ID: 905930459

View in Genome Browser
Species Human (GRCh38)
Location 1:41783258-41783280
Sequence AGTGAGAAGCCACAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 568
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 515}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905930459 Original CRISPR AGTGAGAAGCCACAGGAGGA AGG Intronic
901040094 1:6358491-6358513 AGAGGGAAGCCACAGGAGCAAGG + Intronic
901590406 1:10336603-10336625 AGTGAGACTACACAGGGGGAGGG - Intronic
901943264 1:12680210-12680232 AGTGAGAAGACAAAGGAAAAAGG + Intergenic
902454566 1:16523243-16523265 AGTGAGAGGACAAAGGAGGGCGG + Intergenic
902611942 1:17602772-17602794 AATAGGAAGCCACAGAAGGAAGG + Intronic
902927871 1:19709041-19709063 AGAGAGAGGCCACAGAAGGGAGG + Intronic
903128028 1:21260960-21260982 TCTGAGAAGCCACTGCAGGAGGG - Intronic
903451632 1:23457439-23457461 TGTGGGAAGCCTCTGGAGGAAGG + Intronic
903896268 1:26607489-26607511 AGTGAGAAGCCATTAGAGAATGG - Intergenic
904257052 1:29260496-29260518 CGTGAGAGGCCCTAGGAGGACGG + Intronic
904507036 1:30965772-30965794 AGTAAGTAGCCACATGAGCATGG + Intronic
904774208 1:32896702-32896724 AGTGAGGAACATCAGGAGGAAGG - Intronic
905150962 1:35927112-35927134 AGTGAGCTGCAAAAGGAGGAAGG + Exonic
905930459 1:41783258-41783280 AGTGAGAAGCCACAGGAGGAAGG + Intronic
906108872 1:43310263-43310285 AGTGAGAAGAGAAAGGCGGAAGG - Intronic
907269975 1:53285298-53285320 AGAGAGAGGTCACTGGAGGAAGG + Intronic
907697818 1:56751685-56751707 AGTGAGAAGGAACAGAAGAATGG - Intronic
910612812 1:89163598-89163620 AGTCAGAAACGACAGGGGGATGG - Intronic
910654132 1:89602964-89602986 AGTGAGAAGAGTGAGGAGGAGGG + Intergenic
911043379 1:93609300-93609322 AATGAGCAGCCACAGAAGGCAGG - Intronic
911270327 1:95794055-95794077 TGTGAGAAGACACAGGCAGAAGG - Intergenic
911478068 1:98398385-98398407 TGACAGAAGCCACAAGAGGATGG + Intergenic
911895312 1:103426220-103426242 AGCGAGAAGCTAAAGGAGCAAGG - Intergenic
911959734 1:104286023-104286045 AGTGAGGAGCTAGAGGAGAAGGG - Intergenic
912958602 1:114174625-114174647 AGTCAGAAGTCCCAGGCGGAGGG + Intergenic
913061143 1:115209298-115209320 AGTGAGAATTCTCAGGATGATGG + Intergenic
913380869 1:118208746-118208768 AGTGAGGAGCCAGGGGAGGAAGG + Intergenic
915991499 1:160521766-160521788 GGAGAGCAGCCACAGGAGGAAGG - Intronic
916530582 1:165652734-165652756 AGTGAGAAGCCAATGGAGCCAGG + Intronic
918203040 1:182285106-182285128 AGACAGAAGCCCCTGGAGGAAGG + Intergenic
919532225 1:198737124-198737146 AGAGACAAGCCACAGAATGAGGG - Intronic
920293929 1:204944353-204944375 ACTGAGGAGGCAGAGGAGGAAGG - Exonic
920646496 1:207807749-207807771 AGTGAGTAGCAGGAGGAGGAAGG + Intergenic
920749216 1:208658350-208658372 ACTGAGGACCAACAGGAGGAAGG + Intergenic
920970623 1:210740817-210740839 AGTGAGAAGGAAGAGGAGGGAGG + Intronic
921530545 1:216277276-216277298 AGAGAGAAGCCCCAGGAACAAGG - Intronic
921543166 1:216443939-216443961 AGTATGAAGCCAAAGGAGGGAGG + Intergenic
922792734 1:228319027-228319049 AGCGAGCTGCCAGAGGAGGACGG + Exonic
923399410 1:233601733-233601755 AGAGAGATGCCTCAGCAGGAGGG + Intergenic
923439843 1:234006834-234006856 AGTGAATAGCCACAGGAGGAAGG - Intronic
923439929 1:234007579-234007601 AGTGAATAGTCACAGGAGGAAGG - Intronic
924107118 1:240659951-240659973 AGTGAGAGTCTAGAGGAGGAAGG - Intergenic
924652280 1:245940307-245940329 AGTCAGGAGGCACAGGATGAGGG - Intronic
924738674 1:246781587-246781609 AACCTGAAGCCACAGGAGGAGGG + Intergenic
1063102986 10:2966901-2966923 ATTCAGAACCCACAGAAGGATGG + Intergenic
1063973530 10:11397655-11397677 AGTGAGAAGGCCCAGGAGCCAGG - Intergenic
1064240272 10:13621285-13621307 AGTCAGAAGCCACAGGGCAAGGG - Intronic
1064329326 10:14379052-14379074 ATTGTGAAGACACAGGAGGAAGG - Intronic
1064845144 10:19643841-19643863 AGTTAGAAGCCAGAGGATAAGGG - Intronic
1065109298 10:22424342-22424364 AGTGAGTAGCCACGGTAGCAGGG + Intronic
1065138923 10:22701583-22701605 AGTGAGAAGCCAAAGCATGGTGG - Intronic
1065330119 10:24587024-24587046 AGTGAGAACCCACCCCAGGAAGG + Intronic
1065749331 10:28871222-28871244 ACTGAGAACCCCCAGAAGGAGGG - Intronic
1065774836 10:29110000-29110022 AGCGAAAGGCCACAGGAGGCAGG - Intergenic
1066256482 10:33684351-33684373 GTTGTGATGCCACAGGAGGAGGG - Intergenic
1066289768 10:34003067-34003089 AATGAGAGGCCGGAGGAGGAAGG + Intergenic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1067067091 10:43110373-43110395 AGTGAGGAGGCCCAGGAGGCTGG + Intronic
1067281856 10:44879319-44879341 AGTGACAAGACAGAGGAGAAGGG - Intergenic
1067298607 10:44990444-44990466 AGTGACAAGACAGAGGAGAAGGG + Intronic
1067709152 10:48634910-48634932 TGTGTGAAGACACAGGAAGAAGG + Intronic
1067937001 10:50622012-50622034 AGTGAGCTGCCACAGGCAGAAGG + Intronic
1069802392 10:71090177-71090199 ATTGATAAGCCCCAGGAGGATGG - Intergenic
1070469960 10:76768910-76768932 AGAGAGAAGCCACAAATGGAGGG - Intergenic
1070802325 10:79250989-79251011 AGGGAGAAGGCACAGGAAGCTGG + Intronic
1071985748 10:91048510-91048532 CGTGAAAAGCCACAGGACAAAGG - Intergenic
1072318761 10:94228558-94228580 AGTGAGAACCCTCATGAGGATGG - Intronic
1072563251 10:96596334-96596356 AGTGAGGAGGCAGAGGAGCAGGG - Intronic
1073043680 10:100623832-100623854 AGAGAGAAGAGGCAGGAGGAAGG + Intergenic
1073184524 10:101607700-101607722 AGTGAGAGGCCTGGGGAGGATGG - Intronic
1075565125 10:123497680-123497702 AGTGAGAGGCTCCAGGAGCAGGG - Intergenic
1075609355 10:123839285-123839307 ATTGAGAAGCCACAGGTGTCTGG - Intronic
1075699554 10:124460406-124460428 AGTGGGTGGCCACAGGTGGAGGG + Intergenic
1076074376 10:127521768-127521790 AGGGGGAGGCCACAGGACGAGGG - Intergenic
1077196050 11:1280725-1280747 GGTGGAAAGCAACAGGAGGAGGG + Intronic
1077372768 11:2191242-2191264 AGGGAGAAAGCAAAGGAGGAAGG + Intergenic
1077994011 11:7437876-7437898 TGTGCAAAGCCACAGAAGGAAGG + Intronic
1078915268 11:15772924-15772946 AATGAGGAGCCTAAGGAGGAAGG + Intergenic
1078947743 11:16089723-16089745 ATTGAGAAGCTACAGTTGGATGG - Intronic
1079089177 11:17468874-17468896 AGGCAGAAGCAACAGGATGATGG - Intronic
1080846050 11:36027950-36027972 AGACAGAAGGCATAGGAGGATGG + Intronic
1080884831 11:36357238-36357260 AGTTGGAAGCTACAGGAGGTTGG + Intronic
1081578538 11:44334879-44334901 AGAGAGAAGCTTCAAGAGGACGG - Intergenic
1081724036 11:45314021-45314043 AGTGAGATCCCACAGGTGAAGGG - Intergenic
1081850445 11:46271897-46271919 AGGGAGAAGCCACAGGAGCAGGG - Intergenic
1083186497 11:61020807-61020829 CGGGAGAAGCCACAGGCAGAGGG + Intergenic
1084865502 11:72052938-72052960 AATGGTAAGACACAGGAGGAAGG + Intronic
1084968948 11:72759137-72759159 TGTGAGTAACCACAGGAGGGAGG + Intronic
1086616672 11:88829996-88830018 AGTAAGAAGAGACAGGAAGAAGG + Intronic
1087513555 11:99128646-99128668 AGTCAGGAGGCACAGGATGAGGG - Intronic
1088432513 11:109774381-109774403 GGTGGGAAGCCACAGAAGTAGGG - Intergenic
1088914713 11:114218485-114218507 AGTGCCAAGCCACTGGAGGAGGG - Intronic
1088983828 11:114888199-114888221 CGTGTGAAGACACAGCAGGAAGG - Intergenic
1089059318 11:115613332-115613354 AGTGAGAAGGCCCACGAGGCTGG - Intergenic
1089131279 11:116214254-116214276 TGTGAGAAATCACAGGTGGAGGG + Intergenic
1089476934 11:118771611-118771633 AGGGAGAAGGCAAAGGAGGAAGG + Intronic
1089522114 11:119071854-119071876 AGTGAGAAGGGACAGGGAGAGGG + Intronic
1089771684 11:120807666-120807688 AGTAAGAAGCCAGAAGAGAAAGG + Intronic
1089872121 11:121684866-121684888 AGGGTGAAGACACATGAGGAAGG + Intergenic
1090472528 11:126992960-126992982 AGAGAGGAGGCACAGAAGGATGG - Intronic
1091784264 12:3232827-3232849 AGTGAGCAGCCTCTGGAGGCAGG - Intronic
1092052268 12:5480333-5480355 AGTGGGTAGCCTCGGGAGGAGGG + Intronic
1094531797 12:31282749-31282771 GCTGAGAAGCCAGAGGAGCAGGG - Exonic
1094816691 12:34193777-34193799 AGTGAGGAGCCACTGCAGGGTGG - Intergenic
1095100349 12:38175408-38175430 AGTGAGGAGCCACTGCAGGGTGG + Intergenic
1096458106 12:51804127-51804149 AATGAGGGGCCACAGAAGGAAGG - Intronic
1096798407 12:54092934-54092956 AGTGAAGAGCCATGGGAGGAAGG + Intergenic
1097185649 12:57194955-57194977 AGTCAGAAGCCACAGTTAGATGG - Intronic
1097301277 12:58022232-58022254 AGGGAGAAACCACAGCAGAAAGG - Intergenic
1098066025 12:66617007-66617029 AGAGGGAAGGCACAGGAGAAAGG + Intronic
1098169888 12:67736672-67736694 TGTGATAAGCCACAGGGAGAAGG + Intergenic
1098366818 12:69712156-69712178 AATCAGAAGCCACAGGGGGAGGG + Intergenic
1100210705 12:92395669-92395691 GGTGAGAAGACACAGAAAGAAGG - Intergenic
1100514704 12:95315964-95315986 ACACAGAAGCCAGAGGAGGAAGG + Intergenic
1101282477 12:103272821-103272843 AGTCAGAGGCCACAGCAAGAAGG + Intronic
1102006167 12:109590551-109590573 AGTGAAAAGCCAAGGGAGAATGG + Intronic
1102401209 12:112631122-112631144 AGGCAGAAGCCACAGGACAAGGG - Intronic
1102491525 12:113292256-113292278 AAGGAGAAGCCTCTGGAGGACGG - Intronic
1102507675 12:113394025-113394047 AGTGGGAACCCAGAAGAGGATGG + Intronic
1102620364 12:114189781-114189803 AATGAGAAGACACAGGGGTAGGG + Intergenic
1103462516 12:121116352-121116374 AGTGAGAAGCCACGTTATGAAGG + Intergenic
1103624629 12:122208430-122208452 CGTCAGAAAACACAGGAGGAAGG - Exonic
1103727597 12:123005799-123005821 GGTCAGAAGCCACAGTTGGAAGG + Intronic
1103930486 12:124448261-124448283 GGTGGGAAGCCACAGATGGAGGG - Intronic
1104733353 12:131121213-131121235 GGTGAGAAGGCACCGGAGGATGG - Intronic
1104912889 12:132248125-132248147 AGGGAGGAGGCACAGGAGGGAGG - Intronic
1105257189 13:18751579-18751601 AGTGTTAAGCCACTGGTGGACGG - Intergenic
1105259853 13:18770941-18770963 AGTGTTAAGCCACTGGTGGACGG - Intergenic
1105262533 13:18790264-18790286 AGTGTTAAGCCACTGGTGGACGG - Intergenic
1105930692 13:25049078-25049100 GGTAAGAAGCCACAGGGAGACGG + Intergenic
1106548107 13:30747848-30747870 AGGGAGAAGCGACATGAGGGTGG - Intronic
1107450084 13:40500410-40500432 AGGGAGAATCCACACAAGGATGG - Intergenic
1107677409 13:42811308-42811330 AGGTAGAGGCCACAAGAGGAGGG + Intergenic
1107753362 13:43593371-43593393 CTTGAGAAGCCACTGCAGGAGGG + Intronic
1107999429 13:45892724-45892746 AGAAAGAAGCAACAGGAGGAAGG + Intergenic
1111559319 13:89924228-89924250 ACTGGGTAGTCACAGGAGGATGG - Intergenic
1111572501 13:90105806-90105828 ATTGAGAAACCAGAGGAGGCTGG + Intergenic
1112625371 13:101097723-101097745 AGTGAGAAACCACAAAAGGTTGG - Intronic
1113020225 13:105876867-105876889 AGTGAGAAGCAAGAGTAGCAAGG - Intergenic
1113200839 13:107866695-107866717 AGAGAGAAGAAACGGGAGGAGGG - Exonic
1113843107 13:113371466-113371488 AGGGAGGGGCCTCAGGAGGAGGG - Intergenic
1113843208 13:113371705-113371727 AGGGAGGGGCCTCAGGAGGAAGG - Intergenic
1113843246 13:113371802-113371824 AGGGAGGGGCCTCAGGAGGATGG - Intergenic
1113843277 13:113371882-113371904 AGGGAGGGGCCTCAGGAGGAGGG - Intergenic
1113858010 13:113459918-113459940 AGTGACCATCCACAGGAGAACGG - Intronic
1114656568 14:24319283-24319305 AATGAGAGCCCAGAGGAGGATGG + Intronic
1114930035 14:27454957-27454979 AGAGAGAAGACACAGGAGTAAGG + Intergenic
1114978794 14:28135743-28135765 AGAGAGAAGCCACATGAGATAGG - Intergenic
1115121452 14:29942136-29942158 CCTGAAAAGCCACAGGAGCAGGG + Intronic
1115265437 14:31495080-31495102 AGTCAGGAGGCACAGGAGGCAGG - Intronic
1117253584 14:53956797-53956819 TGCGAGAAGGCAGAGGAGGAGGG - Exonic
1118501213 14:66364320-66364342 AGAGAGAAGCCACAGGGAGCTGG + Intergenic
1118652513 14:67912625-67912647 AGTGAGAACACAGAGGAAGAAGG + Intronic
1119031437 14:71195927-71195949 CAAAAGAAGCCACAGGAGGAAGG - Intergenic
1119276182 14:73358380-73358402 TGAGAGAAGCCAGAGGAAGAAGG - Intronic
1119771234 14:77221525-77221547 AGTGAGAGGCGAGAGGGGGAGGG - Intronic
1119898563 14:78241265-78241287 AGTGGGAAGGGACAGGAGGAGGG - Intergenic
1120666898 14:87316965-87316987 AGAGAGAGACCACAGGAGAAAGG - Intergenic
1120751467 14:88202569-88202591 AGTGAGACGAAAGAGGAGGACGG - Intronic
1121620257 14:95341850-95341872 AATGGGAAGCCACTGGAGGCTGG + Intergenic
1121665734 14:95670789-95670811 GGTGAGAAGGCGCTGGAGGAAGG - Intergenic
1122085634 14:99300542-99300564 AGAGAGGAACCACAGGAGCAAGG + Intergenic
1122297002 14:100711421-100711443 AGCTAGCAGGCACAGGAGGAAGG - Intergenic
1124058167 15:26261586-26261608 TGTGAGATGTCACACGAGGAGGG + Intergenic
1124658599 15:31527462-31527484 AATGGGAAGCCTCAGGAAGAAGG - Intronic
1125385629 15:39133510-39133532 AGTGAGAAGCAAGAGGGGGTTGG + Intergenic
1126189635 15:45866207-45866229 TGTGAAAAGAGACAGGAGGAGGG - Intergenic
1126203891 15:46020214-46020236 TGAGAGCAGCCACAGGAGGCTGG + Intergenic
1126402134 15:48282849-48282871 AATAATAAGCCACAGGAGGAAGG + Intronic
1127289717 15:57559593-57559615 AGTGGGAAGCCAGAGGGCGAGGG - Intergenic
1127733455 15:61820600-61820622 GGTGAGTATCCAGAGGAGGAAGG - Intergenic
1128565088 15:68695804-68695826 AGAGAGAAGAAACAGGAGAAGGG + Intronic
1129154745 15:73710797-73710819 TGTGAGAAGCTAAAGGAGGCTGG - Intronic
1131345490 15:91643917-91643939 TGAGAGAAGCCACACGGGGAAGG + Intergenic
1131553421 15:93377014-93377036 AGGGAGGGGCCACAGGAAGATGG + Intergenic
1131593786 15:93775909-93775931 GGTGAGGAGCCATAGGAGGAGGG + Intergenic
1131797115 15:96030452-96030474 TGTGAGAAGCTAAAGGAGGGTGG - Intergenic
1132846185 16:2001915-2001937 AGTGGGAAGGGAGAGGAGGAGGG + Intronic
1133442484 16:5832324-5832346 AGGGTGAATCCACAGAAGGAAGG + Intergenic
1133934324 16:10256493-10256515 GCTTAGAAGCCACAGGTGGAGGG + Intergenic
1134182306 16:12057647-12057669 AATGTGCAGCCACAGGGGGACGG + Intronic
1134649599 16:15898200-15898222 AGGGAGAAGAAAGAGGAGGAGGG - Intergenic
1134753712 16:16647891-16647913 AGTTAGTGGCCCCAGGAGGAAGG + Intergenic
1134992347 16:18711152-18711174 AGTTAGTGGCCCCAGGAGGAAGG - Intergenic
1135890907 16:26356354-26356376 CATGAGAAGACACAGCAGGAAGG - Intergenic
1136136426 16:28259240-28259262 AGTGAGAAGGCACAGGTGGCGGG + Intergenic
1136393708 16:29981509-29981531 ACTGAGACGCAACAGGATGATGG + Intronic
1136561304 16:31040633-31040655 AGTCAGAAAGCACAGGAGGCCGG + Intronic
1137821527 16:51449922-51449944 AGTGAGAAGAGAAAGCAGGAAGG - Intergenic
1138402896 16:56762795-56762817 AATCAGAAGCCAGAAGAGGAAGG - Intronic
1139055099 16:63173843-63173865 AGTGAGAAGCAGGAGGAGGGAGG - Intergenic
1139144499 16:64307625-64307647 AGAGAGAAGGAAAAGGAGGAAGG + Intergenic
1139296070 16:65902002-65902024 AGGGAGAAGCCCCATGAGGCAGG + Intergenic
1139693848 16:68658496-68658518 AGTGAGAGGGCCCAGGTGGAGGG + Intronic
1139973371 16:70790345-70790367 AAAGAAAAGCCACAGGTGGAGGG + Intronic
1140088281 16:71815807-71815829 AGAGAGAAACAAAAGGAGGAGGG + Intergenic
1140985908 16:80157772-80157794 AGAGAGAAGCCACGTGAGGAGGG - Intergenic
1141426276 16:83946608-83946630 GGTGAGGAGCCATAGGAGGAGGG - Intronic
1141518135 16:84559883-84559905 GGGGAGAAGCAACTGGAGGAGGG + Intergenic
1141523084 16:84594397-84594419 AGTGCGCAGCCACAGGCGGCTGG + Intronic
1142423362 16:89987168-89987190 AGTGTGGAGCCGCTGGAGGAGGG + Intergenic
1143447352 17:7017323-7017345 AGTGAGAGGTCAGAGGTGGAAGG - Exonic
1144463674 17:15479308-15479330 AGTGAGGAGACACAGGAAGAAGG + Intronic
1145068007 17:19776642-19776664 TTTGAGTAGCCACAGGAGGATGG - Intronic
1145834913 17:27947268-27947290 AGTGAGAGGGGGCAGGAGGAGGG + Intergenic
1146399251 17:32490330-32490352 AGTGCCAAGTCTCAGGAGGAGGG + Exonic
1148829790 17:50424236-50424258 AGAGTGAAGACACAAGAGGAAGG + Intergenic
1150295167 17:64003514-64003536 AGAGGGAAGCCTCAGGATGAAGG + Intronic
1150309445 17:64115820-64115842 AGTAAGAAGCCTGAGGTGGATGG + Intronic
1150444798 17:65220591-65220613 AGTGGGAAGGCACTGGAAGAGGG + Intronic
1150888192 17:69112014-69112036 ATTGTAAAGACACAGGAGGAAGG + Intronic
1151144817 17:72030786-72030808 CCTGTGAAGCCACAGGAGGCTGG - Intergenic
1152107234 17:78337768-78337790 AGTGAGAAGGGAAAGGAGAAGGG - Intergenic
1152244949 17:79180570-79180592 AGGTAAAGGCCACAGGAGGAGGG - Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152373284 17:79903894-79903916 TGAGAGAACCCACAGGTGGAAGG - Intergenic
1152375261 17:79915616-79915638 AGCATGAAGCCACAGGTGGAAGG + Intergenic
1153385225 18:4485752-4485774 AGTGAAAACTCACATGAGGAAGG - Intergenic
1154033336 18:10773453-10773475 AGCGAGGAGTCAGAGGAGGACGG - Exonic
1154306465 18:13234233-13234255 GGTGAGGAGCCTCAGCAGGAGGG - Intronic
1154426169 18:14273860-14273882 AGTGTTAAGCCACTGGTGGACGG + Intergenic
1154431179 18:14309789-14309811 AGTGTTAAGCCACTGGTGGACGG + Intergenic
1155109906 18:22704067-22704089 AGAGAGAATCTACAGGAGGAAGG - Intergenic
1155281632 18:24246386-24246408 AATGGGAAGCCAGTGGAGGAGGG + Intronic
1155409880 18:25532140-25532162 AAAGAGAAGCAACAGGAAGAGGG + Intergenic
1155739983 18:29277706-29277728 AGTAAGGAGCCACAGCAGGAAGG - Intergenic
1155904201 18:31429608-31429630 AGTGAAAAGGCAAAGGAGGAAGG + Intergenic
1158491019 18:57909834-57909856 TGTAAGAACTCACAGGAGGATGG + Intergenic
1158575025 18:58629466-58629488 AGGCAGAAGCCACAGAAGGAAGG + Intergenic
1158713738 18:59859866-59859888 GGAGAAAAGCCACATGAGGAAGG + Intergenic
1158892258 18:61883735-61883757 AGAGTGAGGCCACAGGAGAAAGG + Intronic
1159082672 18:63753044-63753066 AGTGAGAAGTCTTAGGAGGTAGG + Intronic
1159728071 18:71988814-71988836 AGTGAGAAGCCTCAGGACACAGG - Intergenic
1160680202 19:408807-408829 AGGGAGGAGCCACAGGTGGGTGG - Intronic
1161730374 19:5956833-5956855 GGACAGAAGCCACAGGAGAATGG + Intronic
1161841776 19:6686067-6686089 AGTGGGAAGCCGCAGGAGACAGG + Intronic
1161958002 19:7506866-7506888 AGGGAGAAGCCAGAGGAAGGGGG - Intronic
1161958008 19:7506885-7506907 AGGGAGGAGCCAAAGAAGGAGGG - Intronic
1162774898 19:12973534-12973556 AGTGAGACACCACAGGACCACGG - Exonic
1163175823 19:15563597-15563619 ACAAAGAAGCCCCAGGAGGAGGG + Intergenic
1163322571 19:16583212-16583234 AGGGAGAATCCAAAGGAGGAGGG - Intronic
1164464009 19:28472216-28472238 AGGGAGAAGCCACAGGGGAGGGG - Intergenic
1165073705 19:33269528-33269550 AGTGAGGAGTCCCAGGAGTAAGG - Intergenic
1165723245 19:38094491-38094513 TTTGGGAAGCCAAAGGAGGAGGG - Intronic
1165768953 19:38367410-38367432 AGTGAGATGCCGCAGGAAAAAGG - Intronic
1165933598 19:39375823-39375845 AGTGAGCAGACAGAGGAGCAGGG + Exonic
1166224435 19:41386312-41386334 AGTGAGATCCCAGAGGAGCAGGG - Intronic
1168430301 19:56273730-56273752 AGTAAGAAGAGACAGGAGGCAGG + Intronic
925274694 2:2640486-2640508 AGTGAGATGTCACTGGGGGAAGG + Intergenic
925327416 2:3034516-3034538 ACTGAGAAGTCACAGAAGGCTGG - Intergenic
925590078 2:5500787-5500809 AGAGAGAAGGGAGAGGAGGAAGG + Intergenic
925678022 2:6386687-6386709 AGAGAAAAGACACTGGAGGATGG - Intergenic
926149356 2:10416028-10416050 AGGGAGAACCCACAGATGGACGG - Intronic
926271989 2:11373695-11373717 AGGGTGAAGCCCCAGCAGGAGGG + Intergenic
927847571 2:26479436-26479458 AGGGCCAGGCCACAGGAGGATGG + Intronic
929290059 2:40180309-40180331 TTAGAGAAGGCACAGGAGGATGG + Intronic
929794171 2:45046330-45046352 AGGGAGAAGTTTCAGGAGGAGGG + Intergenic
931089272 2:58868171-58868193 AGTCATAAGCCACAGTTGGAGGG + Intergenic
931220364 2:60283761-60283783 AGAGAGCAGTCACAGGAGGGAGG + Intergenic
931801276 2:65760455-65760477 GGTGAGAACCCAAAGGAAGAAGG + Intergenic
931812058 2:65863702-65863724 ATCCATAAGCCACAGGAGGAAGG - Intergenic
931916188 2:66959622-66959644 GGAGAAAAGCCACAGGTGGAGGG - Intergenic
931928798 2:67105739-67105761 AGCCAGAAGCTACAGGAGGCTGG + Intergenic
932224632 2:70029916-70029938 AGGGAGAGACCAGAGGAGGAGGG - Intergenic
934149429 2:89131156-89131178 CATGAAAGGCCACAGGAGGACGG - Intergenic
934217867 2:90050885-90050907 CATGAAAGGCCACAGGAGGACGG + Intergenic
934680355 2:96279199-96279221 AGTGAGCAGCCCAAGGAGGAAGG + Intronic
934987896 2:98900501-98900523 TTTGAAAAGCCAGAGGAGGAGGG - Intronic
934989795 2:98913298-98913320 AGAGGGAAGCCACATGAGAACGG + Intronic
935210266 2:100933714-100933736 GGTGAGAAGCCACAGCACGTTGG - Intronic
935654926 2:105413940-105413962 AGTTAGATCCCACAGGATGAGGG + Intronic
936022371 2:109004599-109004621 AGTGAGAAGCGAGAAGAGGGTGG + Intergenic
936071717 2:109375643-109375665 AGAGTGAACTCACAGGAGGATGG + Intronic
936538664 2:113332431-113332453 TAGGAGGAGCCACAGGAGGATGG - Intergenic
937288713 2:120769016-120769038 ACTGAGAAGCCACAGGAATAGGG - Intronic
937887914 2:126912695-126912717 AGTCAGAGGCCACAGGCAGATGG + Intergenic
938389394 2:130893117-130893139 AGCGTGAAACCACAGGTGGACGG - Intronic
938760889 2:134424853-134424875 AGAGAGAAGCCATAGGATAATGG - Intronic
938800921 2:134762648-134762670 AGCAAGAAGGCACAGGAGAATGG - Intergenic
939467551 2:142578404-142578426 ATGAAGAAGCCAAAGGAGGATGG - Intergenic
940442681 2:153736878-153736900 AGTGGGTGGCCACATGAGGAGGG - Intergenic
940900988 2:159126026-159126048 AGTGAGAAAAGGCAGGAGGAAGG - Intronic
941819296 2:169828166-169828188 AGGGTGCAGCCACAGGGGGATGG + Intronic
943855575 2:192785406-192785428 AGAAAAAACCCACAGGAGGATGG - Intergenic
944395750 2:199264071-199264093 AGGAAGAAGGAACAGGAGGAAGG + Intergenic
944398346 2:199296047-199296069 GCTGAGAAGCCACAGTAGGTAGG + Intronic
945142314 2:206699810-206699832 GGTCGGGAGCCACAGGAGGATGG + Exonic
945810822 2:214548050-214548072 ATTGAGAAGACACCGGAAGAAGG - Intronic
946031969 2:216712559-216712581 GGTGAGAAGCCTTAGGAGGATGG + Intergenic
946063693 2:216968083-216968105 AGTGAGAGGCCATGGGAGGGTGG + Intergenic
946490317 2:220143230-220143252 AGTGAGAAGGCAAAAGATGATGG - Intergenic
946507063 2:220313133-220313155 AGGGAAAAGCCAGAGGAGAAGGG + Intergenic
946630352 2:221660492-221660514 CGTGAGAAGCCACAGTAGCATGG - Intergenic
946703160 2:222432690-222432712 ACTCAGAAGCCAGAGGTGGAGGG + Intronic
948135160 2:235631126-235631148 AGGGAAAATCCACAGGACGAGGG + Intronic
948684601 2:239662500-239662522 AGTGAGCTGGCACAAGAGGATGG - Intergenic
1171154860 20:22862590-22862612 TGTGTGAAGCCAAAGGAGTAAGG - Intergenic
1171850236 20:30302754-30302776 AGTGAAGAGCCATGGGAGGAAGG + Intergenic
1172006832 20:31823628-31823650 AATGTGAAGCCACAGGAGCCCGG - Intronic
1172012977 20:31857139-31857161 AGGGGGAGGCCACAGAAGGAGGG + Intronic
1173133269 20:40414590-40414612 AGGGAGAAGCCAAAGAAGGGAGG + Intergenic
1174111882 20:48202845-48202867 GGAGAGAAGGCCCAGGAGGAGGG + Intergenic
1174220734 20:48952991-48953013 ACAGAGAATCCACAGGAAGAAGG - Intronic
1174311025 20:49654808-49654830 ATTAAGAAGCCATAGGAGGCTGG + Intronic
1174665455 20:52253844-52253866 AGGGCAGAGCCACAGGAGGAAGG - Intergenic
1175382705 20:58574808-58574830 AGTAAGAAGCCCCACGAGGGAGG + Intergenic
1175873168 20:62217817-62217839 AGGGAGAGACCACAGGGGGATGG + Intronic
1176271902 20:64239695-64239717 AGAGAGGACCCCCAGGAGGATGG + Intronic
1176293274 21:5057469-5057491 AGAGGCAAACCACAGGAGGACGG - Intergenic
1176843178 21:13856629-13856651 AGTGTTAAGCCACTGGCGGACGG - Intergenic
1176848601 21:13895530-13895552 AGTGTTAAGCCACTGGTGGACGG - Intergenic
1176893924 21:14352679-14352701 AGTGAGAAATGACAGGAGAACGG - Intergenic
1177696266 21:24576537-24576559 TATGAGAAGCCACAGCATGAAGG + Intergenic
1178357372 21:31920144-31920166 AGGGGGCAGCCACAGGAGGAAGG - Intronic
1179863986 21:44206181-44206203 AGAGGCAAACCACAGGAGGACGG + Intergenic
1180183803 21:46129706-46129728 AGAGAGCGGCCACAGGAAGACGG - Intronic
1180193803 21:46181996-46182018 AGTAAAAAGCCACAGAAGGTCGG + Intronic
1180687447 22:17680577-17680599 AGGGAGACAGCACAGGAGGAAGG + Intronic
1181330292 22:22085894-22085916 AGGGAGGAGCCACAGAAGAAAGG + Intergenic
1181850809 22:25748727-25748749 AGTGAGAAGCAAGGGCAGGAAGG - Intronic
1182007041 22:26969683-26969705 AGTGAGAAGCTTTGGGAGGAGGG + Intergenic
1182518722 22:30873291-30873313 GGTGTGTAGCCACAGCAGGAGGG - Intronic
1183176914 22:36231146-36231168 AGTGAGTAGCCTCAGGCTGAGGG - Intronic
1183181312 22:36261894-36261916 AGTGAGTAGCCTCAGGCTGAGGG + Intronic
1183319311 22:37155482-37155504 AGTGAGAAAGCACAGGAGGCAGG - Intronic
949916036 3:8965402-8965424 AGCGAGAAGCCAGAATAGGATGG + Intergenic
950450468 3:13062276-13062298 CGTGAGAATCCAGGGGAGGAAGG + Intronic
950572928 3:13813194-13813216 GCTGTGAAGCCACAGAAGGAAGG - Intergenic
950775281 3:15344508-15344530 ACTGAGAAGCCTCAGGAAGATGG + Intergenic
950814806 3:15689493-15689515 CAAGAGAGGCCACAGGAGGAAGG + Intronic
951862625 3:27270590-27270612 AGTGAGACGTCACAGTAGCATGG - Intronic
953031346 3:39181965-39181987 AGTGAGATCCCACAGAAGGCAGG + Intergenic
953158527 3:40396716-40396738 AGGGTGAAGCCTCAAGAGGAAGG - Intronic
953452113 3:43014119-43014141 TGTGTGAAGCCACAGGAAGGGGG + Intronic
953452137 3:43014257-43014279 AGTGAGAAGTCACGGGAAGAAGG + Intronic
953452790 3:43017892-43017914 AGGGTGAAGCCACAGGAAGGTGG + Intronic
953519476 3:43627582-43627604 TGTCCAAAGCCACAGGAGGATGG + Intronic
953833312 3:46321624-46321646 AGTAAGAAACCAAAAGAGGAAGG + Intergenic
954183500 3:48899504-48899526 TTTGAGAAACCACAGGAAGAGGG + Intergenic
954973798 3:54674368-54674390 AGTGAGAAGGGGAAGGAGGATGG + Intronic
955324765 3:58001453-58001475 ACTGAGAAACCACAGAATGAAGG + Intergenic
955491491 3:59487679-59487701 GCTGAGAAGACACAGGAGGCAGG - Intergenic
956495784 3:69824526-69824548 GGAGAGAAGTCACAGGAAGAAGG + Intronic
956928601 3:74017014-74017036 AGTGAGAAGATGCTGGAGGAAGG - Intergenic
956951387 3:74287694-74287716 AGCGAGAAGCCACAGGGCAAAGG - Intronic
959629057 3:108487646-108487668 AGTGAAAAGGGACAGGAGGGAGG + Intronic
960267200 3:115633712-115633734 AGAGGTAAGCCTCAGGAGGATGG - Intronic
960382378 3:116979783-116979805 AGTTAGAAGCTAGAGGAGAATGG + Intronic
960557092 3:119042252-119042274 AGAGAGAGGCCACAGGGTGAAGG + Intronic
960926938 3:122803630-122803652 AGTGTGGAGCCACGGGAGGGTGG + Intronic
960940153 3:122928112-122928134 AGTGAGATGACGCTGGAGGAGGG - Intronic
961468868 3:127098885-127098907 AGGCAAAAGCCACAAGAGGAGGG - Intergenic
961543506 3:127616811-127616833 AGTGGGAAGTGAGAGGAGGAGGG - Intronic
961660446 3:128466028-128466050 AGTGAGAAGCTATGGGAGGTGGG - Exonic
961688131 3:128649772-128649794 AATGAGAAGCAGCAGGGGGAAGG + Intronic
962051574 3:131821318-131821340 AGAGAGAATCCACAGAAGGCTGG + Intronic
962071975 3:132043230-132043252 AGGGATAACCCACAGGAGGTTGG + Intronic
962270051 3:133971010-133971032 ACTGAGCAGCCACAGGAGACTGG - Intronic
962921593 3:139955251-139955273 ACTGAGAAGCTACAGGATGTTGG + Intronic
963221595 3:142818971-142818993 ACTGAGAAGCCATCTGAGGATGG - Intronic
963851846 3:150217294-150217316 AGCAAGAGGCCACAGGAGGGAGG + Intergenic
964542749 3:157798009-157798031 AGTGAGAAGGCAGAGGCAGAAGG - Intergenic
965848345 3:172990963-172990985 AGTGAGCAGCAGCAGGAGAAGGG + Intronic
966306117 3:178536806-178536828 AGTGAGAAGCAGCAAGAGGAGGG + Intronic
966478949 3:180383183-180383205 AATGAGAAGGCACATGAGAAGGG - Intergenic
968744303 4:2351698-2351720 AGTGAGACCCCACAGGGTGAGGG + Intronic
969026217 4:4174816-4174838 AGTAAGAAGCCACAGAAACACGG + Intergenic
969089832 4:4685422-4685444 AGGGAGAGGGCAAAGGAGGATGG + Intergenic
970663967 4:18316186-18316208 GGGCAGCAGCCACAGGAGGAAGG + Intergenic
971260752 4:25054613-25054635 AAGGAGATGCCACAGGATGAGGG + Intergenic
971316265 4:25570710-25570732 AGAGAGAAGCCAAGGGAAGAAGG + Intergenic
972222036 4:36966808-36966830 AGGGAGATCACACAGGAGGAGGG - Intergenic
972665897 4:41165353-41165375 AGTCAGAGGCCACAGGTAGAAGG + Intronic
972710742 4:41592062-41592084 AGGGAGAAGGGGCAGGAGGAGGG - Intronic
972771123 4:42197904-42197926 AGAGAGAAGGAAGAGGAGGAAGG + Intergenic
973313046 4:48729779-48729801 GGAGAGAAGCCACAGCAGAAAGG + Intronic
973694605 4:53477865-53477887 CCTGAGGAGCCACAGGGGGATGG - Intronic
973840662 4:54857169-54857191 AGAGAGAAGCAACAGCAGCATGG + Intergenic
976022540 4:80646750-80646772 AAAGAGAAGCAACAGGAGAAGGG - Intronic
976110666 4:81669771-81669793 AATGAAAAGGCACAGGAAGAAGG + Intronic
976933590 4:90599876-90599898 TGTGTGGAGCCACAGCAGGAGGG - Intronic
977127502 4:93188177-93188199 AGTGAACAGCCACAGGAGTGGGG - Intronic
977772776 4:100879562-100879584 CGTGACAAGACACAGGTGGAAGG + Intronic
979065095 4:116121575-116121597 ACTGAGTAGTCACAGGAGGATGG + Intergenic
980171230 4:129292401-129292423 AGTCAGAAGGCACAGGAGTCAGG + Intergenic
980978122 4:139630668-139630690 AATGAGATGCCACAGGGGCAGGG + Intergenic
981756508 4:148145979-148146001 AGTGAGAAGAAAAGGGAGGAGGG + Intronic
982340463 4:154292955-154292977 AGTGACAATTCCCAGGAGGATGG - Intronic
983831095 4:172329334-172329356 AGTGAGAAGATACAGGATCAGGG + Intronic
984424313 4:179563786-179563808 ACTCTGAAGCCTCAGGAGGATGG + Intergenic
984561718 4:181278697-181278719 AGAGGCAAGCCACAGGAGGTAGG + Intergenic
985117364 4:186605302-186605324 AGTGAGAAGGGGGAGGAGGAGGG + Intronic
985161475 4:187048845-187048867 TGAGAGAAGGCACAGGAGAAGGG + Intergenic
985180734 4:187258779-187258801 AGAGAGAAGGCACAGGAGGGTGG - Intergenic
985656801 5:1136120-1136142 GCGGAGAGGCCACAGGAGGAGGG + Intergenic
985903742 5:2817067-2817089 AGAGAGAGCCCACAGGTGGATGG + Intergenic
985993701 5:3584625-3584647 AGTGAGGAGGGACAGGAGTAAGG + Intergenic
985993823 5:3585103-3585125 AGGGAGGAGGGACAGGAGGAAGG + Intergenic
986022019 5:3813049-3813071 AGAGAGGAGGCAGAGGAGGATGG + Intergenic
986169751 5:5305867-5305889 AGGGAGAACACACAGGAGCAAGG - Intronic
986592627 5:9387081-9387103 AGTGACAGGCCACATCAGGATGG + Intronic
986717883 5:10537344-10537366 GGAGAGAAGCCACAGCAGAAAGG - Intergenic
988588148 5:32525695-32525717 AGTCAGGGGCCACAGCAGGAAGG - Intergenic
989415561 5:41171452-41171474 AGTGAGAACCAACAGCAGCAGGG + Intronic
989506358 5:42230832-42230854 AGTGAAGAGTAACAGGAGGAGGG + Intergenic
990338218 5:54795776-54795798 TGTCATAAGCCAAAGGAGGAAGG - Intergenic
990905266 5:60796184-60796206 AGTGAGAAAACAGATGAGGAAGG - Intronic
991473408 5:66994119-66994141 AGTGAGGAGCACCAAGAGGAAGG + Intronic
992357842 5:76003930-76003952 AGAGAGAAACCAGAGGAGAAGGG + Intergenic
992934082 5:81683674-81683696 AATGAGAAGGCACAGAATGAGGG + Intronic
994890411 5:105626517-105626539 ATTAAGAAGCCAGAGGAAGATGG - Intergenic
995011851 5:107265260-107265282 AGGGGGAAGCCAAAGGAAGAGGG - Intergenic
995155480 5:108907246-108907268 AATGAGAAGGCAGAGGAGGGAGG - Intronic
995614598 5:113946820-113946842 ATTGAGAAGCCAAAGGAGAAAGG - Intergenic
995842775 5:116459624-116459646 AGTTAGATTTCACAGGAGGAAGG - Intronic
996581818 5:125039584-125039606 ACTGAAAAGCCACAAGAGCAAGG - Intergenic
997431648 5:133845015-133845037 AGTGTGGAGACACAGGGGGACGG - Intergenic
997717994 5:136056410-136056432 CGTCAGAGGCCACAGGAGAAAGG - Intronic
998194459 5:140055607-140055629 AGTCAGAAGCCAGAGGATGAGGG + Intergenic
998257804 5:140602054-140602076 AGGCAGAAGCCACATGATGAGGG - Intergenic
998389842 5:141780385-141780407 AGGGGGAGGCCACAGGAGGGTGG - Intergenic
998413416 5:141928289-141928311 ACTGAGAACTCACAGGAGCATGG - Exonic
998478492 5:142441614-142441636 AGGTAGGAGCCAGAGGAGGAGGG + Intergenic
999023862 5:148202692-148202714 AGTGAGTAACCACAGGATAATGG - Intergenic
999051805 5:148531205-148531227 TGGGAGAAGCCAGAGGTGGAAGG + Intronic
999653458 5:153790146-153790168 AATCTGAAGCCACAGGAGGCAGG + Intronic
1001454731 5:171852087-171852109 AGTGAGAGGGCTCAGCAGGAAGG - Intergenic
1002022802 5:176375359-176375381 AGGTAGAAGCCACAGATGGATGG - Exonic
1002182395 5:177437456-177437478 AGTGACCACCCACAGAAGGATGG - Intronic
1003706089 6:8532029-8532051 AGTAAGAAGTCACAAGAAGAGGG - Intergenic
1003990708 6:11483587-11483609 AGGGAGCAGAAACAGGAGGAGGG - Intergenic
1004021926 6:11783694-11783716 TGTGGGATGCCACACGAGGATGG - Intronic
1004573825 6:16873544-16873566 AGTGAGAAACAGGAGGAGGATGG + Intergenic
1006402560 6:33826268-33826290 AGCGAGAACACACAGGTGGATGG - Intergenic
1007022168 6:38531861-38531883 AGGGAGAAGGCACAGCAAGATGG + Intronic
1007106788 6:39288920-39288942 AGTGAGAAGTCACATGACAAAGG + Intergenic
1007618487 6:43196803-43196825 ATTGAGAAGCATCATGAGGATGG - Exonic
1007978549 6:46126825-46126847 AGTTAGAAGTTACAGGAAGAAGG - Intergenic
1010406496 6:75511838-75511860 AGTCAGATGCCATAGGAGAAGGG + Intergenic
1011813055 6:91155228-91155250 ACTGGGAAGCCCCAGGATGATGG - Intergenic
1012731937 6:102894212-102894234 AGTGGGAAGACGCAGGAGGTGGG - Intergenic
1013166056 6:107593241-107593263 AGAGAAAAGCCACATGAGGGAGG + Intronic
1013192296 6:107813938-107813960 AGTGAGAAGCCAAAGGCACATGG - Intronic
1013826138 6:114213494-114213516 AGTGATAACAGACAGGAGGAAGG - Intronic
1014124206 6:117758839-117758861 AGTGAGAAGGAACAGGATCAGGG - Intergenic
1014569107 6:122986871-122986893 AGTCAGAAGACACAGGAGTTAGG - Intergenic
1015021220 6:128478282-128478304 AGTGAGAAGGCAAAAAAGGAAGG - Intronic
1015669528 6:135672851-135672873 AGATGGAAGCCACAGGAGGCAGG + Intergenic
1015887543 6:137933775-137933797 ATTGAGAAGCCAAAATAGGAAGG - Intergenic
1016096628 6:140045387-140045409 AGTGACAAGCCACAGGCAGTGGG + Intergenic
1016998633 6:149979236-149979258 AGGGAGAAGGGAGAGGAGGATGG - Intergenic
1016999757 6:149988574-149988596 AGGGAGAAGGGAGAGGAGGATGG + Intergenic
1017006859 6:150033700-150033722 AGGGAGAAGGGAGAGGAGGATGG - Intergenic
1017175399 6:151498072-151498094 AGTGAGAAGCCACAGACATATGG + Intronic
1017788318 6:157774314-157774336 AGTGAGAGGCTACAGCTGGAGGG + Intronic
1018011961 6:159678776-159678798 AGTCAGATCCCACAGGTGGAGGG - Exonic
1018474424 6:164125659-164125681 AGAGAGGAGCCAAGGGAGGAAGG - Intergenic
1018670601 6:166173704-166173726 AGTGAGATGTCACGGCAGGAGGG + Intergenic
1018693516 6:166370010-166370032 AGGGAGCAGCCCCAGGAGCATGG + Intronic
1019873677 7:3790350-3790372 ATTGAGCAGCCACAGGAGACTGG - Intronic
1020057648 7:5129263-5129285 AGCCAGAAGCCACTGTAGGAAGG - Intergenic
1020458065 7:8396763-8396785 CATGTGAGGCCACAGGAGGAAGG - Intergenic
1021315736 7:19145200-19145222 AGAGGGAAGACCCAGGAGGATGG - Exonic
1022130735 7:27402211-27402233 GGAGAGAAGCCTCAGAAGGAAGG - Intergenic
1022621391 7:31988135-31988157 AGGGTGAAGCCACAGTGGGACGG - Intronic
1022850562 7:34257324-34257346 AAAGAGAAGCCACAGGGGGTGGG - Intergenic
1023158536 7:37275662-37275684 ATTGAGAAGGCACAGGCAGAAGG - Intronic
1023614862 7:42009664-42009686 AATGGGAAGCCCCAGGAGAACGG + Intronic
1023871589 7:44266211-44266233 ACTGAGAAGCCACAAGAAGGAGG + Intronic
1024112463 7:46161188-46161210 AGGCAGAGGCCACAGTAGGAAGG + Intergenic
1024151268 7:46573875-46573897 TGTGAGAGGACACAGGAGGGAGG + Intergenic
1024222998 7:47303039-47303061 CTGGAGAAGCCACTGGAGGAGGG + Exonic
1024427827 7:49247959-49247981 AGTGAATAGCCACAGAAGCAAGG + Intergenic
1024829235 7:53428531-53428553 AATGAGAAACCACAGAATGATGG + Intergenic
1026528822 7:71179579-71179601 TGTGAGAAACCACAGGAGTATGG - Intronic
1026590986 7:71695397-71695419 AGGGAGAAGCCAGCAGAGGAAGG + Intronic
1026967700 7:74450862-74450884 AATGAGAAGCTGCAGGAGGAGGG + Intergenic
1028466222 7:91155166-91155188 AGAGAGAAGGAACAGCAGGAAGG + Intronic
1028831133 7:95327602-95327624 AATGAGAAGCCACAAGAGGGAGG - Intergenic
1029643347 7:101835251-101835273 TGAGAGAAGCCACAGCACGAAGG - Intronic
1029819052 7:103127665-103127687 ATTGAGAGGCCATAGGAGGCAGG + Intronic
1030639728 7:111990692-111990714 AGTGAGAAGCAATAGAAGAATGG - Intronic
1032153975 7:129453347-129453369 AGTGAGAAGCCTTAGGGGAAGGG + Exonic
1034277341 7:149829630-149829652 TGTGGGAGGACACAGGAGGAGGG - Intergenic
1034277350 7:149829668-149829690 ACTGAGGGGACACAGGAGGAGGG - Intergenic
1034277491 7:149830115-149830137 TGTGGGAGGACACAGGAGGAGGG - Intergenic
1034277536 7:149830266-149830288 TGTGGGAGGACACAGGAGGAGGG - Intergenic
1034277655 7:149830687-149830709 TGTGGGAGGACACAGGAGGAGGG - Intergenic
1034277707 7:149830882-149830904 TGTGGGAGGACACAGGAGGAGGG - Intergenic
1034389417 7:150772841-150772863 GGTGAGAAGTGTCAGGAGGAAGG + Intergenic
1035731899 8:1859624-1859646 AGGGAGAAGCTGCCGGAGGAGGG - Intronic
1036679888 8:10864316-10864338 AGAGAGGGGCCACATGAGGAAGG - Intergenic
1037492972 8:19412913-19412935 ACTAAGAAGCCACAAGAAGAGGG - Intronic
1037695968 8:21224218-21224240 ACTGAGAAGTCATAGTAGGAGGG - Intergenic
1037909918 8:22738221-22738243 AGTGAGCAGCGAGAGAAGGAAGG - Intronic
1038030450 8:23634390-23634412 GCTGAGAAGCCAGAGGAGCAGGG - Intergenic
1041470986 8:58208846-58208868 AGTGAGAAGAGAGAGGTGGAGGG - Intergenic
1041496095 8:58486876-58486898 AGTGAGGGGTGACAGGAGGAGGG - Intergenic
1041528306 8:58834015-58834037 AGTAAGAAGCCACTGCAGAAGGG - Intronic
1041790063 8:61685330-61685352 GGTGAGAACCAACAGGAAGAAGG + Intronic
1042207676 8:66345427-66345449 AGAGAGAGGCAACAAGAGGAAGG + Intergenic
1042835168 8:73072935-73072957 AGTGAGCAGAGACAGGAGGAAGG - Intronic
1043050485 8:75379144-75379166 AGTGTGCAACCACAGGAGGAAGG - Intergenic
1043756667 8:84012083-84012105 CATGTGAAGACACAGGAGGAAGG + Intergenic
1043774335 8:84246015-84246037 ATTCAGAAGCCAAAGGAAGATGG + Intronic
1044096668 8:88074704-88074726 AGTGAGAAACAACAGGGTGATGG - Exonic
1044801963 8:95966432-95966454 AGGTAGAAGACACAGGAGTATGG + Intergenic
1045338699 8:101232787-101232809 AGGCAGAAGCCACACGATGAAGG + Intergenic
1045500809 8:102743074-102743096 GGAGCCAAGCCACAGGAGGATGG + Intergenic
1046482058 8:114835005-114835027 AGTGATAAGCAACAGCTGGAAGG + Intergenic
1046810390 8:118526762-118526784 AGTCAGAAGCCAGAGGGGAAAGG + Intronic
1047315674 8:123730908-123730930 GGTGAGAAGCCTGAGGAGGCAGG + Intronic
1047396435 8:124503791-124503813 AGTGAGAAGCCAGAGGACATGGG + Intronic
1047511610 8:125520253-125520275 TAAGAGGAGCCACAGGAGGAAGG + Intergenic
1048793083 8:138122355-138122377 ACTGAGAAGACACAGGACTATGG + Intergenic
1048862056 8:138730838-138730860 GGAAGGAAGCCACAGGAGGATGG + Intronic
1048992466 8:139768947-139768969 AGAGGGAAGACACAGGAAGAAGG + Intronic
1048993092 8:139772856-139772878 AGAGGGAAGACACAGGAAGAAGG + Intronic
1049509333 8:143019551-143019573 AGGGAGTAGCCCGAGGAGGAAGG - Intronic
1050339351 9:4620303-4620325 TTTATGAAGCCACAGGAGGAAGG - Intronic
1051021490 9:12548992-12549014 AGTGAGGCGCTATAGGAGGAAGG - Intergenic
1052774831 9:32722782-32722804 TGTGAGAAGCCACACGGGCAGGG + Intergenic
1052797160 9:32933536-32933558 AGTGATCAGCCACTGGACGAAGG + Intergenic
1053665753 9:40316491-40316513 AGTGTTAAGCCACTGGTGGACGG + Intronic
1053788014 9:41666046-41666068 AGTGAAGAGCCATGGGAGGAAGG + Intergenic
1053915336 9:42941537-42941559 AGTGTTAAGCCACTGGTGGACGG + Intergenic
1054157118 9:61648722-61648744 AGTGAAGAGCCATGGGAGGAAGG - Intergenic
1054176290 9:61877388-61877410 AGTGAAGAGCCATGGGAGGAAGG + Intergenic
1054376909 9:64456521-64456543 AGTGTTAAGCCACTGGTGGACGG + Intergenic
1054476893 9:65579727-65579749 AGTGAAGAGCCATGGGAGGAAGG - Intergenic
1054518860 9:66059793-66059815 AGTGTTAAGCCACTGGTGGACGG - Intergenic
1054661249 9:67703420-67703442 AGTGAAGAGCCATGGGAGGAAGG - Intergenic
1055146198 9:72937939-72937961 AGTCTCAAGCCACAGGAGTACGG - Intronic
1055269391 9:74540272-74540294 AGTGATAAGCTAGAGGAGGCAGG - Intronic
1056225728 9:84493369-84493391 AGACAGAGGCCAGAGGAGGATGG + Intergenic
1056662107 9:88551649-88551671 AGAGAGAAGCAACAGGGGAAGGG - Intronic
1056804321 9:89716707-89716729 AGCGAGAAGCCACATGAGTTTGG - Intergenic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1058034521 9:100236818-100236840 AGTGAGGAGGCACAGGAGTCAGG + Intronic
1058540697 9:106009509-106009531 TGTGAGAAGCGCCAGGAGGAGGG - Intergenic
1058567732 9:106304496-106304518 AATGAGAAGCCACAAAAGAATGG - Intergenic
1058726529 9:107810039-107810061 AGAAAGAAGCCACAGGAAGAAGG - Intergenic
1059423218 9:114205627-114205649 TGTGAGATGGAACAGGAGGAAGG - Intronic
1060259837 9:122064760-122064782 AGTAAGAAGACAAAGGAGGAGGG + Intronic
1060871205 9:127041731-127041753 AGTGAGAAGACTCAGGGAGAAGG + Intronic
1060974748 9:127758214-127758236 ACTGGGAGGCCACAGTAGGAGGG - Intronic
1062314543 9:135960355-135960377 AGAGAGAAGTCCCAGGAGTAGGG - Intronic
1062535309 9:137018631-137018653 AGTGGGAGGGCACAGGGGGACGG + Intronic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1185949387 X:4414778-4414800 ACTGTGAAGCCACAGTAGAATGG + Intergenic
1186076718 X:5887585-5887607 AGTGAGAAGACAGAGGAAGTTGG - Intronic
1188628498 X:32318947-32318969 AGTCAGAATCCACATGAGGCAGG - Intronic
1190430089 X:50370549-50370571 CCTGAGAAACCACAAGAGGAAGG + Exonic
1190474959 X:50817094-50817116 AGGGAGTAGACACAGGAGGTGGG + Intergenic
1191096183 X:56674710-56674732 AGGGAGAAGCCAGAGCAGAAAGG + Intergenic
1191671331 X:63751315-63751337 AGAGAGAAGGCAGAGGAGGAAGG + Intronic
1191672529 X:63761742-63761764 AGTCATTAGCCACAGGAGGGTGG - Intronic
1193810897 X:86049549-86049571 AATGAGAAGCCACAGATGGATGG + Intergenic
1194974194 X:100376792-100376814 AATGAGAAGCTACATGAAGAAGG + Intronic
1195107656 X:101616499-101616521 AGTGAGAAGCTGGAGGAGGAGGG - Exonic
1197138583 X:123091231-123091253 AGTGAGAAGCCAAAGAGAGAGGG - Intergenic
1197160121 X:123313547-123313569 AGTGAGAAGGAAAAGGGGGAAGG - Intronic
1199658626 X:150023611-150023633 AATGAGAAACCACAGAAGAAAGG + Intergenic
1199946243 X:152670538-152670560 AGTGAAAAGAGATAGGAGGAGGG - Intergenic
1200038590 X:153349318-153349340 ATTGACAAGCCACAGAATGACGG - Exonic
1200420222 Y:2957126-2957148 AGTGAGAATCCAGAGGGAGAAGG - Intronic
1200758685 Y:7016143-7016165 ACTCAGCAGCCACAGGAGGGAGG - Intronic
1201587328 Y:15575515-15575537 AGTGTGAAGATAAAGGAGGATGG - Intergenic