ID: 905931451

View in Genome Browser
Species Human (GRCh38)
Location 1:41790816-41790838
Sequence ATATGCTAGGACAAGTGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905931451_905931454 -6 Left 905931451 1:41790816-41790838 CCCTAACACTTGTCCTAGCATAT 0: 1
1: 0
2: 0
3: 14
4: 106
Right 905931454 1:41790833-41790855 GCATATCCCATGCTCCCTCATGG 0: 1
1: 0
2: 2
3: 10
4: 131
905931451_905931457 2 Left 905931451 1:41790816-41790838 CCCTAACACTTGTCCTAGCATAT 0: 1
1: 0
2: 0
3: 14
4: 106
Right 905931457 1:41790841-41790863 CATGCTCCCTCATGGCCCCATGG 0: 1
1: 0
2: 2
3: 30
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905931451 Original CRISPR ATATGCTAGGACAAGTGTTA GGG (reversed) Intronic
905931451 1:41790816-41790838 ATATGCTAGGACAAGTGTTAGGG - Intronic
906922384 1:50078459-50078481 CTCTGCTAGCACAATTGTTAAGG - Intronic
907964821 1:59318823-59318845 GCATGCTAGGATCAGTGTTAAGG + Intronic
912690823 1:111803420-111803442 ATATGCTAGGATCAGTTTTGGGG + Intronic
916476933 1:165178392-165178414 ATATCCAAGGAGAAGTGATATGG - Intergenic
918761349 1:188414275-188414297 ATATGAAAGGACCAGTGTTATGG - Intergenic
919249777 1:195038960-195038982 ATATGCAAAAATAAGTGTTAAGG + Intergenic
919318933 1:196009188-196009210 ATACAATAGGACAAGTGATATGG - Intergenic
920988537 1:210913755-210913777 ATATGCAAGGAAAACTGATATGG - Intronic
921000969 1:211042395-211042417 ATATGCCAGGCCTTGTGTTAAGG - Intronic
1068921450 10:62489035-62489057 ATAGGATATGACAAGTATTATGG + Intronic
1072645911 10:97253477-97253499 AGATGCTGGGATAGGTGTTAGGG + Intronic
1074617513 10:115084231-115084253 ATATTTTAGGACATGTTTTATGG - Intergenic
1075164581 10:120055558-120055580 ATAGGATATGAGAAGTGTTATGG - Intergenic
1077620697 11:3720153-3720175 ATATGCCAGGCCAAGTGCGAAGG - Intronic
1082665438 11:55970810-55970832 AGATGCTTAGACAAGTGGTAGGG + Intergenic
1088049578 11:105495320-105495342 TTATGTAAGGACAAGTGATATGG - Intergenic
1093521640 12:20057931-20057953 ATATGCAATGACAAGAGTTCAGG + Intergenic
1095309105 12:40674967-40674989 ATATATTAGGACAATAGTTATGG + Intergenic
1096171373 12:49473582-49473604 ATATTCTTGTACAAGTGTTACGG - Intronic
1097693104 12:62752595-62752617 ATATGCTTGGAAAAATGTTAAGG - Intronic
1099598098 12:84694445-84694467 ATAAGCAAGGACAGGAGTTAAGG - Intergenic
1100793323 12:98154054-98154076 ATATGGAAGGACAGGTGTGAAGG - Intergenic
1102768870 12:115455953-115455975 ATAAGTTAGGAAAAGTGTTTTGG - Intergenic
1105543546 13:21335610-21335632 ATATCCTAGTACATGTGTTTTGG - Intergenic
1106188579 13:27429449-27429471 ATAAGCCAAGACAAGTTTTATGG + Intronic
1106931574 13:34671312-34671334 CTATGATAGGACATGTGGTAAGG + Intergenic
1107494034 13:40907097-40907119 ATAGGCTAAGACAAAAGTTAAGG - Intergenic
1107602606 13:42028815-42028837 ATGTGTTAAGACAAGTGTAAAGG - Intergenic
1108821325 13:54354371-54354393 ATATGATTGGACAAAAGTTATGG + Intergenic
1111698400 13:91655256-91655278 GTATGCTAGGACAATTCTTAGGG + Intronic
1114017365 14:18443245-18443267 ATACACTAGGAGAAGTGTTCTGG + Intergenic
1115197849 14:30821151-30821173 ATATACTGGGTCAAGTGTTAAGG - Intergenic
1119749826 14:77069212-77069234 ATATACTAGGACATGTTTTCAGG - Intergenic
1119980400 14:79074396-79074418 ATATGCTAGTAAAATAGTTAAGG + Intronic
1123961137 15:25402349-25402371 ATCTGCAAGGACCAGTGTGAAGG + Intronic
1126339655 15:47625249-47625271 ATATGCTATGATAATTGTTAAGG + Intronic
1130327400 15:82891725-82891747 CTGTGATAGGACAAGAGTTATGG + Intronic
1130805526 15:87317269-87317291 AAATGCTAAGATAAGTGTTCAGG - Intergenic
1130877801 15:88029360-88029382 ACATGCTAGGAAAAATGCTATGG + Intronic
1136718696 16:32303335-32303357 ATATGCCAGGACCAGGGCTAGGG + Intergenic
1136837067 16:33509599-33509621 ATATGCCAGGACCAGGGCTAGGG + Intergenic
1139291566 16:65863255-65863277 AAATGCTAGGAGACTTGTTAGGG + Intergenic
1141397511 16:83718075-83718097 AGATGCTGAGACAAGGGTTAGGG + Intronic
1142303804 16:89274531-89274553 AACTGCATGGACAAGTGTTACGG + Intronic
1203007735 16_KI270728v1_random:214436-214458 ATATGCCAGGACCAGGGCTAGGG - Intergenic
1203123754 16_KI270728v1_random:1559391-1559413 ATATGCCAGGACCAGGGCTAGGG - Intergenic
1203147244 16_KI270728v1_random:1809878-1809900 ATATGCCAGGACCAGGGCTAGGG + Intergenic
1147203318 17:38818725-38818747 ATATTGTAGGACATGTGATAGGG + Intronic
1150938661 17:69665597-69665619 ATATGCTAAGACTTGTTTTATGG - Intergenic
1154378049 18:13825071-13825093 AAGTGTCAGGACAAGTGTTAGGG + Intronic
1157912357 18:51628895-51628917 ATATACTAGTGCAAATGTTAGGG - Intergenic
1165664469 19:37615414-37615436 ATATTCTACGACAACTGTGATGG - Intronic
926738929 2:16095015-16095037 ATATGCTAGCTCAAGCGTGAAGG - Intergenic
929691064 2:44073941-44073963 ATATGCTAGGCCAGGTGTAGTGG + Intergenic
933554283 2:83812265-83812287 ATATACTAGGTCAAGTTTTAAGG - Intergenic
933845894 2:86326962-86326984 ATTGGCTAGGCCAAGAGTTAAGG - Intronic
944290273 2:197996957-197996979 TTTTGCTTGGACAAGTGTTGAGG + Intronic
944582368 2:201142884-201142906 ATATGCTAGGCCAAGTGCAGTGG - Intronic
945416172 2:209575837-209575859 TTATGCTATGATAAGTGCTATGG + Intronic
946572068 2:221035273-221035295 ATGGGCAATGACAAGTGTTATGG - Intergenic
1171027407 20:21643601-21643623 ACATGCAAGGACAAGTTTTTTGG + Intergenic
1174887114 20:54348100-54348122 ATATTGTAGGATAAATGTTAAGG + Intergenic
1177446940 21:21209924-21209946 ATGTGCTTGGACAAGTTTTCCGG - Intronic
1180441869 22:15374114-15374136 ATACACTAGGAGAAGTGTTCTGG + Intergenic
1182190421 22:28454298-28454320 ATATGCTAGGAAATGTTTTAAGG - Intronic
955097172 3:55810745-55810767 ATATTCTAGGCCAAGTGTGGTGG - Intronic
957258902 3:77874976-77874998 ATATTTTATGGCAAGTGTTAGGG + Intergenic
962811095 3:138960294-138960316 AGAATCTAGGACAAATGTTAGGG + Intergenic
963537901 3:146551214-146551236 ATATGGGAGAACAAGTCTTAAGG + Intergenic
965473296 3:169121915-169121937 AAATGCTAGGAAATGTGTTTTGG + Intronic
965894544 3:173559261-173559283 ATATGCTAAAACAAATGTTTGGG - Intronic
973306172 4:48653100-48653122 ATATGTTAGGAAGAGAGTTACGG + Intronic
974310617 4:60205119-60205141 ATACACTATGCCAAGTGTTAGGG + Intergenic
978237901 4:106482244-106482266 ATATGATAGGAAAATTGTGAAGG + Intergenic
982225194 4:153158676-153158698 AAATGCTGGGACAAGTGGTGCGG + Intronic
984134467 4:175918039-175918061 ATATGTTAGGAAAAGAATTATGG - Intronic
984228377 4:177063604-177063626 ATATACTGGGTCCAGTGTTATGG + Intergenic
984535353 4:180968361-180968383 ATCTGCGAGGCCAAATGTTAAGG + Intergenic
990325263 5:54669297-54669319 ATATGGAAGGACTAGTGTTCAGG - Intergenic
995384211 5:111570660-111570682 ATATGCTATGATAAGGGTTAAGG - Intergenic
996621746 5:125513575-125513597 ATATGAAATTACAAGTGTTAAGG - Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
1001158048 5:169290153-169290175 ATATGCTAGGGCACATGCTAGGG + Intronic
1001158124 5:169290632-169290654 ATATGCTAGGGCAAATGCTAGGG + Intronic
1003408479 6:5842434-5842456 ATATCCTAGTACATGTGTTTTGG + Intergenic
1009758669 6:67975874-67975896 ATGTTCTAGGAAAAGTGTTAAGG + Intergenic
1014438943 6:121451557-121451579 AAATGATAAGACAAGTGGTAGGG + Intergenic
1014705447 6:124740844-124740866 ATATATTAGGAAAAGTTTTAAGG + Intronic
1015020608 6:128469467-128469489 ATATTCTAGCACAAGTGTTGAGG + Intronic
1016416772 6:143842109-143842131 ATATCCTAAGACAAGTTTTATGG + Intronic
1016487564 6:144558838-144558860 AAAGGCTATAACAAGTGTTATGG + Intronic
1021755371 7:23846258-23846280 AAATGAAAGAACAAGTGTTAAGG + Intergenic
1022149066 7:27580449-27580471 AAATGCTAGGAAAAGTTTTCAGG + Intronic
1023117232 7:36874454-36874476 ATATGCTAGGCCCTGTGCTAAGG - Intronic
1023296214 7:38717394-38717416 GTATGTTACCACAAGTGTTATGG - Intergenic
1026384115 7:69828743-69828765 AAATGCTAGCAGAAGTGATATGG - Intronic
1026506060 7:70984999-70985021 ATAAGGTAAGCCAAGTGTTAAGG - Intergenic
1030580263 7:111346310-111346332 ATAGCCCAGGACAAGGGTTAGGG - Intronic
1031650919 7:124288922-124288944 ATATGATAGAACAGGTGTTTGGG - Intergenic
1032822307 7:135535588-135535610 ATATGGTTTGACAAGTGATATGG + Intergenic
1039983067 8:42425426-42425448 ATATGAGAGAATAAGTGTTATGG + Intronic
1040966537 8:53087296-53087318 AAACGCTAGCACATGTGTTAAGG - Intergenic
1043821650 8:84873615-84873637 AAAGGCAAGGACAAGTGTTTTGG + Intronic
1046961118 8:120113996-120114018 ATATGCTAAGCCAGGTGCTAGGG + Intronic
1049489312 8:142885680-142885702 ATTTGCTAAGACCAGTGTCATGG + Intronic
1051304489 9:15694195-15694217 AGAGCCTAGGACAAGTCTTATGG - Intronic
1052651744 9:31312073-31312095 ATATGCTAAGAAAAGTCTGAAGG - Intergenic
1052870696 9:33503459-33503481 ATAGGCTAAGACAAAAGTTAAGG - Intergenic
1053475077 9:38376768-38376790 ATTTGCTGGGACAAGTGATGTGG - Intergenic
1057687824 9:97251903-97251925 ATAGGCTAAGACAAAAGTTAAGG + Intergenic
1058127494 9:101211622-101211644 ACATGCCAGGCCTAGTGTTAAGG - Intronic
1061787207 9:133036916-133036938 ATTTGCAAGGAAAAGGGTTATGG - Intronic
1186088278 X:6015093-6015115 ATATGATATCACAAGTGCTATGG - Intronic
1186152106 X:6686401-6686423 ATATGCCAGGAAATGTGTTACGG + Intergenic
1192080822 X:68046295-68046317 AAATGCTAGAAAAATTGTTAAGG - Exonic
1193869306 X:86777377-86777399 ATGTGCAGGGACAAGTGTGAAGG - Intronic
1194196004 X:90893591-90893613 AGATGCCAGGCCAAGTATTAGGG + Intergenic
1200541852 Y:4467772-4467794 AGATGCCAGGTCAAGTATTAGGG + Intergenic
1201520634 Y:14870045-14870067 ATATCCTATGTCAGGTGTTAAGG + Intergenic
1201728160 Y:17177167-17177189 ATATGATCTCACAAGTGTTATGG + Intergenic