ID: 905930501

View in Genome Browser
Species Human (GRCh38)
Location 1:41783514-41783536
Sequence CAGGGTGATGGGAGGGATGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 726
Summary {0: 1, 1: 0, 2: 8, 3: 71, 4: 646}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905930501 Original CRISPR CAGGGTGATGGGAGGGATGC GGG Intronic
900081356 1:860607-860629 TAGGGAGCTGGGAGGGATGGAGG - Intergenic
900419139 1:2548032-2548054 CAGGGGGAGGGGAGGGAGGAGGG + Intergenic
900469094 1:2843112-2843134 CAGGGTGATGGGAAGAAGGTTGG + Intergenic
900885083 1:5409424-5409446 GTGGGTGACGGGAGGCATGCAGG + Intergenic
901190095 1:7404629-7404651 CAGGGTGAGGGGACGGACGTGGG - Intronic
901296041 1:8161650-8161672 CAGGGTGGTGGGATGGAGGATGG - Intergenic
901464572 1:9413115-9413137 CAGGGTGAGGACAGGGCTGCGGG - Intergenic
901789367 1:11646398-11646420 CAGGGAGATGGGTGGGAGGAAGG - Intergenic
901896742 1:12319991-12320013 CCAGGTGAGGAGAGGGATGCAGG - Intronic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902391972 1:16112263-16112285 GGGGGAGATGGGAGGGAGGCTGG - Intergenic
902395613 1:16130989-16131011 AAGAGAGATGGGAGGGAGGCTGG - Intronic
902542725 1:17166170-17166192 GATGGTGATGGTAGGGATGGTGG - Intergenic
902634825 1:17728447-17728469 CAGCATTTTGGGAGGGATGCAGG - Intergenic
902667040 1:17946724-17946746 CAGAGAGATGGGAGGGATGGGGG + Intergenic
903285171 1:22272600-22272622 CGGGGTGGTGGGAGTGAGGCTGG + Intergenic
903557779 1:24206091-24206113 CAGGGTGGTTGGAGGCTTGCTGG + Intergenic
903572211 1:24314371-24314393 AAGGGAGATGGGAGGGAGGGAGG - Intergenic
903712518 1:25337083-25337105 GAGGGTGAAGGGAGAGATCCAGG - Intronic
904384868 1:30134633-30134655 GAGGGTGATGTGGGGGGTGCTGG - Intergenic
904616946 1:31755110-31755132 CATGGGGATGGGAAGGAGGCAGG - Intronic
905207749 1:36352619-36352641 CAGGGGGAAGGGAGGGAAACAGG - Intronic
905348984 1:37331536-37331558 GAGGGGGATGGGGAGGATGCAGG - Intergenic
905590554 1:39159470-39159492 GAGGGTGGAGGGAGGAATGCAGG + Intronic
905930501 1:41783514-41783536 CAGGGTGATGGGAGGGATGCGGG + Intronic
906145688 1:43558757-43558779 CTGGGGGAGGGGAGGGAGGCAGG + Intronic
906282427 1:44563408-44563430 CAGGGCCAAGGGAGGGAAGCGGG - Intronic
906290209 1:44614779-44614801 CAGGGACAAGGGAGGGAGGCTGG - Intronic
906319029 1:44805421-44805443 CAGGGTGCTGGGGAGGAAGCTGG + Intronic
907222131 1:52914847-52914869 GTGGGTGATCCGAGGGATGCAGG - Intronic
907550226 1:55298820-55298842 TAGGGTGTAGAGAGGGATGCTGG + Intergenic
907946886 1:59143747-59143769 CAGGGTGATGAGAGATATGATGG + Intergenic
908513835 1:64872206-64872228 CTGGGTGGAGGCAGGGATGCTGG + Intronic
909897641 1:81093294-81093316 TTGGGTGATGGGAGGAATGAAGG + Intergenic
911167980 1:94742166-94742188 CAGGCTGATGGGGAGGATGTGGG - Intergenic
914226278 1:145721606-145721628 CAGCGGGATGGGAGGGGCGCAGG - Intronic
914342702 1:146773899-146773921 CAGTGTGATGGGAGGGAAGCAGG - Intergenic
914816318 1:151065573-151065595 CAGGGTGTTGGGGGAGATGCTGG + Intronic
915312847 1:155013014-155013036 CAGGGTGATTTGAGGGAGGGAGG + Intronic
915454544 1:156030875-156030897 CTGAGGGGTGGGAGGGATGCAGG - Intergenic
915558440 1:156673109-156673131 AAGGGTGAGGGGAGGGAAGTTGG + Exonic
915564564 1:156706401-156706423 TAGGGGGAAGGGAGGGAGGCGGG + Intergenic
915590104 1:156865806-156865828 CAGAGAGATGGGAAGGATGGTGG + Intronic
915826861 1:159087284-159087306 CAGGGTGATGGTAAGGATGATGG + Intronic
916168120 1:161981320-161981342 CAGGGTGCTGGGTTGGTTGCAGG + Intergenic
916431691 1:164736151-164736173 CAGGGTGAAGGGAGGGGAGAGGG - Intronic
916901773 1:169232548-169232570 CAGGGTGTTGGGGGGGGGGCAGG + Intronic
917002040 1:170370986-170371008 CAGGGTGGGGGGAGGGAGGAGGG - Intergenic
917141177 1:171837627-171837649 CAGAGAGATGGGAGGGGTGGGGG + Intergenic
917490480 1:175494089-175494111 CAGGCTGGTGGGAGGAATCCGGG - Intronic
918243124 1:182637421-182637443 CAGGGTGTTGTCAGGGGTGCTGG - Intergenic
918987426 1:191651105-191651127 CAGGGTGGTGCGAGGGATAGTGG - Intergenic
919943926 1:202306561-202306583 CATGGTGATGGGAGGTGTGGGGG + Intronic
920442463 1:205990023-205990045 TAGGGTGTGGGGAGGGAAGCTGG - Intronic
920616309 1:207496142-207496164 CAGAGTGTGGGGAGGGCTGCGGG - Intronic
920951290 1:210573913-210573935 CAGGGAAATGAGAGGGATGAAGG + Intronic
922614690 1:226954902-226954924 CAGGGTGCTGGGAGGCATGTTGG + Intronic
922883904 1:229003491-229003513 CAGGGGGAGGGGAGGGAGGAAGG + Intergenic
923109566 1:230879925-230879947 CAGGGTGACTGGAGAGATGGAGG - Intergenic
923482233 1:234396456-234396478 CAGGGTGAAGAGAGGGACGGAGG - Intronic
924202567 1:241675070-241675092 AAGGATGAAGGGAGGGAGGCAGG - Intronic
924438505 1:244067367-244067389 CAGGGCGCTGAGATGGATGCAGG - Intergenic
924499854 1:244627142-244627164 GAGGCTGAGGGGAGAGATGCGGG + Intronic
924612188 1:245582914-245582936 CAGGGAGAGAGGAAGGATGCTGG - Intronic
1062799865 10:371138-371160 CAGGGTGAGGGGATGGTGGCAGG - Intronic
1063045070 10:2383608-2383630 GATGGTGAGGGGAGGGTTGCTGG + Intergenic
1063647990 10:7904949-7904971 CAGTGTGAGGGAAAGGATGCAGG - Intronic
1064986178 10:21212442-21212464 CAGAGTGATGGGAGGAAAGAAGG + Intergenic
1066236517 10:33490154-33490176 CAGGGTGGAGGGAGGGACGGAGG + Intergenic
1066567036 10:36731545-36731567 CAGGGAGATAGGAAGGCTGCAGG - Intergenic
1067187900 10:44045520-44045542 CAGGATGCTGGGAGGGATGGAGG + Intergenic
1067267343 10:44757328-44757350 GAGGGGGATGGGAGAGATGGAGG - Intergenic
1067726272 10:48773679-48773701 CAGGATGATGGGAGGGTGGGCGG + Intronic
1067800266 10:49353786-49353808 GAGGGTGTGGGGAGGGATGCTGG - Intergenic
1068017573 10:51536791-51536813 CAGGGTGGGGGGAGGGGTGAGGG - Intronic
1069835280 10:71304210-71304232 GGGGGTGAAGGGAGGGATACAGG + Intergenic
1069917050 10:71793650-71793672 GAGGGAGGTGGGAGGGGTGCAGG - Intronic
1069995664 10:72340775-72340797 CAGGGTGATGTGAGTGAGGAGGG - Exonic
1070721983 10:78763230-78763252 CAAGGTGATGTGGGGCATGCGGG - Intergenic
1070786984 10:79167733-79167755 CAGGAAGCTGGGAGGGATGAAGG - Intronic
1070824235 10:79381554-79381576 CACGGTGATGGGGAGGAGGCAGG - Intergenic
1070828226 10:79403558-79403580 CAGGATGCTGGGAGGGAGGAAGG + Intronic
1070959721 10:80490158-80490180 CAGAGTGAGGGGATGGATGGTGG + Intronic
1072422045 10:95297351-95297373 CAAGGTAGTGGGAGGGAAGCGGG + Intergenic
1072692733 10:97582530-97582552 AAGGGTGATGGGAGGTGGGCTGG - Intronic
1072782636 10:98260962-98260984 CAGGGTGGTGTGCGGGATGCTGG - Exonic
1073073815 10:100810854-100810876 CAGGGCCATGGGGGGGAGGCGGG - Intronic
1073877194 10:107938547-107938569 CAGGGAGAAGGGAGGGAAGGGGG - Intergenic
1073941243 10:108700777-108700799 CAGGGTGATGGGAGGCTTACAGG - Intergenic
1074036013 10:109739332-109739354 CAGGGTAATGGGAGCTTTGCTGG + Intergenic
1074160031 10:110829551-110829573 GAGGGAGATGGGAGGGAAGGAGG - Intronic
1074185123 10:111094448-111094470 CAGGGTCATGTGTGGGATGGAGG + Intergenic
1074414214 10:113253123-113253145 GAGGGGGAAGGGAGGGAGGCAGG - Intergenic
1074543208 10:114383373-114383395 AAGGGTGAAGGGAGGGAAGGAGG + Intronic
1074685912 10:115962295-115962317 CAGGGTGATGGCAGAGATGGGGG - Intergenic
1075389462 10:122082467-122082489 AATGGTTATGGGAGGGGTGCAGG + Intronic
1075647781 10:124107888-124107910 CAGGGTGATGGCAAGGAAGGCGG - Intergenic
1076550182 10:131273127-131273149 CAGGGTAATGGAAGGGATGCGGG - Intronic
1076715993 10:132364059-132364081 CAGGGTGATGGGGGGTTAGCGGG - Intronic
1077351776 11:2096472-2096494 CAGGGTGGGGGGCGGGCTGCTGG + Intergenic
1078720657 11:13880678-13880700 CAAGGTAATGAGAGGGAAGCTGG - Intergenic
1078927438 11:15887193-15887215 CAAGGTAATGGCAGGGAGGCTGG - Intergenic
1078946156 11:16070840-16070862 AAGTGTGATGGGAGGGATATAGG - Intronic
1079006498 11:16794844-16794866 CAGGGTGGTGGGAGGGTGGAAGG - Intronic
1079402652 11:20118306-20118328 CAGGGTGATGTGGGGGATGCAGG - Exonic
1079789465 11:24717742-24717764 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1081611738 11:44567071-44567093 CAGGGACATGGTAGGGATGGGGG - Intronic
1081793131 11:45803132-45803154 TAGGGAAATGGGAGGGCTGCAGG - Intergenic
1082007642 11:47428670-47428692 CAGGTTGATGACAGGGATGAAGG - Intergenic
1082130762 11:48486414-48486436 CACGGTGGTGTGAGAGATGCAGG + Intergenic
1082564269 11:54657287-54657309 CATGGTGGTGTGAGAGATGCAGG + Intergenic
1082798329 11:57394869-57394891 CAGGGTGTGGGGAGGGATGCAGG - Intronic
1082812880 11:57489221-57489243 CAGGGAGAGGGGAAGGATGAAGG + Intronic
1082838148 11:57666993-57667015 TTGGGTGAGGTGAGGGATGCGGG + Intergenic
1083148144 11:60773677-60773699 CAGGGTGAAGGGGAGGGTGCAGG + Intronic
1083253807 11:61484512-61484534 GAGTGTGATGGGAAGGCTGCAGG + Intronic
1083295872 11:61715455-61715477 CAGGGGGATGGGGGGGAAGAAGG - Intronic
1083805001 11:65068192-65068214 CAGGGAGATGGCAAGGATGGGGG - Intronic
1083891623 11:65598427-65598449 CAGGGTGCTCGGCGGGGTGCAGG + Exonic
1084092707 11:66889141-66889163 CAGGGTGAAGGGAGGGAAAGTGG + Intronic
1084507037 11:69574788-69574810 CCGGGTGAAGGGAGAGTTGCAGG - Intergenic
1084603476 11:70159896-70159918 CAGGGTGTGGTGAGGGCTGCAGG + Intronic
1085618575 11:78020801-78020823 CAGGATGTTGGGAAGGATGGCGG - Intronic
1086027286 11:82309162-82309184 CAAGGTCAGGGGAGGGAGGCAGG - Intergenic
1086530323 11:87777477-87777499 CAGGAGGAAGGGAGGGATGGGGG - Intergenic
1087129937 11:94660026-94660048 CAGGGTCAGGGGAGGGAGTCGGG - Intergenic
1088995839 11:114996089-114996111 AAGGGTGAGGGGAGGAAGGCAGG - Intergenic
1089027529 11:115287358-115287380 GAGGGTGAGGGGACGGAGGCAGG + Intronic
1089596854 11:119585926-119585948 CAGGCTGATGGGAAGGAAGGTGG - Intergenic
1089683417 11:120132217-120132239 GAGGGTGCTGGGAGGGAAGCGGG - Intronic
1091098627 11:132848318-132848340 AAAGGTGATGGGATGGATGATGG + Intronic
1091688217 12:2578713-2578735 GAAGGTGATGGGTGGGAAGCAGG + Intronic
1091726195 12:2848315-2848337 GAGGGTGATGGGAAGGTGGCTGG - Intronic
1091992005 12:4962963-4962985 GAAGGTGATGGGAGGGAGGGGGG + Intergenic
1092177317 12:6419127-6419149 CTGGGTGCTGGGCAGGATGCGGG - Intergenic
1092872020 12:12813618-12813640 TTGGGTGGTGGGAGGGCTGCTGG + Intronic
1093879916 12:24392592-24392614 CAGGGTGAGGGTAGGGTTGGGGG - Intergenic
1094039359 12:26106679-26106701 CAGGGAGATGGGAGCTGTGCAGG + Intergenic
1094475933 12:30840495-30840517 CAGGATGATGGTAGTGATGCAGG + Intergenic
1094490952 12:30960302-30960324 CAGGGTGATGGGAAGTGTACAGG - Intronic
1095131011 12:38542504-38542526 GAGGGTGAGGGCAGGGAAGCTGG - Intergenic
1095160594 12:38910277-38910299 GAGGGGGATGGGAAGGATGGAGG - Intergenic
1095233076 12:39765296-39765318 AAGGGTGATGGGGTGGATGAGGG + Intronic
1095357506 12:41293062-41293084 AAGGGAGATAGGAGGGACGCTGG + Intronic
1095921807 12:47539388-47539410 CAGGGAGATTGGCGGGAGGCCGG + Intergenic
1096524553 12:52202766-52202788 CAGGGGGAGGGGTGGGATGAGGG + Intergenic
1096588462 12:52641522-52641544 CAGGGAGAAGGAGGGGATGCTGG + Intergenic
1096694593 12:53340535-53340557 CTGGGTGGGGGTAGGGATGCTGG - Intronic
1097169099 12:57102558-57102580 CAGGCAGGTGGGAGGGATGAAGG - Intronic
1099195270 12:79608299-79608321 CAGGGGGATGGCAGGGAGGATGG + Intronic
1099681567 12:85836275-85836297 CAGGGTGAAGGGAGGAGGGCTGG + Exonic
1100648388 12:96556902-96556924 GAGGGTGAAGGGTGGGATGAGGG + Intronic
1101334164 12:103781564-103781586 ATGGCTGATGGGAAGGATGCAGG - Intronic
1101637844 12:106560986-106561008 CTGGCTGATGGGAGGTAAGCAGG + Intronic
1101732845 12:107440737-107440759 CAGGGAAATGGAAGGGAGGCAGG + Intronic
1102063560 12:109953762-109953784 CAGGTAGATGAGAGGAATGCTGG - Intronic
1102205780 12:111089931-111089953 GAGGGTGATGGGAGCCATGGAGG + Intronic
1102658724 12:114506079-114506101 TATGGTGATGGTAGGGATGATGG - Intergenic
1103239891 12:119404428-119404450 CAGGGTGGTGGGGGGGAGGTAGG - Intronic
1103333867 12:120174408-120174430 CAGGGTCCTGGGAGGCAGGCTGG + Intronic
1103341130 12:120221743-120221765 CACAGTGATGGCAGGGCTGCAGG + Exonic
1103566756 12:121819917-121819939 GAGGGTGGTGGGAGGGAGGCAGG + Intronic
1104213326 12:126711518-126711540 AAGGGAGAAGGGAGGGATGGAGG + Intergenic
1104357896 12:128104439-128104461 CTGGGTGATGGGAGGAGTGTGGG - Intergenic
1104612430 12:130240700-130240722 CCGGGTGAAGGGAGGGAAGAGGG + Intergenic
1104667692 12:130659000-130659022 CATGGTGGAGGGAGGGAGGCTGG - Intronic
1104708522 12:130967790-130967812 CAGGCGGATGAGAGCGATGCTGG - Intronic
1104756793 12:131274350-131274372 CAGGGGGAGGGGAGGGCTTCAGG - Intergenic
1104807553 12:131599117-131599139 AAGGCTGATGGGAAAGATGCAGG - Intergenic
1105299458 13:19119011-19119033 GAGGGTGATGGGGGGGAAGTGGG + Intergenic
1105417732 13:20227739-20227761 CAGGGTGATGGGTCAGCTGCGGG + Intronic
1105853764 13:24358381-24358403 AAGGGTGATGTGTGGGCTGCTGG + Intergenic
1105913690 13:24893912-24893934 GAGGGTGATGGGAGAGTGGCTGG + Intronic
1107128524 13:36870429-36870451 TAGGGTGAAGGCAGAGATGCTGG - Intronic
1107175699 13:37395493-37395515 AGGGGTGGTGGGTGGGATGCAGG - Intergenic
1109259570 13:60128051-60128073 GAGGGTGATGGGTGGGAGGAGGG - Intronic
1112326658 13:98446314-98446336 CACGGGGATGACAGGGATGCTGG + Intronic
1113069789 13:106409363-106409385 CAGGGTGATGGGACGCCTGGGGG + Intergenic
1113382083 13:109813407-109813429 CAGGGTGTTGGAAGGGATTATGG + Intergenic
1113582693 13:111440135-111440157 CAGGGAGGTGGCAGGGATTCAGG + Intergenic
1113913271 13:113854783-113854805 CTGTTGGATGGGAGGGATGCTGG + Intronic
1114182170 14:20376375-20376397 CAGCTCCATGGGAGGGATGCAGG + Intronic
1115762536 14:36589874-36589896 CAGGGTGAAGGGAAGGAGGAAGG + Intergenic
1115915416 14:38307130-38307152 CAGGGTGAAGGGAGGGAGGAGGG + Intergenic
1116029181 14:39550342-39550364 CGGGGTGAGGGGAGGGAGGATGG - Intergenic
1117964262 14:61190634-61190656 CAGGGTGGTGGGAGACAGGCTGG - Intronic
1118616035 14:67575060-67575082 CAGGGTGCCGGGAGGGAGGGAGG - Intronic
1118766087 14:68910082-68910104 CTCGGTGGAGGGAGGGATGCCGG + Intronic
1119771336 14:77221993-77222015 CAGGGTGAGGGGAAGGATATGGG - Intronic
1119859104 14:77923882-77923904 CAGGGAGAGGGGAGGGGAGCAGG + Intronic
1120704733 14:87734829-87734851 CAGGGGGATGGGGGGGACGGGGG + Intergenic
1120835824 14:89037567-89037589 GAGGGTGATGTGTGTGATGCTGG + Intergenic
1121224215 14:92309478-92309500 CAGGGAGATGGGAGGGTCCCAGG - Intergenic
1122263419 14:100535709-100535731 AAGGGGGAGGGCAGGGATGCAGG + Intergenic
1122408692 14:101514972-101514994 CAGGGAGGTGGGAGTGCTGCTGG - Intergenic
1122816611 14:104317111-104317133 CAGGATGGCGGGAGGGAAGCAGG - Intergenic
1122865712 14:104603185-104603207 CAGGGAGAAGGGAGGGAGCCAGG - Intronic
1122894001 14:104746403-104746425 CAGGGTGCAGGGAGGGTGGCTGG - Intronic
1122941652 14:104984243-104984265 CAGGGAGCTGGGAGGGGGGCAGG - Intergenic
1123146232 14:106133241-106133263 CAGGGTGAGGGCAGAGCTGCAGG - Intergenic
1123186473 14:106522290-106522312 CAGGGTGAGGGCAGAGCTGCAGG - Intergenic
1123223227 14:106875710-106875732 CAGGGTGGGGGCAGGGCTGCAGG - Intergenic
1123479270 15:20616055-20616077 CAGGGGGATGGGTGTGATGTGGG + Intergenic
1123638743 15:22384330-22384352 CAGGGGGATGGGTGTGATGTGGG - Intergenic
1124003830 15:25780528-25780550 CAGGGTGAGGGGTGAGAGGCTGG - Intronic
1124390126 15:29247680-29247702 CAGGGTTGGGGGAGGGAAGCTGG - Intronic
1124627092 15:31314419-31314441 CAGGGAGATGACAGGGATGATGG - Intergenic
1125358674 15:38843073-38843095 CAGGCTGGTAGGAGGGATTCTGG + Intergenic
1125589334 15:40844598-40844620 CAAGGCGACGGCAGGGATGCCGG - Exonic
1125600041 15:40910516-40910538 CAGGGTGCAGTGGGGGATGCTGG - Intergenic
1125863515 15:43020358-43020380 CAGTCTGATGGGAGAGATGAAGG - Intronic
1125881759 15:43201645-43201667 CAGGAGGATGGGAGTGAGGCAGG - Intronic
1126242398 15:46460200-46460222 CAGAGTGCTGGGAGGGAGGTGGG + Intergenic
1127761707 15:62146184-62146206 CAGGGTGAGGGTAGGGAAGGAGG - Intergenic
1127812132 15:62573582-62573604 CAGGGAGAGAGGAGGGAAGCTGG - Intronic
1128146367 15:65334455-65334477 CAGGGTGAGGGGAGGACTGCAGG + Intronic
1128769707 15:70272791-70272813 CAGTGTGATGCGAGGGCCGCAGG - Intergenic
1128967769 15:72077626-72077648 CAGGGTGGTGGCAGGGTGGCGGG + Intronic
1129439994 15:75574472-75574494 TAGGGTGATGGCAGTGATGGTGG + Intronic
1129689163 15:77703592-77703614 TGGGGTGATGTCAGGGATGCTGG + Intronic
1129689875 15:77707122-77707144 CAGGCTGCAGGCAGGGATGCTGG + Intronic
1129755327 15:78094587-78094609 CAGGGTGCTGGGGGAGCTGCAGG + Intronic
1130168415 15:81486331-81486353 CAGGGTGTTGGGAGGGAGCAAGG + Intergenic
1130509725 15:84579395-84579417 CAGGCAGATGGGAGGGAGCCAGG - Intergenic
1130585444 15:85177360-85177382 CAGGCAGATGGGAGGGAGCCAGG + Intergenic
1130760351 15:86813163-86813185 CAGGCTGATGGGAGTAATGATGG + Intronic
1131747023 15:95459702-95459724 CAAGGTGAGGGGAGGCATGCAGG - Intergenic
1131849611 15:96524849-96524871 CAGGGTGGTGGGAAGAAGGCAGG + Intergenic
1132116181 15:99138046-99138068 CAGGGTGTCCTGAGGGATGCTGG + Exonic
1133386060 16:5371351-5371373 CAGAGTGATGCCAGGGATGCCGG + Intergenic
1134012979 16:10868857-10868879 CGGGGAGCTGGGAGGGGTGCAGG + Intergenic
1134264291 16:12680196-12680218 GAGGGAGATGGGAGAAATGCAGG - Intronic
1134562738 16:15224720-15224742 CATGGTGATGGGAGAGATTCAGG - Intergenic
1134771150 16:16810867-16810889 CAGAGTGATGGGAGTGACTCTGG + Intergenic
1134861888 16:17567609-17567631 GGGGGGGATGGGAGGGATGCAGG + Intergenic
1134923276 16:18136353-18136375 CATGGTGATGGGAGAGATTCAGG - Intergenic
1135083893 16:19459244-19459266 CAGGGCCATGTGAGGGAGGCAGG + Intronic
1136279897 16:29202195-29202217 CAGGCTGTTGGGAAAGATGCTGG + Intergenic
1136279927 16:29202365-29202387 CAGGCTGTTGGGAAAGATGCTGG + Intergenic
1136391081 16:29964659-29964681 CAGGGTGGTGGGGGGGGCGCGGG - Intronic
1136692830 16:32048215-32048237 CAGGGTGAGGGCAGAGCTGCAGG + Intergenic
1136793326 16:32991440-32991462 CAGGGTGAGGGCAGAGCTGCAGG + Intergenic
1136876529 16:33862616-33862638 CAGGGTGAGGGCAGAGCTGCAGG - Intergenic
1137697158 16:50469016-50469038 CTGGGTGATGGGGGTGCTGCAGG - Intergenic
1138554618 16:57764252-57764274 GAGGGTGGTGGGAGGGAGGCTGG + Intronic
1138586365 16:57972848-57972870 CAGCCTGACGGGAGGGATGATGG + Intergenic
1138604926 16:58082543-58082565 CAGGGATATGGAAGGGAGGCAGG - Intergenic
1139633649 16:68245311-68245333 CGGGGGGATGCGGGGGATGCGGG + Intronic
1139670699 16:68491022-68491044 AGGGGTGGTGGGAGGGATGGGGG + Intergenic
1139991282 16:70941429-70941451 CAGTGTGATGGGAGGGAAGCAGG + Intronic
1141347914 16:83265203-83265225 CAGGGTGATGGCTGAGAAGCAGG - Intronic
1142084289 16:88168303-88168325 CAGGCTGTTGGGAAAGATGCTGG + Intergenic
1142175901 16:88645183-88645205 CAGGGAGACGGGGGGGATGCGGG + Intronic
1203095585 16_KI270728v1_random:1253131-1253153 CAGGGTGAGGGCAGAGCTGCAGG + Intergenic
1142743108 17:1942045-1942067 GAGGCTGGTGGGAGGGGTGCAGG - Intronic
1143270260 17:5670012-5670034 CAGGCTGATGGAAGGGAGGCAGG - Intergenic
1143382144 17:6503234-6503256 CAGAGTGAGGGGTGGGAGGCTGG - Intronic
1144026023 17:11276348-11276370 CCGGGTGATGGGAGGGAGATGGG + Intronic
1144206126 17:12980638-12980660 CAGGGTGACAGGAGGGAGTCAGG + Intronic
1144584198 17:16478032-16478054 CAGGGTGAGAGCAGGGACGCTGG - Intronic
1144790262 17:17854293-17854315 CAGGCTGATGGGAGGGAAGTGGG + Intronic
1145001779 17:19310343-19310365 CAGGGTGGGCGCAGGGATGCAGG + Intronic
1145788372 17:27608883-27608905 CAGGGTGATGGGCAGGGAGCCGG - Intronic
1146158226 17:30542170-30542192 CAGGGTGCGGGGATGGATTCCGG + Intergenic
1147025429 17:37578631-37578653 CAGGGTGCTGGGAGGGATCTTGG - Intronic
1147258237 17:39194747-39194769 CAGGGTGATGGGGTGGCTCCAGG + Intronic
1147453629 17:40521114-40521136 CTGTGTGAATGGAGGGATGCAGG - Intergenic
1147538371 17:41335355-41335377 CAGGGTGCAGGGCAGGATGCTGG + Intergenic
1147548608 17:41422335-41422357 CAGGGTGTTGGGGGAGATGCGGG - Exonic
1147550556 17:41438759-41438781 CAGGGTGCTGGGGGAGATGCGGG - Exonic
1148669903 17:49402748-49402770 CAGGGAGATGGGCTGGATGCGGG + Intronic
1148773708 17:50081368-50081390 CATGTTGATGGTGGGGATGCTGG - Exonic
1148866809 17:50633045-50633067 CAGGGTCATGGAAGGGGTGGAGG + Intergenic
1149446252 17:56715594-56715616 CAGGGTCCTGTGAGGGATGTGGG - Intergenic
1149637218 17:58180747-58180769 CAGGGTGCAGGGAGGGAAGGGGG - Intergenic
1151221308 17:72615146-72615168 CAGGGTGATGGGAGGGAGGGAGG - Intergenic
1151358196 17:73572490-73572512 CTGGGTGATAAGAGGGAGGCTGG - Intronic
1151696307 17:75719823-75719845 CAGAGTGATTGCAGGGGTGCTGG - Intergenic
1151976236 17:77484930-77484952 GGTGGTGATGGGAGTGATGCTGG + Intronic
1152158825 17:78654143-78654165 CAGGGTAGTGTGCGGGATGCTGG - Intergenic
1152181601 17:78825597-78825619 CTGTGAGATGGGAGGAATGCAGG - Intronic
1152265688 17:79293350-79293372 GAGGGGGAGGGGAGGGAGGCAGG - Intronic
1152446875 17:80350044-80350066 GATGGAGATGAGAGGGATGCTGG - Intronic
1152491902 17:80640670-80640692 CAGGATGTTGTGAGGGATGCAGG + Intronic
1152650426 17:81490054-81490076 CTGGGTGTTGGTGGGGATGCTGG + Intergenic
1152759087 17:82098880-82098902 TAGGGTGATGGGCGGGCGGCGGG + Intergenic
1152800359 17:82328007-82328029 CAGGGTGGTGGGGGGGCTGGTGG - Intronic
1155908709 18:31484206-31484228 ATGTGTGATTGGAGGGATGCTGG - Intergenic
1156089396 18:33447359-33447381 CAGGATAATGGCAGGGATGTTGG + Intergenic
1157727886 18:49978820-49978842 CAGGGTGTTGGGCGGGCTGGAGG + Intronic
1158305193 18:56097496-56097518 AAGAGTGATGGGAGGAATTCTGG - Intergenic
1159648599 18:70950427-70950449 CAGGCAGATGGGAGGGAAGGGGG - Intergenic
1159804706 18:72941904-72941926 CAGTGTGACGGGAAGGAGGCAGG + Intergenic
1159899913 18:74036425-74036447 CTGGCTGATGGCAGGGATGGAGG - Intergenic
1159946341 18:74447092-74447114 CAGGCTGAGGGGCGGGAAGCTGG + Exonic
1160002833 18:75043511-75043533 GACAGTGATGGGAGGGATGGAGG - Intronic
1160196275 18:76758226-76758248 CAGTGTGACGGTAGGGGTGCGGG - Intergenic
1160625535 18:80201828-80201850 CAGGGTGCTGGGTGGGAGGCGGG - Intronic
1160673777 19:377918-377940 CAGGGAGATGGGATGGGAGCTGG - Intergenic
1160676397 19:393641-393663 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676413 19:393703-393725 AAGGTTGATGGGAAGGATGATGG + Intergenic
1160676416 19:393715-393737 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676419 19:393727-393749 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676422 19:393739-393761 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676428 19:393764-393786 AAGGATGATGGGAAGGATGGTGG + Intergenic
1160676442 19:393818-393840 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676447 19:393843-393865 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676452 19:393868-393890 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676457 19:393893-393915 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676480 19:393986-394008 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676491 19:394035-394057 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676494 19:394047-394069 AAGGATGATGGGAAGGATGACGG + Intergenic
1160676518 19:394134-394156 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676521 19:394146-394168 AAGGATGATGGGAAGGATGACGG + Intergenic
1160676535 19:394196-394218 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676538 19:394208-394230 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676548 19:394245-394267 AAGGGTGATGGGAAGGATGATGG + Intergenic
1160676555 19:394270-394292 AAGGTTGATGGGAAGGATGATGG + Intergenic
1160676558 19:394282-394304 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676623 19:394594-394616 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676733 19:395088-395110 AAGGATGATGGGAGGGATGATGG + Intergenic
1160676738 19:395113-395135 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676741 19:395125-395147 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676762 19:395213-395235 AAGGTTGATGGGAAGGATGATGG + Intergenic
1160676778 19:395275-395297 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676787 19:395313-395335 AAGGTTGATGGGAAGGATGATGG + Intergenic
1160676803 19:395375-395397 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676812 19:395413-395435 AAGGTTGATGGGAAGGATGATGG + Intergenic
1160676828 19:395475-395497 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676831 19:395487-395509 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676854 19:395585-395607 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676861 19:395610-395632 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676871 19:395647-395669 AAGGTTGATGGGAAGGATGATGG + Intergenic
1160676874 19:395659-395681 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695185 19:480455-480477 GAGGATGATGGGAAGGATGATGG + Intergenic
1160695219 19:480607-480629 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695239 19:480721-480743 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695255 19:480835-480857 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695270 19:480924-480946 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695296 19:481063-481085 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695310 19:481139-481161 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695313 19:481151-481173 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695330 19:481226-481248 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695333 19:481238-481260 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695343 19:481288-481310 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695351 19:481339-481361 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695364 19:481402-481424 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695377 19:481453-481475 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695384 19:481478-481500 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695387 19:481490-481512 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695403 19:481551-481573 AAGGATGATGGGAAGGATGGTGG + Intergenic
1160710002 19:547094-547116 GAGGGGGATGGGAGGGATGAAGG + Intronic
1160876463 19:1298626-1298648 CAGGGGGATGGGCAGGATCCAGG + Intronic
1160954493 19:1684255-1684277 GGGGGGGATGGGAGGGCTGCAGG + Intergenic
1160956813 19:1697388-1697410 CTGGGAGATGGGATGGATGGTGG + Intergenic
1161039272 19:2101394-2101416 AAGGGTGCTGGGAAGGATGTGGG + Exonic
1161088029 19:2344106-2344128 CGGGGTGATGGGGGGGGTGATGG - Intronic
1161144323 19:2668512-2668534 CAGGGAGATGGAGGGGCTGCTGG + Intronic
1161286451 19:3471004-3471026 CAGAGTGAGGAGAGGGATGGAGG + Intergenic
1161329357 19:3678870-3678892 CAGGATGGAGGGAGGGATGGCGG + Intronic
1161580343 19:5077421-5077443 CAGGATGATGGGCGAGATGAGGG - Exonic
1161592610 19:5135603-5135625 CAGGGTGTTGGTGGGGGTGCCGG + Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161628559 19:5340175-5340197 CCGGGGGATGGGGGGCATGCGGG - Intronic
1161678333 19:5665984-5666006 CAGGGTGAAGGGAGAGATGGCGG - Intronic
1161768253 19:6218340-6218362 CAGGGTACTGGGAGGGAGGCTGG + Intronic
1162086563 19:8253113-8253135 CAGGATGTTAGGAGGGATGGTGG + Intronic
1162088005 19:8260063-8260085 CAGGGAGGAGGGAGGGCTGCTGG + Intronic
1162377983 19:10316317-10316339 CAGAGTCAAGGGAGGGAAGCTGG + Exonic
1162567305 19:11451577-11451599 CAGGATGAAGGGAGGGGTGGAGG + Exonic
1162743435 19:12786225-12786247 CAGGGACACGGGAGGGAGGCTGG + Intronic
1162838938 19:13341480-13341502 CAAGGAGATGGGAGGGTTGGAGG - Intronic
1163000391 19:14363360-14363382 GAGGGTGCTGGGACGGAAGCGGG - Intergenic
1163157860 19:15449215-15449237 CAGGGAGATGGTGGGGAGGCCGG + Intronic
1163250746 19:16125088-16125110 CAGCGTGAGGGGAGTGCTGCTGG + Intronic
1163389509 19:17021888-17021910 CAGGGGCATGGGAGGGAGGGAGG - Intronic
1163735467 19:18977664-18977686 CCCGGTGATGGGAAGGAGGCGGG + Intergenic
1164601001 19:29563105-29563127 CAGGGGCATGGAGGGGATGCCGG + Intronic
1164681005 19:30133745-30133767 CAGGGTGCAGAGAGGTATGCTGG + Intergenic
1164730398 19:30499868-30499890 CAGGGGCAAGGGAGGGATGGTGG + Intronic
1164976116 19:32573971-32573993 CAGGGATTTGGGAGGGATTCGGG + Intergenic
1165958487 19:39516113-39516135 TAGGGCGAGGGGAGGGATTCAGG + Intronic
1166194379 19:41196475-41196497 CAGGGTGATAGGGAGGATCCAGG + Intronic
1166329599 19:42070262-42070284 CAGGAGGAAGGGAGGGAGGCAGG + Intronic
1166357218 19:42234328-42234350 CAGAGTTATGGGAGGGTGGCGGG - Intronic
1166366505 19:42280924-42280946 TTGGGAGATGGGTGGGATGCGGG - Intronic
1166571958 19:43802653-43802675 CAGAGTGCTGGGAGGGGTGAAGG - Intronic
1166772807 19:45294471-45294493 CAGGGTGAGGGGTGGGAAGTAGG + Intronic
1167156317 19:47741434-47741456 CAGGGCCATGGGAGGGGGGCCGG - Exonic
1167200749 19:48063560-48063582 CGGGGGGACGGGAGGGATGGGGG - Intronic
1167213714 19:48149932-48149954 CAGGGAGATGGGAGACAGGCTGG + Intronic
1167334445 19:48875822-48875844 CTGGGTGAGGGCAGGGATGGGGG - Exonic
1167732388 19:51268058-51268080 CAGGGTGTTAGGAGGGCAGCAGG - Intronic
1167870988 19:52370071-52370093 CGGGGTGGAGGGAGCGATGCGGG - Intronic
1167974279 19:53211214-53211236 CAAGGTGATGGAAGGAATGCAGG + Intergenic
1168059181 19:53882007-53882029 CAGGGTGGTGGGGGGGAGCCAGG + Intronic
1168316506 19:55486854-55486876 CTGGGGGGTGGGAGGGATGCTGG + Exonic
1168460771 19:56555369-56555391 TATGGTGATGGGAGGGAGGATGG - Exonic
925017684 2:543914-543936 CAGGATGATGGGAGGCAGGGAGG + Intergenic
925723560 2:6851601-6851623 CAGGGTGATGGGCTGGGGGCAGG + Exonic
925876692 2:8317344-8317366 CATGGTGAGGGCAGGAATGCTGG + Intergenic
925969265 2:9095703-9095725 CAGGGTGGTGGCAGGGGTGGTGG - Intergenic
926020128 2:9487282-9487304 CAGGGCAATGGGAGGGAGACTGG + Intronic
927081328 2:19633749-19633771 CAGGAGGAGGGAAGGGATGCTGG - Intergenic
927348374 2:22074691-22074713 AAGGGTAATGGGAGGGGTGAAGG + Intergenic
927840463 2:26438806-26438828 GAGGGAGATGGGATGGAGGCTGG + Intronic
928069709 2:28202374-28202396 CAGGGGCATGGGAGGGAAGCAGG - Intronic
928774836 2:34748358-34748380 GAGGGTGAAGGGTGGGATGAGGG + Intergenic
929551423 2:42895499-42895521 CATGGGGGAGGGAGGGATGCAGG + Intergenic
929792530 2:45034210-45034232 CAAGGTGAAGAGAGGGCTGCAGG + Intergenic
930063631 2:47311044-47311066 CAGGGTTGTGGCAGTGATGCAGG + Intergenic
933026276 2:77263254-77263276 CAGCCAGATGGGAGAGATGCAGG - Intronic
934657080 2:96122047-96122069 CTGGGTGGTGGGAGGGGTACAGG - Intergenic
935644326 2:105321061-105321083 CTGGCTGATGGCAGGGATCCTGG + Intronic
936267728 2:111023215-111023237 CAGGGAGATGAGAGGGGAGCGGG + Intronic
936286785 2:111187343-111187365 CAGAGTCAGGGGAGGTATGCAGG + Intergenic
936346790 2:111681609-111681631 CTGGGTGATGGGTGTGATGTGGG - Intergenic
936489961 2:112961453-112961475 CTGGGTCATGGGAGGCATTCAGG + Intergenic
936891726 2:117378519-117378541 TAAGGTGACGTGAGGGATGCTGG + Intergenic
936928792 2:117765276-117765298 GAGGGTGAAGGGAGGGAAGGAGG + Intergenic
937094832 2:119228621-119228643 CAGGGTGATGGGTGGGTGGAGGG + Intronic
937288396 2:120767319-120767341 CAGGGTGCTGGGCTGGGTGCTGG + Intronic
937660062 2:124420450-124420472 CAGTGTGAAGGGAGGTAAGCAGG - Intronic
938092110 2:128440907-128440929 CAGGCTGCTGGGAGGGCTGCCGG - Intergenic
938285882 2:130116494-130116516 CAGGGTGAAGGGTGGGAGGAGGG - Intronic
938287311 2:130128862-130128884 GGGGGTGATGGGGGGGAGGCAGG - Intronic
938429723 2:131222408-131222430 CAGGGTGAAGGGTGGGAGGAGGG + Intronic
939949151 2:148447596-148447618 CAGGCTGATGGGAATGAAGCAGG + Intronic
939957790 2:148541032-148541054 AATGGTGATGGGAGGAATGTGGG + Intergenic
940019878 2:149145634-149145656 AAGGGAGAAGGGAGGGAGGCTGG - Intronic
941586388 2:167364241-167364263 AAGGTTAATGGGAGTGATGCTGG + Intergenic
942279304 2:174344105-174344127 TAGGGTGATGGGATGAATCCTGG - Intergenic
942620420 2:177839158-177839180 CATGGTGATGGCAGGGAGGCTGG - Intronic
943731144 2:191305156-191305178 TAGGGAGGTGGGAGGGGTGCTGG + Intronic
944470526 2:200047810-200047832 TAGGGGGATTGGAGAGATGCTGG + Intergenic
944505051 2:200402474-200402496 CAGGGGAATGGGAGGGAAGGTGG - Intronic
945918121 2:215726151-215726173 CAGGGAGAGGGGAGGGAGGGAGG + Intergenic
946434265 2:219641553-219641575 CAGGGAGCAGGGAGGGCTGCAGG + Intronic
947892991 2:233643118-233643140 CATTCTGAAGGGAGGGATGCAGG - Intronic
947980351 2:234403447-234403469 CAGGGTGATGGGATGGCCGCTGG - Intergenic
948061345 2:235045037-235045059 ATGGCTGATGGGAGGGACGCAGG - Intronic
948087714 2:235265480-235265502 CAGGGTGAAGACAGGGAGGCTGG - Intergenic
948189395 2:236046224-236046246 CTCGGTGATGGGCTGGATGCTGG + Intronic
948554287 2:238796552-238796574 CAGGAGGATGGGAGGGAACCAGG - Intergenic
948884057 2:240874243-240874265 CCGGGCGAGGGGAGGGCTGCAGG + Intronic
948918350 2:241049810-241049832 CAGGGTGATGGCAGGGCTGGGGG - Exonic
949043337 2:241859247-241859269 CAGGGAGATGGGGGGGATGGGGG - Intergenic
949050398 2:241894785-241894807 CAGGGTGCAGGGAGGCAGGCGGG - Intronic
1169072145 20:2739192-2739214 CTGGGTGATGGGAAGGCTACAGG - Intronic
1169415115 20:5409464-5409486 GAGGGTGATAGGAGAGGTGCAGG + Intergenic
1169745685 20:8940270-8940292 GAGGGTGATGGTGGAGATGCTGG - Intronic
1169960311 20:11152404-11152426 CAGGGAGATGGGAGACATACTGG + Intergenic
1170941855 20:20854621-20854643 CAGGGTCATGGCCAGGATGCTGG - Intergenic
1171269320 20:23801091-23801113 CATGGTGATGGTAGTGATGATGG - Intergenic
1171462988 20:25309307-25309329 CATGGGGATGGGAGCGAGGCTGG + Intronic
1171489322 20:25505312-25505334 CTGGGTGGTGGGGGAGATGCTGG + Intronic
1172639604 20:36432729-36432751 CAGGGTCAGGGGTGGGATGAGGG + Intronic
1172872314 20:38143454-38143476 CAGGGCGTTGGCAGGTATGCAGG - Intronic
1173316751 20:41951374-41951396 CAGGCTCATGGGAGGCAGGCTGG + Intergenic
1173380154 20:42532752-42532774 CAGGGTCGTGGGAGAGATGTTGG - Intronic
1173447704 20:43134938-43134960 CAGGTTGAGGCCAGGGATGCTGG - Intronic
1173476270 20:43362077-43362099 CAGGGTTATAGTAGGGATCCAGG + Intergenic
1173552315 20:43941147-43941169 CAGGGTGATGTGAGGGAAGGGGG + Intronic
1173706243 20:45112170-45112192 GGGGGTGATGGGAGGGTTCCTGG + Intronic
1174398371 20:50261759-50261781 AAGGGTCCTGGGAGGGCTGCGGG - Intergenic
1174834091 20:53839800-53839822 CAGGGTGAGGAGCAGGATGCAGG - Intergenic
1174926620 20:54767313-54767335 CAGAGTGAGGGCAGGGAGGCAGG - Intergenic
1176301606 21:5101478-5101500 CAGGGGCAGGGCAGGGATGCAGG + Intergenic
1179278780 21:39916016-39916038 CAGGCTGATTGGAGGGATAGAGG - Intronic
1179855425 21:44160421-44160443 CAGGGGCAGGGCAGGGATGCAGG - Intergenic
1179883948 21:44305529-44305551 ATGGGTGCTGGGAGGGAGGCAGG + Intronic
1179924090 21:44522852-44522874 CAGGCCCATGGCAGGGATGCTGG - Intronic
1180177544 21:46097976-46097998 GAGGGGGATGGGAGGGAAGCGGG - Intergenic
1180763064 22:18223550-18223572 CCGGGAGCTGAGAGGGATGCTGG + Intergenic
1180772579 22:18400997-18401019 CCGGGAGCTGAGAGGGATGCTGG - Intergenic
1180803959 22:18650613-18650635 CCGGGAGCTGAGAGGGATGCTGG - Intergenic
1180806804 22:18718836-18718858 CCGGGAGCTGAGAGGGATGCTGG + Intergenic
1180953729 22:19731988-19732010 CAGGCTGAAGGGAGGGCTTCAGG + Intergenic
1180981376 22:19879610-19879632 CAGGGTGGTGGGGGGGGTGGGGG + Intronic
1181217760 22:21344646-21344668 CCGGGAGCTGAGAGGGATGCTGG + Intergenic
1181309295 22:21935378-21935400 AAGGGTGACAGGAGGGATCCTGG + Intronic
1181318190 22:21984822-21984844 CAGGGTGGTGGCAGGGAGGCAGG - Intergenic
1181359276 22:22322565-22322587 CAGGGTCAGGGGAGGGGTCCAGG + Intergenic
1181369377 22:22404317-22404339 CAGGGTCAGGGGAGGGGTCCAGG + Intergenic
1181512251 22:23394272-23394294 CAGGGTGCTGGGTGGGGGGCTGG - Intergenic
1182451616 22:30425206-30425228 CAGGCTGGTGGGAGGGTTTCAGG + Exonic
1183022959 22:35042202-35042224 CAGCTTGATGGAAGGGATGGTGG + Intergenic
1183033936 22:35126595-35126617 CATGCTGTTGGGAGGGAGGCAGG + Intergenic
1183056691 22:35311090-35311112 GAGGGTGATGGGGTGGCTGCGGG + Intronic
1183483659 22:38078064-38078086 CAGGGTGGTGGGAGGGAGTCTGG - Intergenic
1183498076 22:38161797-38161819 CAGGCTGAGGGGAGGGAAGGAGG + Intronic
1183754394 22:39746727-39746749 CAGGGTGCTGGGAGGCCAGCAGG + Intronic
1183818579 22:40325031-40325053 TAGGGTGGGGGGATGGATGCCGG + Exonic
1184405330 22:44297597-44297619 CAGAGTGGTGGGAGGGTTCCAGG - Intronic
1184458772 22:44625671-44625693 CAGGGAGATGAAAGGGATGGGGG + Intergenic
1184516155 22:44964029-44964051 CTGTGTGTTGGGAGGGTTGCTGG + Intronic
1184592361 22:45493563-45493585 CAGGGAGCTGGGAGGGCAGCTGG + Intergenic
1184838431 22:47037804-47037826 TAGGAGGATGCGAGGGATGCTGG + Intronic
1184902181 22:47453316-47453338 CAGGAAGAAGGGAGGGATGAGGG - Intergenic
1185288740 22:50013844-50013866 CGGGGTGGTGGGAGGGAGGGAGG - Intergenic
1185336816 22:50274668-50274690 GAGGGGGCTGGGAGGGGTGCTGG - Intergenic
1185336845 22:50274730-50274752 GAGGGGGCTGGGAGGGGTGCTGG - Intergenic
1185336860 22:50274762-50274784 GAGGGGGCTGGGAGGGGTGCTGG - Intergenic
1185336876 22:50274794-50274816 GAGGGGGCTGGGAGGGGTGCTGG - Intergenic
1185336905 22:50274856-50274878 GAGGGGGCTGGGAGGGGTGCTGG - Intergenic
1185347105 22:50315234-50315256 CAGGGTGACGGGAGGGGTCTGGG - Intronic
1203234417 22_KI270731v1_random:141985-142007 CCGGGAGCTGAGAGGGATGCTGG - Intergenic
949627490 3:5883506-5883528 TAGGGTGATTGGAGGGAAGAGGG + Intergenic
950602973 3:14051560-14051582 CAGGGTGATGGAAGGGAGGGGGG - Intronic
950723222 3:14899255-14899277 CAGAGAGATGGGAGGGAAGTGGG - Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951565193 3:24005878-24005900 CAGGGAGAAAGGAAGGATGCAGG - Intergenic
952344861 3:32473902-32473924 CATGGTAAAGGGAGGGATGGAGG - Intronic
953616806 3:44497964-44497986 CAGTGTAATGGGAGGGAGACGGG + Intergenic
953888931 3:46736275-46736297 CAGGGGCATGGGACGGAGGCTGG - Intronic
954304887 3:49720382-49720404 CAGGGAGACGGAAAGGATGCAGG + Exonic
954633426 3:52058878-52058900 CAGGCTAATGTGAGGGATGGCGG - Intergenic
955353779 3:58213728-58213750 CAGGGTGCAGGGAGGGATGCAGG + Intronic
955487152 3:59446834-59446856 CAGGGAGATGGGAGGTAGGGAGG - Intergenic
955675535 3:61444356-61444378 CAGGGTGGAGGGAGGGAGGGAGG - Intergenic
956560058 3:70565314-70565336 TAGGGTGATGGGTGAGATACTGG - Intergenic
957521065 3:81319196-81319218 CATTGTGTTGAGAGGGATGCAGG - Intergenic
959631430 3:108511373-108511395 CATGGTGATGTGAGTGAAGCTGG + Intronic
960048738 3:113221249-113221271 CAGAGTGAAAGGAGGGTTGCTGG + Intronic
960914067 3:122679731-122679753 CCGAGTGATGGGAGAGAAGCTGG - Intergenic
960933896 3:122883640-122883662 CAGGGGGATGGGAGTGATACAGG + Intergenic
961387254 3:126529751-126529773 CAGGATGATGGGAGGGGAGGAGG - Intronic
962383220 3:134913252-134913274 CAGGGGCATGGGAGGGGTGAGGG + Intronic
963306516 3:143659664-143659686 CAGGGTGATGACAGGGATAGGGG - Intronic
968009611 3:195265393-195265415 CAAGGTGATGGGAAAGATGAAGG + Intronic
968628333 4:1637905-1637927 CAGGTGGATGGGAGGAATGGGGG - Intronic
969376727 4:6768130-6768152 CAGGGTGGGGGGAGGGGAGCTGG - Intergenic
969718306 4:8879041-8879063 GAGGGTCTTGGGAGGGCTGCAGG + Intergenic
969945868 4:10782627-10782649 CAGGTTGATGGGAAGGATCCAGG - Intergenic
970172752 4:13305740-13305762 CAGGCGGATGGGAGTGATGGTGG - Intergenic
970367186 4:15371768-15371790 AAGGGGGCTGGGAGGGATGCAGG + Intronic
971394495 4:26215807-26215829 CAAGGAGGTGAGAGGGATGCGGG - Intronic
971395341 4:26221932-26221954 CAGGGCGGTGAGAGGGATGGGGG + Intronic
971774598 4:30946471-30946493 CAGTGTGGTGGGAGGGAGGTGGG - Intronic
974454207 4:62105262-62105284 CAGGGTGAAGGGTGGGAGGAGGG - Intergenic
975745162 4:77468143-77468165 CAGGGTGATGGGACTGAAGAAGG + Intergenic
976615098 4:87068536-87068558 CAGGGAGACGGGAGGTATGGAGG + Intronic
977749231 4:100588835-100588857 CAGGGTGGTGGCAGTGCTGCTGG - Intronic
978453540 4:108863368-108863390 CAGGGTGAACGGGGGGAAGCAGG - Exonic
979301114 4:119088463-119088485 GAGGGTGATGGGAGGGAGGAGGG - Intergenic
980172150 4:129302847-129302869 AAGGGTAATGGGTGGGATGGGGG + Intergenic
980488332 4:133490656-133490678 AAGGGTCATGGGAGGGAAACTGG + Intergenic
981027140 4:140088201-140088223 AAGTGTGATGGGAGGGAGGAAGG + Intronic
984822427 4:183893471-183893493 CTGGGTGATGCAAGTGATGCTGG + Intronic
985896368 5:2751820-2751842 CAGAGAGACGGGAGGGAGGCGGG + Intergenic
986454546 5:7903309-7903331 CAGGATGATAGGAGGGCAGCAGG - Intronic
987115913 5:14726553-14726575 AAGAGTGACGGGAGGGAGGCTGG + Intronic
988113716 5:26855694-26855716 CAGAGTGGTGGGTGGGATGCGGG + Intergenic
989195963 5:38716601-38716623 CAGGGAGAATTGAGGGATGCTGG + Intergenic
990998782 5:61761093-61761115 GAGGGTGAAGGGAGGGAGGAGGG + Intergenic
991625508 5:68596716-68596738 CAGGGTGAGGGGATGGATTCAGG + Intergenic
992308109 5:75464434-75464456 CAGGGTGCTATGGGGGATGCGGG + Intronic
993663821 5:90670626-90670648 CAGCATGATGGTAGGGATGGAGG + Intronic
994085300 5:95751678-95751700 GAGGGTGGTGGGAGGGAGGAGGG - Intronic
994117651 5:96078935-96078957 GAGGGTGCTGGGTGGGAGGCAGG + Intergenic
994313624 5:98306327-98306349 CAGGGGGATGGAAGGGGTGTTGG + Intergenic
994539950 5:101081904-101081926 AAGGGAGATGGGAGGGAGGGAGG - Intergenic
996581241 5:125034637-125034659 CTGGGTCATGGGAGGGGTGGGGG - Intergenic
996949433 5:129108281-129108303 CAGGGTGGTGGGAAGCAGGCAGG + Intronic
997656586 5:135559616-135559638 CACGGGGAAGAGAGGGATGCTGG + Intergenic
997725144 5:136114043-136114065 AAGGGTGAGGGCAGGGATGGAGG - Intergenic
998164830 5:139837020-139837042 GAGGGGCATGGGAGGGAGGCTGG + Intronic
999622209 5:153485100-153485122 TAGGGAGATTGGAGGGATGAGGG + Intergenic
1000042040 5:157491938-157491960 CAGTGCAATGGGAGGGATGCTGG + Intronic
1001308130 5:170590551-170590573 GAGGGTGATGGGAGGGGTGAGGG + Intronic
1001413709 5:171528601-171528623 CAGCCAGTTGGGAGGGATGCAGG - Intergenic
1001710024 5:173771168-173771190 AAGGGGGAGGGGAGGGAGGCGGG - Intergenic
1001785557 5:174409712-174409734 CCGGGGGATGGGAAGGATGCTGG - Intergenic
1002083396 5:176751295-176751317 CAGGGTGATTGGTCTGATGCAGG - Intergenic
1002457573 5:179354281-179354303 CAGGCTGCTGGGAGGGAGGATGG + Intergenic
1002947367 6:1775943-1775965 AAGGGAGATGGGAGGTATGTGGG + Intronic
1003116441 6:3286814-3286836 CTGGGTGCAGGGAGGGAAGCTGG - Intronic
1003119011 6:3304883-3304905 CAGGGAGAGGAGAGGGATGCAGG + Intronic
1004160807 6:13211265-13211287 CAGGGGGAGGGGTGGGAGGCTGG - Intronic
1004479771 6:16007469-16007491 GAGTGTGATGGGATGGGTGCAGG - Intergenic
1004828551 6:19451120-19451142 CAGGGTGGTGGGTGGGAGGAGGG - Intergenic
1005692625 6:28322100-28322122 CAGGGTGAGTGGGGTGATGCAGG - Intergenic
1006084981 6:31589110-31589132 CATGGTGGTGGGAGGGGCGCTGG + Exonic
1006101671 6:31689555-31689577 GTGGGGGATGGGAGGGAGGCTGG + Intronic
1006473427 6:34240733-34240755 AAGAGTGATGGCTGGGATGCTGG - Exonic
1006507515 6:34498976-34498998 CAGGGTTAGGGGAGGGTTGGGGG + Intronic
1006615993 6:35327328-35327350 CAGGGTGATGGAAAGGACACAGG - Intergenic
1006984974 6:38169998-38170020 CAGGGTGCTGGGTGGGTTGGAGG + Exonic
1007019829 6:38508315-38508337 TGGGGTCATGGGAGGGATGGAGG - Intronic
1007225600 6:40311571-40311593 CATGATGATGGGAGGTAGGCAGG + Intergenic
1007316550 6:40993854-40993876 CAGGGTACTGGGAAGGATGGAGG - Intergenic
1007387358 6:41528830-41528852 CAGCCTGGTGAGAGGGATGCGGG + Intergenic
1007836681 6:44679172-44679194 CAGGCAGATAGGAGTGATGCAGG + Intergenic
1008386490 6:50897346-50897368 CAGTGTGGTGGGAGGGGAGCTGG - Intergenic
1008419711 6:51284017-51284039 GAGGGAGAAGGGAGGGATGAAGG + Intergenic
1008494153 6:52115793-52115815 GAGGATGATGGGAGGGAAGGAGG + Intergenic
1010743125 6:79530356-79530378 AAGGGTGAAGGGTGGGATGAGGG + Intronic
1011509831 6:88088318-88088340 CAGGGTGGTGAGAGGGCTGTGGG - Intergenic
1011983643 6:93417415-93417437 GGGGGTGATGGGAGGGAGGGTGG - Intronic
1012494410 6:99818749-99818771 CATGGTGATGGCAGGCATGATGG + Intergenic
1012939544 6:105402725-105402747 GAGGGGGAGGGGAGGGACGCGGG + Intronic
1013068314 6:106704890-106704912 AATGTTGATGGGATGGATGCTGG - Intergenic
1013526887 6:110982325-110982347 CCGTGGGATGGGAGGGATGTGGG + Intronic
1015384908 6:132610836-132610858 CTTGGTGATGGGAGGTGTGCAGG + Intergenic
1015436505 6:133195783-133195805 GAGGGTGATGGGTGGGAGGAGGG - Intergenic
1016828368 6:148408937-148408959 AAAGGTGGTGGGAGGGAGGCAGG - Intronic
1017671336 6:156772124-156772146 CAGGGTGAGGGCAGGCATGCTGG - Intergenic
1018051927 6:160016650-160016672 CAGGGTGTGGTGAGGGATGATGG - Intronic
1018433592 6:163742545-163742567 CAGGGTGGTGGGAGGCATGCAGG - Intergenic
1018699613 6:166416194-166416216 GAGGGTGATGGTAGGGTTGATGG - Intronic
1019160924 6:170066489-170066511 CAGAGGGATGGGATGGATGGAGG - Intergenic
1019665988 7:2252617-2252639 CAGGGTGAAGGGGGGGCTGGAGG - Exonic
1019801499 7:3091459-3091481 CTGGGTGGTGGGAGGGCTGCTGG + Intergenic
1021501758 7:21339501-21339523 CAGGGCAATGGGAGGGATGGGGG - Intergenic
1021638550 7:22715183-22715205 CAGGGAGAGAGGAGGGAGGCAGG + Intergenic
1022113387 7:27244463-27244485 GAGGGTTATGGGAAGGAGGCTGG - Intronic
1022190678 7:28014259-28014281 TTGGGTGATGGGAGGGTTACTGG - Intronic
1022472245 7:30689073-30689095 CAGGGTGGTGGGTGGGGTGCTGG - Intronic
1022538588 7:31114385-31114407 GGGGGTGTTGGGAGGGATGAAGG + Intergenic
1023039696 7:36161309-36161331 CAGGATGATGTGTGGGATGAGGG + Intronic
1024094221 7:45971687-45971709 CAGGGAGCAGGGAGGGAGGCAGG - Intergenic
1025178120 7:56812097-56812119 CAGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025178550 7:56813836-56813858 CAGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025178988 7:56815626-56815648 CAGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025179893 7:56819350-56819372 CAGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025180368 7:56821332-56821354 CAGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025180811 7:56823170-56823192 CAGGCTGCTGGGAGGCAGGCAGG + Exonic
1025181238 7:56824921-56824943 CAGGCTGCTGGGAGGCAGGCAGG + Intronic
1025690231 7:63750236-63750258 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025690679 7:63752059-63752081 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025691130 7:63753882-63753904 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025691562 7:63755658-63755680 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025692004 7:63757481-63757503 CAGGCTGCTGGGAGGCAGGCAGG - Exonic
1025692453 7:63759304-63759326 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025692897 7:63761127-63761149 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025693313 7:63762806-63762828 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025693756 7:63764629-63764651 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1026340630 7:69431084-69431106 AAGGGTGATGGGAGGTGGGCAGG - Intergenic
1026549023 7:71351288-71351310 GAGGGTGATGGAAGGGAGGTAGG + Intronic
1026774116 7:73220656-73220678 CAGGGCGATGTGACGGATGAAGG - Intergenic
1026864574 7:73815500-73815522 CAGGGTGCTGGGTCAGATGCTGG + Intronic
1026898056 7:74021950-74021972 CAGGATGCTGGGTGGGAGGCAGG - Intergenic
1027014973 7:74774042-74774064 CAGGGCGATGTGACGGATGAAGG - Exonic
1027073058 7:75171911-75171933 CAGGGCGATGTGACGGATGAAGG + Intergenic
1029035990 7:97522456-97522478 AAGGGTGATGCCAGGGATGAGGG - Intergenic
1029606600 7:101602851-101602873 CAGGGTGAGGGGTGGGATGGGGG - Intergenic
1030094406 7:105885259-105885281 CTGGGTGGTGGGAGAGAAGCAGG + Intronic
1030180667 7:106705528-106705550 CAGGATGATGGAAGAGAAGCAGG - Intergenic
1030670058 7:112325855-112325877 CAGCTTGCTGGGAGGGATGTGGG - Intronic
1031133549 7:117861241-117861263 CAGCGTGATGGAAGGGGAGCTGG - Exonic
1032087796 7:128892869-128892891 CAGGGGGCTGGGTGGGGTGCTGG + Exonic
1032529391 7:132607847-132607869 GAGGATGATGGGAGTGATGGTGG - Intronic
1033243325 7:139699168-139699190 CAGGCTGGTGGGAGAGATGGCGG - Intronic
1033438375 7:141355102-141355124 GGGGGTGATGGAAGGGATGAAGG + Intronic
1033956389 7:146854054-146854076 CAGGGAGATGAGAAGGAGGCTGG + Intronic
1034072183 7:148196900-148196922 CAGGCTCAAGGGAGGGATTCAGG + Intronic
1034443900 7:151101895-151101917 CTGGGTGAGGGGAGCCATGCGGG + Intronic
1035023669 7:155813243-155813265 CAGGGTGTTGGGGGGGGGGCAGG + Intergenic
1035065253 7:156099776-156099798 GAGGGGGATGAGAGGGGTGCGGG + Intergenic
1035074451 7:156169011-156169033 CAGTGTGTGGGGTGGGATGCTGG + Intergenic
1035180032 7:157082625-157082647 CAGTGTGATTGAAGGGATGCAGG + Intergenic
1035363314 7:158328629-158328651 CTGGGTGGTGGGAGGAATGGGGG - Intronic
1035523907 8:296867-296889 TGGGGAGCTGGGAGGGATGCAGG + Intergenic
1035579191 8:729309-729331 CAGGGTCATGGGGTGGTTGCAGG - Intronic
1035723784 8:1812528-1812550 CAGGGAGCTGTGAGGGATCCTGG + Intergenic
1037791009 8:21941672-21941694 TAAGGAAATGGGAGGGATGCTGG + Intronic
1037808171 8:22069827-22069849 CATGCTGATGGCAGGGAGGCTGG - Intronic
1039552338 8:38452031-38452053 GAGGGAGAGGGGAGGGAGGCTGG + Intronic
1041375482 8:57206778-57206800 TAGGGTGATTGCAGGGGTGCTGG + Intergenic
1041376245 8:57211157-57211179 TAGGGTGATTGCAGGGGTGCTGG + Intergenic
1042120620 8:65484068-65484090 CAGTTGGATGGGAGGGATGGAGG + Intergenic
1042433839 8:68741080-68741102 GAGGGTGAAGGGAGGGAGGGGGG + Intronic
1046772461 8:118129680-118129702 CAGGGAGATGGCTGTGATGCAGG - Intergenic
1046790761 8:118319333-118319355 CAGGGTGAAGGGAGAGAAGTGGG - Intronic
1047037623 8:120956724-120956746 CAGAGTGGTGGGAGAGAGGCAGG + Intergenic
1047175663 8:122538103-122538125 GAGGGAGAAGGGAGGGATACTGG + Intergenic
1047878452 8:129166691-129166713 AAGAGGGATGGGAGGGATGCAGG - Intergenic
1048053066 8:130837496-130837518 CAGGGTGATAGGTGTTATGCTGG - Intronic
1049005065 8:139849847-139849869 CAGGGCGAAGTGAGGTATGCTGG - Intronic
1049252532 8:141596920-141596942 CAGGGTGGTGGGTGGGGTGAGGG - Intergenic
1049261676 8:141642266-141642288 CAGGGTCCTGGGAGGGGTGCAGG + Intergenic
1049303179 8:141882613-141882635 CAGGGAGATGGAGGGCATGCAGG - Intergenic
1049305135 8:141898692-141898714 CAGAGTCATGGGTGGGAAGCTGG + Intergenic
1049308099 8:141918174-141918196 TGGGGTGAGGGGAGGGACGCAGG + Intergenic
1051193875 9:14542437-14542459 CAGGGAGATGGGAGTGAAGGAGG - Intergenic
1051680554 9:19603490-19603512 CAGGGTGAGGGGAGGGAGGGGGG + Intronic
1051692656 9:19732796-19732818 CAGGCAGATGGGAGGGCAGCTGG - Intronic
1052879753 9:33594159-33594181 TAGGGTGATGGGAGGGTGGTGGG + Intergenic
1053434408 9:38065976-38065998 CAGGGTTACAGGAGGGATGAAGG - Intronic
1053496228 9:38550070-38550092 TAGGGTGATGGGAGGGTGGTGGG - Intronic
1054709016 9:68492363-68492385 CTAGGTGATGAGAGGGCTGCTGG - Intronic
1054947346 9:70810125-70810147 CAGGGTGATGGAAAGGAGGGTGG - Intronic
1056110871 9:83393443-83393465 CAGGGTGGTGGGATGGTTTCAGG + Intronic
1056526541 9:87447833-87447855 CAGGGAGGTTGGAGGAATGCAGG - Intergenic
1056808995 9:89749974-89749996 CAGGATCATGGGGAGGATGCAGG - Intergenic
1058343647 9:103930287-103930309 CACGGGGAAGGGAGGGAGGCAGG - Intergenic
1058468664 9:105254474-105254496 CAAGGTGGCGGCAGGGATGCAGG + Intronic
1058948479 9:109881028-109881050 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1060301464 9:122376820-122376842 CAGGGTGGTGGGGGTGATGGTGG + Intronic
1060879892 9:127110818-127110840 CAGGGTGGTGGCAGGGAGGTGGG - Intronic
1060991756 9:127853597-127853619 CAGGGAGGTAGGAGGGAGGCAGG + Intronic
1061057527 9:128232437-128232459 CGGGATGATGGGTGTGATGCGGG + Intronic
1062127375 9:134870814-134870836 GAGGGAGGTGGGAGGGAAGCTGG + Intergenic
1062201378 9:135304567-135304589 GAGGGTGAGTGGAGGGATGGAGG + Intergenic
1062235164 9:135504438-135504460 CACGGTGAAGGGAGGGCTGCTGG - Exonic
1062303225 9:135887574-135887596 GAGGCGGAGGGGAGGGATGCAGG + Intronic
1062460883 9:136662146-136662168 GGGGGTGTGGGGAGGGATGCGGG - Intronic
1185459783 X:328779-328801 CAGGGAGAGGGGAGGGGGGCGGG - Intergenic
1185944677 X:4361969-4361991 GAGGGTGGTGGGAGGGATGGGGG - Intergenic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1186819484 X:13272341-13272363 CATGGTGATGGAAGGGAGCCTGG + Intergenic
1189462060 X:41250861-41250883 AAGGGTGAGGGAAGGTATGCAGG + Intergenic
1190247392 X:48699666-48699688 CAGGGTGGTGGCAGTGATGATGG + Intronic
1193023783 X:76821854-76821876 CTTGGGGATGGGGGGGATGCAGG + Intergenic
1194406791 X:93506302-93506324 CTGGATGGTGGGAGGGGTGCAGG + Intergenic
1195236087 X:102900072-102900094 CAGGGGAAAGGGAGGGATGGAGG - Intergenic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1196338206 X:114564228-114564250 CAGGGTGGAGGGTGGGATGAGGG + Intergenic
1196555442 X:117079642-117079664 AAGGGTGATGGGAAGGATTTAGG + Intergenic
1196756053 X:119158288-119158310 AAGGGGTATGGGAGGGAGGCAGG + Intergenic
1198033682 X:132780322-132780344 CAGGATGAAGGGAGGCATGAGGG - Intronic
1198421643 X:136474487-136474509 CAGGGTGAAGTGAGGGAAGGGGG + Intergenic
1199821992 X:151458554-151458576 GAGGGTGATGGGTGGGAGGAGGG + Intergenic
1200122860 X:153799381-153799403 CAGGCTGATGGGAGAGGTGCAGG - Intergenic
1201731239 Y:17206034-17206056 GAGGGTGGTGGGAGGGATGGGGG - Intergenic
1201741285 Y:17326410-17326432 GAGGGGGAAGGGAGGGAGGCGGG + Intergenic