-43353921 GGTGGATGGGTCATGAAGTCAGG - Intergenic
1040110613 8:43565680-43565702 GCTGTGGGGGCAATGAGGTCCGG - Intergenic
1041319773 8:56601267-56601289 GCTGTGGGGGGCAGGTAGTCAGG + Intergenic
1049044557 8:140139165-140139187 GCTGAGGGGGACAGCAAGTCAGG + Intronic
1051403546 9:16709185-16709207 ACTGAAGGGGAGATGAAGTGGGG + Intronic
1052993976 9:34539846-34539868 CCCGTAGGGTACCTGAAGTCTGG + Intergenic
1056718892 9:89056779-89056801 ACTGTGTGGGACATGAAGGCTGG - Intronic
1057510830 9:95678458-95678480 GCTGGAGAGGACCTGAAGCCTGG - Intergenic
1060235357 9:121858876-121858898 TGTGGAGAGGACATGAAGTCAGG - Intronic
1061526847 9:131172617-131172639 GCTGTAGAGGACATGAAATGTGG + Intronic
1061798333 9:133101267-133101289 GCTGTAGGGGAGGTGAGGTCAGG - Intronic
1186211345 X:7253483-7253505 GATGTAGGTGTCATGAAGGCAGG + Intronic
1188154387 X:26722942-26722964 GCTATTGGGGACATGAAGATGGG + Intergenic
1190877872 X:54472496-54472518 GCTTTAGGGGACATACAGTGAGG - Intronic
1192437722 X:71153222-71153244 GCTGTTGGGGACAAGGAGGCGGG + Intronic
1195404588 X:104498994-104499016 GCTGTAGACCACATGGAGTCTGG + Intergenic
1195651222 X:107287061-107287083 GGGGTAGGGGACATGAAATCAGG + Intergenic
1195842174 X:109186129-109186151 ACTGTATGGGGCATAAAGTCTGG - Intergenic
1196469557 X:116010590-116010612 CCTGCAGGGGCCAAGAAGTCTGG + Intergenic
1197083069 X:122441429-122441451 GCTGGGGTAGACATGAAGTCTGG + Intergenic
1200152307 X:153957251-153957273 ACTGGAGGGGAAATGGAGTCCGG - Intronic
1202346557 Y:23934422-23934444 GCTATCGGGAACATGAAGTGAGG - Intergenic
1202524214 Y:25735671-25735693 GCTATCGGGAACATGAAGTGAGG + Intergenic