ID: 905932645

View in Genome Browser
Species Human (GRCh38)
Location 1:41800443-41800465
Sequence GCCTGGTGCCAGCTCTTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 262}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905932645_905932647 -9 Left 905932645 1:41800443-41800465 CCAGCCAAGAGCTGGCACCAGGC 0: 1
1: 0
2: 1
3: 24
4: 262
Right 905932647 1:41800457-41800479 GCACCAGGCCCCTCGATGTGAGG 0: 1
1: 0
2: 0
3: 9
4: 120
905932645_905932648 -8 Left 905932645 1:41800443-41800465 CCAGCCAAGAGCTGGCACCAGGC 0: 1
1: 0
2: 1
3: 24
4: 262
Right 905932648 1:41800458-41800480 CACCAGGCCCCTCGATGTGAGGG 0: 1
1: 0
2: 0
3: 4
4: 84
905932645_905932654 4 Left 905932645 1:41800443-41800465 CCAGCCAAGAGCTGGCACCAGGC 0: 1
1: 0
2: 1
3: 24
4: 262
Right 905932654 1:41800470-41800492 CGATGTGAGGGAGGCTCTCTTGG 0: 1
1: 0
2: 0
3: 11
4: 175
905932645_905932650 -5 Left 905932645 1:41800443-41800465 CCAGCCAAGAGCTGGCACCAGGC 0: 1
1: 0
2: 1
3: 24
4: 262
Right 905932650 1:41800461-41800483 CAGGCCCCTCGATGTGAGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905932645 Original CRISPR GCCTGGTGCCAGCTCTTGGC TGG (reversed) Intronic
901528040 1:9836264-9836286 GCCTGGTGCCAGCGCTGGGCAGG + Intergenic
902333481 1:15742339-15742361 GCCTGGAGCCAGCTGCTGCCCGG - Intergenic
903666778 1:25012880-25012902 TCCTGGGGCCTGCTCTGGGCCGG + Intergenic
905119718 1:35672397-35672419 GCCGGGAGCCAGCTCGTGCCAGG + Intergenic
905270607 1:36785170-36785192 TCCTGGTGCCAGGGCTTGGTAGG + Intergenic
905309202 1:37037778-37037800 CCCTGGTGCCTGCTGGTGGCGGG - Intergenic
905534792 1:38712769-38712791 GCATGGGCCCAGCTTTTGGCTGG - Intergenic
905868605 1:41390369-41390391 GCCTCCTGCCAGCACTGGGCTGG + Intergenic
905932645 1:41800443-41800465 GCCTGGTGCCAGCTCTTGGCTGG - Intronic
906225598 1:44118993-44119015 GTCAGGTGCCAGCCCCTGGCAGG + Intronic
906475561 1:46167170-46167192 ACCCGGCGCCAGCGCTTGGCTGG - Intronic
906726627 1:48049014-48049036 GCCTGGTGCCCATTCTTGGAGGG - Intergenic
907263311 1:53238321-53238343 GCCTGGTCCCCGCTCCCGGCGGG + Intronic
908267640 1:62394920-62394942 CCCTGATCCCAGCTCTTGTCTGG + Intergenic
910837834 1:91533677-91533699 GCCTAGAACCAGCTCTTGGTCGG + Intergenic
912585162 1:110756676-110756698 AGCTGGTGCCTGCTGTTGGCTGG + Intergenic
913216470 1:116624861-116624883 GGCTGGAGCCAGCTCTGGACTGG - Intronic
914970303 1:152303654-152303676 GTCTCGTGCCTGCTCGTGGCGGG + Exonic
914970619 1:152305598-152305620 GTCTTGTGCCTGCTCATGGCGGG + Exonic
914970774 1:152306570-152306592 GTCTTGTGCCTGCTCATGGCGGG + Exonic
914971245 1:152309489-152309511 GTCTCGTGCCTGCTCGTGGCGGG + Exonic
915319448 1:155048188-155048210 TGCTGCTGCCAGCTCCTGGCTGG + Intronic
915907559 1:159889953-159889975 GCCTGGGGGCAGCTCTAGTCAGG + Intronic
920674688 1:208030809-208030831 TTTTGATGCCAGCTCTTGGCCGG + Intronic
920966771 1:210707539-210707561 GCCTGATTCGTGCTCTTGGCAGG + Intronic
921127356 1:212189459-212189481 GCCTCGGGGCAGCTGTTGGCAGG + Intergenic
923215563 1:231845298-231845320 TCCTGGTGCCAGCTCTGGACCGG + Intronic
924409075 1:243784573-243784595 GCCTGGTGCCAGAACTCGGAGGG - Intronic
1063470878 10:6283857-6283879 CCCTGGTGCCACCCCATGGCAGG + Intergenic
1066439835 10:35427899-35427921 GCCTGGTGGTGGCTCTTGGTGGG + Intronic
1069693735 10:70371893-70371915 GCCTGGCTCCAGCTCTAGCCAGG + Intronic
1070472945 10:76801846-76801868 CCCTGGGGCCACCTGTTGGCAGG + Intergenic
1070698391 10:78580164-78580186 GCCTGGAGCCAACTGCTGGCAGG + Intergenic
1072756279 10:98023291-98023313 TCCTTGTGCCAGCTCTGGGAAGG + Intronic
1073379811 10:103069535-103069557 GCCTGTGGCCGGCTCTTGTCTGG + Intronic
1074078147 10:110148099-110148121 AGTTGGTGCCAGCTGTTGGCGGG + Intergenic
1074111020 10:110423000-110423022 CCATGGGGCCAGCTCTTGCCAGG - Intergenic
1074123481 10:110510254-110510276 GCCTGCTGCCTCCCCTTGGCAGG - Exonic
1076256017 10:129025477-129025499 GCCTTTTGCCAGCCCCTGGCTGG - Intergenic
1076297623 10:129399076-129399098 GTGTGGTTCCAGCTTTTGGCTGG - Intergenic
1076546360 10:131248315-131248337 GACTGGACCCAGGTCTTGGCAGG + Intronic
1076723495 10:132402951-132402973 TCCTGGCGCCAGCACCTGGCTGG + Intronic
1077147112 11:1051257-1051279 GCCAGGTGCCACCTGCTGGCGGG + Intergenic
1079104880 11:17564160-17564182 GCCCTGTGCCAGCTCTGTGCTGG + Intronic
1082037873 11:47660272-47660294 ACCTGGAGCTGGCTCTTGGCTGG + Exonic
1083269842 11:61566464-61566486 GCCAGGTGCCAGCTCTGAGCTGG + Intronic
1084004788 11:66317057-66317079 GGCTGGCGGCAGCTCTTGACAGG + Intergenic
1084607530 11:70181195-70181217 GCATGGTGTCAACTTTTGGCGGG - Intronic
1085637020 11:78166764-78166786 TCCTGGTGCTAGCTCCTGGAAGG + Intergenic
1087818470 11:102685002-102685024 GCCTGCTTCCAGCTTCTGGCTGG + Intergenic
1088114041 11:106296287-106296309 TCCTGGTACCAGCTCCTGGAGGG + Intergenic
1089151854 11:116370556-116370578 GCCATGTGCCAGCTCTGGGCTGG + Intergenic
1089401348 11:118166398-118166420 GCCTGATGGCTGCTCTGGGCTGG + Exonic
1091085782 11:132720286-132720308 GGCTGTGGCCAGGTCTTGGCCGG - Intronic
1091762727 12:3097726-3097748 GCCTGGTAACAGCCATTGGCTGG + Intronic
1093483363 12:19627725-19627747 CCCTGGTGCCACCCCATGGCAGG + Intronic
1093720288 12:22434382-22434404 GCCTTGTTCCAGCTCTTAGGGGG - Intronic
1094219059 12:27974209-27974231 GCCAGATGCCTGCCCTTGGCTGG + Intergenic
1094228546 12:28075936-28075958 GCCTTGTGCCTGATCTTGGAGGG - Intergenic
1095623256 12:44283291-44283313 GCATGGTGCAAGCTCTTGGTGGG - Intronic
1095786119 12:46110323-46110345 GGCAAGTGCCACCTCTTGGCTGG + Intergenic
1095801067 12:46269815-46269837 GCCGGGGGCCAGCTCTTGGAGGG + Intronic
1098377230 12:69829890-69829912 GCCCAGTGCCAGCACTGGGCAGG - Intronic
1099725756 12:86425698-86425720 GGCTGGTGCAAGATTTTGGCTGG - Intronic
1102426000 12:112844939-112844961 GTTTGGTGCTAGCTGTTGGCTGG + Intronic
1102616779 12:114161594-114161616 GCCTGGTACCTGCTCTGTGCTGG + Intergenic
1103699894 12:122843624-122843646 TCCTGCTGCCAGCACTGGGCAGG + Intronic
1105541059 13:21317781-21317803 GCCTTGTGCCAGATCTTAGAGGG + Intergenic
1105559454 13:21476950-21476972 GCCTGGTGCCAGTGCCTGGGCGG + Intergenic
1105827727 13:24137296-24137318 GCCAGGGGCCTGCTCCTGGCTGG + Intronic
1111682272 13:91458414-91458436 GTCTTGTTCCAGCTCTTGGCGGG - Intronic
1112975567 13:105313645-105313667 GCCTGATGACTGCTGTTGGCTGG + Intergenic
1115793960 14:36911648-36911670 AGTTGGTGCCAGCTATTGGCTGG - Intronic
1118320121 14:64748049-64748071 TCCTGGCCCCAGGTCTTGGCGGG - Exonic
1120626335 14:86831568-86831590 TCCTGGTGGCAGCTATAGGCAGG - Intergenic
1121097989 14:91231214-91231236 GCATGGTGCCAGCATCTGGCAGG + Intergenic
1121520773 14:94584829-94584851 GGCTGGTTCCAACCCTTGGCAGG + Intronic
1121698133 14:95929331-95929353 CCCTGCTTCCTGCTCTTGGCTGG - Intergenic
1122625931 14:103085349-103085371 GGCTGGTGCCAACTCCTGCCAGG + Intergenic
1122956820 14:105075062-105075084 GCTGGGTGCCAGGTCTGGGCGGG + Intergenic
1123042754 14:105497073-105497095 GCCGGGGGGCAGCTCTTGCCTGG + Intronic
1123110257 14:105863891-105863913 GCGGGGTGCCAGTTCTTGCCTGG - Intergenic
1124218734 15:27831599-27831621 GCTGGGTGCCCACTCTTGGCTGG - Intronic
1126583574 15:50262405-50262427 GCCATGTGCCAGCTCTGTGCTGG - Intronic
1126670047 15:51107847-51107869 GGCTGGTGCTGGCTGTTGGCTGG - Intergenic
1128805305 15:70526502-70526524 GCCTGATGCCAGTTCCAGGCAGG - Intergenic
1129030334 15:72612841-72612863 GCCTGGCACCAGCTCTGGCCAGG - Intergenic
1129235558 15:74221868-74221890 GCCTCCTGTCACCTCTTGGCAGG + Intergenic
1129252881 15:74318487-74318509 GCCTGCTTCCAGCTCAGGGCTGG + Intronic
1129469085 15:75740374-75740396 GCCTGGCACCAGCTCTGGCCAGG - Intergenic
1129672166 15:77613423-77613445 GCCTGGGCCCAGCTCCGGGCTGG - Exonic
1129955569 15:79633764-79633786 GCCCGGTGGCAGCAGTTGGCTGG - Intergenic
1132113461 15:99118963-99118985 GCCTGGTGCCAGCTGCAGGCAGG - Intronic
1132185907 15:99801479-99801501 GCCTGGCGCAAGCTCTGGCCAGG - Intergenic
1132429771 15:101751219-101751241 GCCTGGCGCAAGCTCTGGCCAGG + Intergenic
1132569917 16:639830-639852 GCCTGGGCACAGCTCTTGGTGGG + Intronic
1132671033 16:1102448-1102470 GCCAGGAGCCAGCTTCTGGCAGG - Intergenic
1132694193 16:1194769-1194791 GCCTGGGGCCTGCGCCTGGCCGG - Intronic
1132838607 16:1967243-1967265 GCCAGGTGTCAGCACCTGGCTGG - Intronic
1137601973 16:49762410-49762432 GCCTGTGGCCAGCCCTTCGCAGG + Intronic
1137775185 16:51048339-51048361 TCCTGGTTCTAGCTCTAGGCAGG - Intergenic
1138380864 16:56601428-56601450 GCCTCCTTCCAGCTCCTGGCAGG + Intergenic
1138584281 16:57960329-57960351 GCCTGGAGCAGGCTGTTGGCGGG - Intronic
1138597320 16:58035916-58035938 GCCGGGTGCCAGGGCTGGGCTGG + Intronic
1139327277 16:66162180-66162202 CCCTGGTGCCACCCCATGGCGGG + Intergenic
1139420591 16:66847238-66847260 GCCAGGTGCCAGGCTTTGGCAGG - Intronic
1139435059 16:66932145-66932167 TCCTGGTCCCAGCTCCTGCCAGG - Exonic
1139798672 16:69503552-69503574 AGTTGGTGCCAGCTATTGGCTGG - Intergenic
1140471621 16:75218712-75218734 GCCTGGTGCCGTCTCCTGGCAGG + Intergenic
1141223353 16:82091914-82091936 CCCTGGTGCCTGCTCTGAGCGGG + Intronic
1142159935 16:88552150-88552172 GACAGGTGCCAGCTCTGGACTGG + Intergenic
1142167787 16:88602087-88602109 TCCTGGTGCGTGCTGTTGGCAGG + Intronic
1142200955 16:88760947-88760969 GCCTGGTGGCTGCTGTGGGCTGG + Intronic
1142276044 16:89119397-89119419 ACCTGGTGCCAGGTCTGGGGAGG + Intronic
1142375447 16:89704621-89704643 GGTTGGTGCCAGCTGTCGGCTGG - Intergenic
1143028930 17:3956692-3956714 GCCTGCTGCCAGCACTCAGCAGG + Intronic
1143421892 17:6799909-6799931 GCCTGCTGCAACCTCTTGGCTGG - Exonic
1145013091 17:19380978-19381000 GCCCGGCGCCAGCTCTTCCCAGG + Exonic
1145390248 17:22450146-22450168 TTCTGGTGCCACCTCTGGGCTGG - Intergenic
1147381735 17:40060331-40060353 GACTGGTGACAGGTCTGGGCAGG - Intronic
1148002786 17:44399670-44399692 GTTTGGTGCCTGCTCTTCGCTGG + Exonic
1148148834 17:45384177-45384199 GCCTGGTGCCAGCACATGTTCGG - Intergenic
1148238876 17:45986807-45986829 GCCTGCTGCCCCCTCTTGCCAGG + Intronic
1148683204 17:49486375-49486397 GTCTGGCCCCAGCCCTTGGCAGG - Intergenic
1148759045 17:49989960-49989982 GGCTGGTGGCAGCTCTTGTGGGG - Intergenic
1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG + Intronic
1151800078 17:76373878-76373900 GCCTCCTTTCAGCTCTTGGCAGG - Intronic
1152244293 17:79177167-79177189 GCCTTGGGCCAGCTCTGGGGAGG - Intronic
1152905781 17:82970211-82970233 ACCTGGTGCCAGTTCCAGGCAGG + Intronic
1153820247 18:8825934-8825956 GCCTGGGCCCAGCTCTGGTCGGG - Exonic
1157284682 18:46369619-46369641 GCCTGGAGACAGCTCCTTGCTGG + Intronic
1158458873 18:57630429-57630451 GCCTGGGGACAGCTCCTGGAAGG - Intergenic
1158920783 18:62188212-62188234 GCCTGCTTCCAACCCTTGGCTGG + Intronic
1160190510 18:76710924-76710946 GACAGATGCCTGCTCTTGGCAGG + Intergenic
1160499263 18:79394341-79394363 GCCTGGGGCCAGGATTTGGCGGG - Intergenic
1161030121 19:2054146-2054168 GTCTGGTGCCTGAGCTTGGCTGG - Intergenic
1161041369 19:2112326-2112348 GCCTGGTTCCTGTTCGTGGCCGG - Intronic
1161231936 19:3178827-3178849 GCCGGCCGCCAGCTGTTGGCAGG - Exonic
1161482685 19:4518647-4518669 GCCTGATGCAAGCTGTGGGCAGG - Intergenic
1161659634 19:5538045-5538067 CCCTGGTGTCAGTTGTTGGCGGG - Intergenic
1162084197 19:8238587-8238609 GCCTGGTGCCTGCTGTGGGAAGG - Intronic
1162503202 19:11066515-11066537 ACCTGGTGACAGCTGCTGGCTGG + Intergenic
1162796894 19:13091738-13091760 GCCTGGTGCCAGCCCAGAGCTGG - Intronic
1162939439 19:13999623-13999645 GCCTGCTGCCTGTTTTTGGCTGG - Intronic
1165901592 19:39171948-39171970 GCCTAGTGCATGCTCTGGGCAGG - Intronic
1166727029 19:45034611-45034633 GCCTTGTGGCTGCTCTTGGAGGG - Intronic
1167033579 19:46979415-46979437 GCAGGGTGTCAGCTCTAGGCTGG + Intronic
1167506262 19:49872699-49872721 TCCTGGGGCCAGCTCTGTGCTGG - Intronic
927454033 2:23233879-23233901 GCCTGTCGCCAGCTCTCAGCAGG + Intergenic
927827331 2:26317758-26317780 GCCTGGTTCCTGGTCTTGGGTGG - Intronic
930094957 2:47559997-47560019 GCTTGGTGCAAGGTCTAGGCAGG + Intronic
931463762 2:62469613-62469635 GCCTGTTGCCAGGTGTTGGGAGG + Intergenic
932359809 2:71094911-71094933 GCCTGGTGCCAGGTCTGAGAGGG + Intergenic
932471635 2:71963090-71963112 GCCCGGGGCCAGAACTTGGCTGG - Intergenic
932701886 2:73997731-73997753 GCCTGGGACTAGCTCTTTGCTGG + Intronic
935403242 2:102682232-102682254 GCTTGGTGACAGCTCATGGTAGG - Intronic
937650540 2:124314170-124314192 GCATGTTGCCAGCTCTAGGCCGG - Intronic
937923076 2:127146113-127146135 GCCTGGGACCAGCCCTGGGCAGG + Intergenic
938144213 2:128820621-128820643 GCCTGGTGCCCAGGCTTGGCTGG + Intergenic
938919130 2:135977057-135977079 TCCTGTTGTCAGCTCTTGGAAGG - Intronic
939194044 2:138950375-138950397 GCATTGTGCCAGGTCCTGGCTGG - Intergenic
941124690 2:161571065-161571087 GAATGGTGCCAGCTGTGGGCTGG + Intronic
943714801 2:191139171-191139193 GCCTTGTTCCAGCTCTCGGGGGG - Intronic
947636666 2:231683774-231683796 GCCTGCTCCCAGCTCCTTGCGGG - Intergenic
948221053 2:236270034-236270056 GCATGGTGCAAGCTGTTGGTGGG - Intergenic
948309387 2:236973715-236973737 GCCTGTTTCCAGCTTCTGGCCGG + Intergenic
948487796 2:238291728-238291750 GCATGGTGGCAGCTCCTGGCAGG + Intergenic
948610551 2:239163706-239163728 GCATGGAGCCAGCTCTTCACCGG - Intronic
948678114 2:239611004-239611026 GGCTGCTTCCAGCTCTTGACTGG + Intergenic
948800574 2:240431610-240431632 AACAGGTGCCAGCTCTTGGAGGG + Intergenic
1168971721 20:1935819-1935841 GCCAGGTGCCAGCCCTGGCCAGG + Intronic
1169039396 20:2480573-2480595 GCATGGTGCCAGCACCTGGTGGG - Intronic
1169088307 20:2840713-2840735 GCCTGGAGCCCGCTCTAGGTGGG + Exonic
1171330950 20:24338528-24338550 GCATGGTGGCAGCACTTGGGAGG + Intergenic
1172092838 20:32446074-32446096 GGCTTCTGCCAGCTCTGGGCAGG + Exonic
1172956713 20:38765119-38765141 TGATGGTGCCAGCTCATGGCTGG - Intronic
1173478383 20:43379759-43379781 CCTTGGTGCTAGCTGTTGGCTGG + Intergenic
1173691338 20:44963460-44963482 GGTTGGTGCTAGCTGTTGGCTGG - Intergenic
1174675210 20:52347196-52347218 TGCTGGTGCTGGCTCTTGGCAGG + Intergenic
1175340259 20:58224504-58224526 GTCTGGTGCCAGCACTGGGGTGG - Intronic
1175397763 20:58678698-58678720 GCCAGGGGCCAGCTCCAGGCTGG - Exonic
1175998377 20:62821363-62821385 TCCTGGTGCCCTCTCTGGGCTGG + Intronic
1178160304 21:29904736-29904758 TCCTGGTTCCAGCCCTTGGTAGG - Intronic
1180252347 21:46597709-46597731 TCCTGGTGCATGCTCTGGGCTGG - Intergenic
1180817816 22:18803234-18803256 GGCTGGAGCCAGCTCTGGACTGG - Intergenic
1181204031 22:21237687-21237709 GGCTGGAGCCAGCTCTGGACTGG - Intergenic
1181265410 22:21628327-21628349 TCCAGGTCCCAGCTCTGGGCTGG + Exonic
1181477211 22:23176129-23176151 GCCTGATGCCTGCTCATGGATGG + Intergenic
1181635378 22:24172008-24172030 GCCTGGGCCCAGCTCTGGACTGG - Intronic
1182070826 22:27462533-27462555 TCCTGGTTCCTGGTCTTGGCAGG + Intergenic
1183548424 22:38467750-38467772 CACTGGTGCCAGCGCTTGGCAGG - Intergenic
1183949640 22:41345731-41345753 CCCTGCTGCCAGGACTTGGCAGG - Intronic
1184221261 22:43101445-43101467 GCCTTGAGCCTGCTCCTGGCAGG + Intergenic
1184289828 22:43492690-43492712 TCCTGGAGCCTGCTCATGGCTGG + Intronic
1203222890 22_KI270731v1_random:57728-57750 GGCTGGAGCCAGCTCTGGACTGG + Intergenic
1203267939 22_KI270734v1_random:29085-29107 GGCTGGAGCCAGCTCTGGACTGG - Intergenic
949566941 3:5253762-5253784 CCCTGGTGCCTGCACATGGCTGG - Intergenic
949987439 3:9552273-9552295 GCCTGGATGCAGCTCTTGGCAGG - Exonic
951778768 3:26340083-26340105 TCCTGGTGCTAGCACTTGGAGGG + Intergenic
953869767 3:46616137-46616159 GCCAGGTGCCAGCTTGTGGAAGG + Intronic
953904678 3:46862539-46862561 GCCTGCTCCCTGTTCTTGGCTGG - Intronic
954666507 3:52256482-52256504 GCCTAGAACCAGCTCTTGGTTGG + Exonic
955045068 3:55351977-55351999 GGCTGGGGTCAGATCTTGGCTGG + Intergenic
955394302 3:58546442-58546464 GCCTTGTTCCAGTTCTTAGCGGG + Intergenic
959408079 3:105986253-105986275 GCCTGGTGCCAGGTCTGAGAGGG + Intergenic
959973455 3:112432251-112432273 GCATGGTGCAAGCTGTTGGTGGG - Intergenic
960047535 3:113212158-113212180 GCCGGGTCCCAGCGCTCGGCCGG + Intronic
961336807 3:126185273-126185295 GGCTGGTGCCAGCACCTGGCTGG + Intronic
961358300 3:126352396-126352418 GCCTGCAGCCAGCTCTCAGCTGG - Exonic
961362100 3:126374524-126374546 GTCATGTGCCAGCTCTTGTCGGG + Intergenic
961667609 3:128503473-128503495 GCCTGGTCCTAGCTCTCGCCTGG + Intergenic
962875501 3:139533157-139533179 GCCGGGTGCCTGATCTGGGCAGG + Intronic
962951455 3:140223425-140223447 GCTTGTTGCCAGCCCTTGGAGGG + Intronic
963017588 3:140840552-140840574 GCTTGGTGCAAGCGGTTGGCTGG + Intergenic
965403984 3:168248746-168248768 GCCCGGTGCCAGCTGTTGTCTGG - Intergenic
965702388 3:171471289-171471311 GCCTGGTACTGGCTCTTGGGTGG + Intergenic
968868009 4:3226164-3226186 CCCTGGGGCCAGCTCTTGGGGGG + Intronic
969057006 4:4408353-4408375 GCCAGGTGCCAGCACGTGGCAGG - Intronic
969081115 4:4618989-4619011 AGCTGGTGCTGGCTCTTGGCTGG + Intergenic
969378142 4:6776648-6776670 ACCTGGTGCTTGCTCTAGGCAGG + Intergenic
972816950 4:42656153-42656175 ACCTGGGGCCAGCTCTTGAATGG - Intronic
975320998 4:73010854-73010876 GCCTGGGGCCAGGTCATGCCTGG - Intergenic
976225260 4:82790687-82790709 GGATGGTGCCAGCGCTTGGCAGG + Intronic
976848727 4:89520160-89520182 CCCTGGTGACAGCACTTGGGTGG - Intergenic
985694286 5:1331226-1331248 CACTGGTCCCAGATCTTGGCAGG + Intronic
987469605 5:18311438-18311460 GCCTAGGTTCAGCTCTTGGCTGG + Intergenic
989208993 5:38841544-38841566 CCCTGGTGTCACCTCATGGCAGG + Intergenic
989576366 5:42992090-42992112 GCCTGGTGCCCGCGCTTGCCGGG + Intergenic
994399108 5:99256870-99256892 GCCTGGGGCAAGCTCTTAGCAGG - Intergenic
994754631 5:103779091-103779113 GGCTGGTGCAGGCTCTTGGTGGG - Intergenic
995560471 5:113375654-113375676 GCTTGGTGCTGGCTGTTGGCTGG + Intronic
997736437 5:136215926-136215948 GCCTGCTGCCAGCTCTGAGGTGG + Intronic
998136517 5:139677017-139677039 CCCTGGTCCCAGCTCCCGGCTGG + Intronic
1001330609 5:170759917-170759939 ACCTGGAGCCAGGTCTTCGCAGG - Intergenic
1002779974 6:358420-358442 GCCTGGCACCAGGTCCTGGCAGG + Intergenic
1003234428 6:4282994-4283016 ACCTGGAGCCAGCTTATGGCAGG - Intergenic
1003667918 6:8128761-8128783 GCCTGGTGCCAGTCCTTTTCAGG - Intergenic
1005311555 6:24564080-24564102 GGCTGGCTCCAGCTCTTGGCTGG - Intronic
1006418564 6:33919525-33919547 GCCTGTTGCCCCCTCTAGGCTGG - Intergenic
1006674866 6:35755263-35755285 AGTTGGTGCCAGCTGTTGGCAGG + Intergenic
1009361956 6:62825666-62825688 GCCTGGTCCCAGCTCTAGTACGG + Intergenic
1010435714 6:75827709-75827731 GCACAGTGCCAGCTCATGGCAGG - Intronic
1010441265 6:75897513-75897535 TCAGGGTCCCAGCTCTTGGCAGG + Intronic
1011555720 6:88569968-88569990 GCATGGTGCAAGCTGTTGGTGGG + Intergenic
1013477325 6:110521106-110521128 GCCTAGTGCCGGCTCTCAGCCGG + Intergenic
1014693236 6:124587604-124587626 GCCTGGGGCCAGCTCTTGTTGGG - Intronic
1018841920 6:167523580-167523602 GCCAGTTGCCAGCACATGGCCGG + Intergenic
1018864613 6:167737081-167737103 GTCTGGTGCCAGCACCTGCCTGG + Intergenic
1019084972 6:169467243-169467265 GCATGGTGCAAGCTGTTGGTGGG + Intronic
1021275665 7:18647917-18647939 GCCTGGTGGCTGCTGTTGGGTGG - Exonic
1024465333 7:49706257-49706279 GCATGGTGTCAGTACTTGGCAGG - Intergenic
1024968008 7:55042360-55042382 GCCTTGTGCCAGCTCTGGGAAGG - Intronic
1025638995 7:63349891-63349913 GGCTGGTGCCAGCGCTCGTCCGG + Intergenic
1025643704 7:63398201-63398223 GGCTGGTGCCAGCGCTCGTCCGG - Intergenic
1028770940 7:94620847-94620869 GCCTGGCAGCAGCTCTTGGATGG - Intronic
1029452478 7:100648871-100648893 GCCTGGGCCCAGATCTTGTCTGG + Intronic
1033173317 7:139102796-139102818 GCCTGGTCCCAGCTACTGGGAGG + Intronic
1034276590 7:149826517-149826539 GCCTGGTGCCATCTGTGTGCAGG + Intergenic
1034875905 7:154724635-154724657 GCCAGGAGCCAGCTCCTGGAGGG - Intronic
1038311780 8:26450304-26450326 GCCTCGTACCTGCACTTGGCAGG - Intronic
1042865033 8:73349473-73349495 GCCTGTTGCCAGATCCTGCCAGG + Intergenic
1044844456 8:96366544-96366566 CCCTGGTGTCACCTCATGGCAGG + Intergenic
1049252299 8:141595799-141595821 GCCCTGTGCCTGCTCTGGGCCGG - Intergenic
1049487467 8:142874071-142874093 GCCTGGAGCCAGCACTGGGAGGG + Exonic
1049545912 8:143230456-143230478 GCCTGGACCCAGCTCCCGGCTGG + Intergenic
1051565263 9:18490176-18490198 GCCTGCTTCCAGCTCTGGCCAGG - Intronic
1055317311 9:75047113-75047135 AGCTGGTGCTGGCTCTTGGCAGG + Intergenic
1056966976 9:91171380-91171402 GCCTTGTTCCAGTTCTTGGAGGG - Intergenic
1057390525 9:94638809-94638831 GCCAGGTGCCCACACTTGGCCGG + Intronic
1057880786 9:98791331-98791353 GCCTGCTGCCACCTGCTGGCAGG + Intronic
1058800568 9:108541076-108541098 GCCTGGTGCCATGTGGTGGCTGG + Intergenic
1060020924 9:120130426-120130448 GGCTGGTGCTGGCTGTTGGCTGG + Intergenic
1061619302 9:131801078-131801100 AGCTGGTGCCATCTATTGGCTGG - Intergenic
1061853653 9:133429771-133429793 ACCAGGAGCCGGCTCTTGGCTGG - Intronic
1062017768 9:134300014-134300036 GACTGGTGCTGGCTGTTGGCAGG + Intergenic
1062267586 9:135694387-135694409 TGCTGGTCCCAGCTCGTGGCCGG - Exonic
1062370695 9:136237191-136237213 ACCTGGAGCCTGCTCTGGGCCGG + Intronic
1062370728 9:136237318-136237340 ACCTGGAGCCTGCTCTGGGCCGG + Intronic
1062370828 9:136237699-136237721 ACCTGGAGCCTGCTCTGGGCCGG + Intronic
1062499990 9:136848190-136848212 GCCAGGTGTCAGCTCTGGCCAGG - Exonic
1185923486 X:4120567-4120589 GCCTGGTCCAAGCTCCTGGAGGG + Intergenic
1186211038 X:7251114-7251136 GAGGGGTGCAAGCTCTTGGCTGG + Intronic
1186705232 X:12133742-12133764 AGCTGCTGCCAGCTCTTGCCTGG + Intergenic
1187495981 X:19796248-19796270 GCCTGGTTTCTGATCTTGGCTGG + Intronic
1190456408 X:50632387-50632409 CCCTGATGCCATCTTTTGGCCGG - Intronic
1192123419 X:68477707-68477729 GGCTGGTGCCGGCTCCTGGGGGG + Intergenic
1193417392 X:81241080-81241102 TCCTGGTGCCTGCTCTTGGGTGG + Intronic
1199420385 X:147637413-147637435 TCATGGTGCAAGCTCTTGGTGGG - Intergenic