ID: 905933573

View in Genome Browser
Species Human (GRCh38)
Location 1:41806687-41806709
Sequence TGCCCACTGGAGTGCCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 193}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905933573_905933588 24 Left 905933573 1:41806687-41806709 CCTCTGTGGCACTCCAGTGGGCA 0: 1
1: 0
2: 1
3: 19
4: 193
Right 905933588 1:41806734-41806756 CGGGGCCAGCGGGACCACTCAGG 0: 1
1: 0
2: 0
3: 10
4: 84
905933573_905933582 5 Left 905933573 1:41806687-41806709 CCTCTGTGGCACTCCAGTGGGCA 0: 1
1: 0
2: 1
3: 19
4: 193
Right 905933582 1:41806715-41806737 GCCTTGGAAGGCGCAGGGCCGGG 0: 1
1: 0
2: 8
3: 36
4: 379
905933573_905933584 6 Left 905933573 1:41806687-41806709 CCTCTGTGGCACTCCAGTGGGCA 0: 1
1: 0
2: 1
3: 19
4: 193
Right 905933584 1:41806716-41806738 CCTTGGAAGGCGCAGGGCCGGGG 0: 1
1: 0
2: 3
3: 21
4: 257
905933573_905933586 14 Left 905933573 1:41806687-41806709 CCTCTGTGGCACTCCAGTGGGCA 0: 1
1: 0
2: 1
3: 19
4: 193
Right 905933586 1:41806724-41806746 GGCGCAGGGCCGGGGCCAGCGGG 0: 1
1: 2
2: 2
3: 105
4: 770
905933573_905933585 13 Left 905933573 1:41806687-41806709 CCTCTGTGGCACTCCAGTGGGCA 0: 1
1: 0
2: 1
3: 19
4: 193
Right 905933585 1:41806723-41806745 AGGCGCAGGGCCGGGGCCAGCGG 0: 1
1: 0
2: 10
3: 94
4: 909
905933573_905933579 -1 Left 905933573 1:41806687-41806709 CCTCTGTGGCACTCCAGTGGGCA 0: 1
1: 0
2: 1
3: 19
4: 193
Right 905933579 1:41806709-41806731 AAGGAGGCCTTGGAAGGCGCAGG 0: 1
1: 0
2: 1
3: 26
4: 272
905933573_905933580 0 Left 905933573 1:41806687-41806709 CCTCTGTGGCACTCCAGTGGGCA 0: 1
1: 0
2: 1
3: 19
4: 193
Right 905933580 1:41806710-41806732 AGGAGGCCTTGGAAGGCGCAGGG 0: 1
1: 0
2: 4
3: 35
4: 318
905933573_905933578 -7 Left 905933573 1:41806687-41806709 CCTCTGTGGCACTCCAGTGGGCA 0: 1
1: 0
2: 1
3: 19
4: 193
Right 905933578 1:41806703-41806725 GTGGGCAAGGAGGCCTTGGAAGG 0: 1
1: 0
2: 3
3: 42
4: 325
905933573_905933581 4 Left 905933573 1:41806687-41806709 CCTCTGTGGCACTCCAGTGGGCA 0: 1
1: 0
2: 1
3: 19
4: 193
Right 905933581 1:41806714-41806736 GGCCTTGGAAGGCGCAGGGCCGG 0: 1
1: 0
2: 2
3: 42
4: 457

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905933573 Original CRISPR TGCCCACTGGAGTGCCACAG AGG (reversed) Intronic
900486606 1:2925561-2925583 TGCACCCTGGAATCCCACAGGGG + Intergenic
900809480 1:4790511-4790533 AGCCCGCTGGCGTGCCAGAGGGG + Exonic
902251770 1:15158273-15158295 GGCCCTCTGGACTCCCACAGTGG - Intronic
902794296 1:18791061-18791083 TGCCAACTGGAGCTCCTCAGTGG - Intergenic
903060240 1:20664114-20664136 TGCCCCATGGGGTGGCACAGGGG - Exonic
903126580 1:21252381-21252403 AGCTCACTGGTGTGCCCCAGAGG - Intronic
903328213 1:22583391-22583413 TGCCGACTGGTGAGCCACAGCGG + Intronic
905933573 1:41806687-41806709 TGCCCACTGGAGTGCCACAGAGG - Intronic
905992686 1:42353078-42353100 TGCCCCCTGGGGAGCCCCAGGGG + Intergenic
913541263 1:119822858-119822880 GGCCCACTTGAGAGCCACACGGG - Intergenic
913668829 1:121075538-121075560 TGCCCACTGCTGAGTCACAGAGG - Intergenic
914020574 1:143862971-143862993 TGCCCACTGCTGAGTCACAGAGG - Intergenic
914659072 1:149770889-149770911 TGCCCACTGCTGAGTCACAGAGG - Intergenic
915008071 1:152658912-152658934 TGTGCACTGGAGTGGCACTGCGG + Intergenic
915010606 1:152682503-152682525 TGTGCACTGGAGTGGCACTGTGG + Intergenic
918697423 1:187560919-187560941 GGCCCACCTGAGTGCCACTGGGG - Intergenic
918727819 1:187947961-187947983 TGCACACTGCAAAGCCACAGGGG + Intergenic
920035282 1:203061267-203061289 GGGCCACTGGTGTGCTACAGCGG + Intronic
921530060 1:216271110-216271132 TGAGCACAGGAGTGACACAGAGG - Intronic
923305644 1:232685791-232685813 TTCCCATTGGAGTGCTTCAGTGG - Intergenic
924382346 1:243475925-243475947 TGCCCAGTTGTGTGCCACTGTGG - Intronic
924600411 1:245483620-245483642 TGCCCACTGGAATGGGACCGTGG - Intronic
1064455768 10:15486166-15486188 TGGCCATTGCAGTGACACAGTGG - Intergenic
1065958188 10:30711249-30711271 TCCCCACTGCTGTGTCACAGGGG - Intergenic
1067755238 10:49000135-49000157 AGCCCACTGCAGTGGCAGAGGGG + Intergenic
1067971004 10:50970855-50970877 TAGGCACTGTAGTGCCACAGAGG - Intergenic
1069047789 10:63761482-63761504 TGACCTCTAGAGAGCCACAGGGG + Intergenic
1069967100 10:72129119-72129141 AGCCCACTGGAGTTGCACATGGG + Intronic
1071905599 10:90170158-90170180 TACCCACTGGAGTTCCCAAGGGG + Intergenic
1072963458 10:99951504-99951526 TGTACCCTGGAGAGCCACAGGGG + Intronic
1076878300 10:133227630-133227652 TGTGCACTGCAGTGCCACTGTGG + Intergenic
1077390543 11:2298918-2298940 TGCCCACTGGAGTTGGCCAGCGG + Intronic
1078404920 11:11062106-11062128 TGCTCACTGGAGTGGGGCAGGGG + Intergenic
1078722368 11:13896893-13896915 TCCCCACTGAAGAGCCAGAGAGG - Intergenic
1079935351 11:26609192-26609214 GGCCCACCTGAGAGCCACAGGGG - Intronic
1080158166 11:29137803-29137825 TGAGCACTGGAGTGCCAAAGGGG + Intergenic
1081118812 11:39238271-39238293 TGCACACAGGAGTGCCAGAAAGG - Intergenic
1081455039 11:43212801-43212823 GGCCCACTTGAGAGCCACACGGG - Intergenic
1083330449 11:61895865-61895887 GGCACACAGAAGTGCCACAGAGG - Intergenic
1083912625 11:65719190-65719212 TGCCCACTGCAGTGCCAAGACGG + Exonic
1085600807 11:77854630-77854652 TGCACCCTGCAGAGCCACAGAGG - Intronic
1093656073 12:21695187-21695209 TGCTCACGGGAGTGGGACAGTGG + Intronic
1094170499 12:27486253-27486275 TGCCCAGCAGAGTGCCAAAGAGG - Intronic
1094236432 12:28172623-28172645 TGCCCTCTGGTGAGCCACATGGG + Intronic
1094471299 12:30804150-30804172 TGACCCCTGGAAAGCCACAGGGG - Intergenic
1095041178 12:37442503-37442525 GTCCCCCTGCAGTGCCACAGGGG - Intergenic
1096535871 12:52274384-52274406 TGGGCACTGGGGAGCCACAGAGG - Intronic
1098694602 12:73537369-73537391 AGCCCACCTGAGAGCCACAGGGG + Intergenic
1103250511 12:119496027-119496049 TGTCCACTGGAGTACCACAGTGG - Intronic
1105396806 13:20043898-20043920 TGACCACTGGAGACCCCCAGTGG - Intronic
1105668793 13:22589301-22589323 TGCTGACTGGGGAGCCACAGTGG - Intergenic
1106614779 13:31316301-31316323 TGTCCCCTGCAGAGCCACAGGGG + Intronic
1106754816 13:32811924-32811946 TGCCCACTGGAGTGTCCCCCAGG - Intergenic
1107488903 13:40860654-40860676 TGGTCACTGGAATGCCACAAAGG + Intergenic
1108815741 13:54287564-54287586 GGCCCACTTGAGAGCCACACGGG - Intergenic
1108979451 13:56492126-56492148 TGCACCCTGAAGAGCCACAGGGG - Intergenic
1109297463 13:60552435-60552457 TGCACCCTGCAGAGCCACAGGGG - Intronic
1112223244 13:97513152-97513174 TGCCCACTGGATTCCCCCAGTGG - Intergenic
1112446105 13:99465609-99465631 TTCCCACTGGGGTTCCAGAGTGG - Intergenic
1113926924 13:113946881-113946903 TGCCCTTTGGAGCCCCACAGCGG + Intergenic
1114510510 14:23256070-23256092 GGCTCCCTGGAGTTCCACAGTGG + Intronic
1118523794 14:66617468-66617490 AGCCCACCTGAGAGCCACAGGGG - Intronic
1119842044 14:77800412-77800434 AGCCCACTGGTGTGCCAAACTGG - Intronic
1121687202 14:95845330-95845352 TGCTTACTGTATTGCCACAGTGG - Intergenic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1123663164 15:22584210-22584232 TGCAAACTGGCCTGCCACAGTGG + Intergenic
1124316967 15:28678513-28678535 TGCAAACTGGCCTGCCACAGTGG + Intergenic
1124566481 15:30818986-30819008 TGCAAACTGGCCTGCCACAGTGG - Intergenic
1126293604 15:47111228-47111250 GTCCCCCTGCAGTGCCACAGGGG + Intergenic
1128308958 15:66618594-66618616 TGCACACTGAAGGGCCATAGAGG - Intronic
1131097976 15:89667763-89667785 GGCCCAGTGGGGTGCCTCAGTGG - Exonic
1131724612 15:95207639-95207661 TGTACCCTGCAGTGCCACAGGGG + Intergenic
1133043029 16:3070682-3070704 TGCACCCTGCAGAGCCACAGGGG - Intronic
1133045114 16:3083617-3083639 TGCACCCTGCAGAGCCACAGGGG - Intergenic
1137235740 16:46616076-46616098 TGCTCACTTGAGAGTCACAGAGG + Exonic
1137714635 16:50591278-50591300 TGCCCACAGGGGAGCCACAGTGG - Intronic
1138401414 16:56747881-56747903 AGCCTCCTAGAGTGCCACAGTGG + Intronic
1138418839 16:56886481-56886503 TGGCCCCTGGAGGGGCACAGGGG + Intronic
1140636960 16:76926160-76926182 AGCTCACTGGAGTGTGACAGTGG + Intergenic
1141631440 16:85290180-85290202 TGCCCTCAGGAGTGCCACAAAGG - Intergenic
1142283218 16:89160264-89160286 TGGCAGCTGGAGAGCCACAGGGG - Intergenic
1142365996 16:89649992-89650014 TGCCCAGTGGAGTGCTGGAGGGG - Intronic
1145217431 17:21062342-21062364 AGGCCACTGGAGTGTGACAGAGG + Intergenic
1145264672 17:21374055-21374077 TGCCCAGTGGCGTGGCAGAGGGG + Intergenic
1145999223 17:29121458-29121480 AGCCCAGTGGGGTGCCACAGGGG + Intronic
1147140861 17:38459927-38459949 TCCTCATTGGGGTGCCACAGAGG + Intronic
1147557694 17:41489792-41489814 TGCCGCCTGCTGTGCCACAGAGG + Exonic
1150639763 17:66941672-66941694 TGTCCACTGTAGTTCCACACGGG - Intergenic
1151868421 17:76820291-76820313 TTCCCACTGTGGTGCCCCAGGGG - Intergenic
1156361751 18:36389907-36389929 TGGCCACTGGCCTACCACAGGGG - Intronic
1161225919 19:3145939-3145961 TGCACACTGGAGAGCCATGGGGG - Intronic
1161342820 19:3752360-3752382 TGCCCACTGGTGTGCCCTTGGGG - Intronic
1162822550 19:13231847-13231869 TGTCCTCAGGAGTGCCACCGGGG - Exonic
1165775340 19:38401118-38401140 TGCCCAGAGGTGGGCCACAGTGG - Intergenic
1168099077 19:54131457-54131479 TTCCCACTGAAGGGACACAGAGG + Exonic
1168379272 19:55906477-55906499 TGCAAGCTGGAGTGGCACAGTGG - Intronic
924990627 2:309674-309696 AGCCCACAGGAGCGCCCCAGGGG + Intergenic
925345387 2:3168535-3168557 TGCCCCCTGGAGAGCCCCACGGG + Intergenic
925401867 2:3580044-3580066 TGCCCTCTGGAGTTGCCCAGAGG + Intronic
926197557 2:10772966-10772988 TGCCCAGTGAACGGCCACAGCGG + Intronic
927684541 2:25161431-25161453 TGCCCACCGGCTTGCCCCAGCGG + Exonic
929893946 2:45941774-45941796 GGTCCACTGGAGTCCCAGAGTGG + Intronic
932051656 2:68404271-68404293 TGCCCTCTGGACTTACACAGTGG - Intergenic
932911015 2:75805969-75805991 TGCCCACTGGCCGGGCACAGTGG - Intergenic
935263558 2:101375605-101375627 GGCCTCCTGGGGTGCCACAGAGG - Intronic
935467193 2:103412323-103412345 TGCCCCACGGAGTGCCACATTGG + Intergenic
935542073 2:104360607-104360629 TGCCCACTGAAGTGCCAGTGGGG - Intergenic
936503394 2:113084445-113084467 TGCCCTCTAGAGTTACACAGTGG - Intergenic
939167157 2:138652333-138652355 TGCCCACTGCAGTGTCACTGTGG - Intergenic
944479714 2:200144253-200144275 TGAGCCCTGCAGTGCCACAGAGG - Intergenic
944500580 2:200355170-200355192 TCTCCACAGCAGTGCCACAGTGG - Intronic
944687129 2:202127491-202127513 TGGCCCATGGAGTGCCCCAGGGG + Intronic
1169096857 20:2908449-2908471 TGCACACTCAAGTCCCACAGTGG - Intronic
1171535770 20:25887412-25887434 GTCCCCCTGCAGTGCCACAGGGG - Intergenic
1171572089 20:26262486-26262508 GTCCCCCTGCAGTGCCACAGGGG + Intergenic
1171805323 20:29673772-29673794 GTCCCCCTGCAGTGCCACAGGGG + Intergenic
1171838730 20:30182658-30182680 GTCCCCCTGCAGTGCCACAGGGG - Intergenic
1172485525 20:35295827-35295849 TGCACACTGCCGTGCCACACGGG - Intergenic
1173017370 20:39237740-39237762 TGCTCACAGGAGTCTCACAGAGG + Intergenic
1173152598 20:40580666-40580688 TGCCCACTGGAGAGGTACTGAGG - Intergenic
1173273526 20:41558102-41558124 TACCCACTGGACTGCCTCCGAGG - Intronic
1174214587 20:48906399-48906421 TGCCCACTGCAGTGTCCCTGAGG + Intergenic
1177258658 21:18700058-18700080 TGCACCCTGCAGAGCCACAGGGG + Intergenic
1178121315 21:29473219-29473241 TGCCCAGTGACTTGCCACAGTGG + Intronic
1181309240 22:21934984-21935006 AGTCCACAGGAGTGCCACGGTGG - Intronic
1181361692 22:22342864-22342886 TTCCCTCTGGGGTCCCACAGTGG - Intergenic
1184453540 22:44596818-44596840 TGCCCACTGCAGGCCCACAGCGG + Intergenic
1184608970 22:45590512-45590534 AGCCCCCTGCAGAGCCACAGTGG + Intronic
1184974268 22:48049906-48049928 TGCCCGGTGGAGGACCACAGTGG - Intergenic
1185412165 22:50688500-50688522 TGCCCACTGGGGTCCCAGAGTGG + Intergenic
954366106 3:50147019-50147041 TGGCTACTGGGGTGCCAGAGAGG - Intergenic
955164215 3:56494804-56494826 TGCTCACTGGAGTGACACTAGGG - Intergenic
958522315 3:95205067-95205089 GGCCCACCTGAGAGCCACAGTGG - Intergenic
961316358 3:126038392-126038414 TGCACCCTGGAAAGCCACAGGGG + Intronic
961946311 3:130692703-130692725 TGCCCACAGGGGCCCCACAGGGG + Intronic
962708201 3:138064655-138064677 TGCCCAATGCTGGGCCACAGAGG - Exonic
964174101 3:153804735-153804757 TGCTGACTTGAGTGCCACAGAGG + Intergenic
964258270 3:154804680-154804702 TGCACCCTGCAGAGCCACAGGGG - Intergenic
965395085 3:168153110-168153132 TGAGCCCTGGAGAGCCACAGGGG + Intergenic
965404811 3:168255602-168255624 TGCACCCTGCAGAGCCACAGAGG - Intergenic
968929815 4:3572917-3572939 TGCGACCTGCAGTGCCACAGAGG - Intergenic
969388543 4:6873445-6873467 TGGCCACAGCTGTGCCACAGAGG + Intronic
972575355 4:40346138-40346160 TGCCCACTGGTGCTCCACATTGG - Intronic
972833121 4:42836856-42836878 TGCCCCCTGGGTTCCCACAGAGG + Intergenic
973012420 4:45093282-45093304 TGCCCCCTGCAAAGCCACAGGGG - Intergenic
973792390 4:54390683-54390705 TGCCCATTGAAGTCCCTCAGTGG + Intergenic
975526135 4:75352598-75352620 TGCCCAGTGGTGTCCCAGAGAGG + Intergenic
976283303 4:83346651-83346673 TGCACACTGCAAAGCCACAGGGG - Intergenic
976636932 4:87295668-87295690 TGCCAACTGGAGTCCCATAAAGG + Intergenic
978591634 4:110330197-110330219 TGTACCCTGCAGTGCCACAGGGG + Intergenic
979978440 4:127225046-127225068 AGCCCACCTGAGAGCCACAGGGG - Intergenic
980744748 4:136999725-136999747 AGCCCACTTGAGAGCCACATGGG - Intergenic
980787510 4:137573337-137573359 GGCCCACCGGAGAGCCACATGGG - Intergenic
981503052 4:145473157-145473179 TGTACACTGCAGAGCCACAGGGG - Intergenic
984757980 4:183342005-183342027 TGCCCAGTGCAGTGGCACAATGG + Intergenic
985719468 5:1481715-1481737 TGCCCACAGGAGTTGCACTGGGG + Intronic
986151122 5:5131290-5131312 AGCCCACTGGGCTCCCACAGTGG + Intergenic
989460116 5:41687676-41687698 TTCCCTCTAGAGTGTCACAGGGG + Intergenic
990789042 5:59455744-59455766 TGCACCCTGCAGAGCCACAGGGG + Intronic
991307809 5:65198944-65198966 TGCCCACTGGAATGACACAATGG - Intronic
992500924 5:77342780-77342802 TCCCCACTGGAGAGCTGCAGAGG + Intronic
993084551 5:83348075-83348097 TGTACCCTGGAGAGCCACAGGGG - Intronic
993781178 5:92066818-92066840 TGCTCCCTGCAGTGCCACAGGGG + Intergenic
994137174 5:96301773-96301795 TGTACACTGCAGGGCCACAGGGG - Intergenic
995592002 5:113709010-113709032 TGCCCTTTAGAGTGCCACACTGG + Intergenic
996336652 5:122390874-122390896 TGCCCACTGGGGAGCCACACTGG + Intronic
996823259 5:127653936-127653958 GGCCCACTGGAGAGCCCTAGGGG - Intronic
996893743 5:128455679-128455701 GGCCCACTTGAGAGCCACACGGG + Intronic
998945991 5:147339636-147339658 TGCACCCTGGAAAGCCACAGAGG + Intronic
998975033 5:147636131-147636153 TGCTCTCAGGAGTGGCACAGGGG - Intronic
1001325429 5:170720312-170720334 TTCCCACAGGAGTGCCCCAGTGG + Exonic
1001922063 5:175608583-175608605 TGCCCACTAGAGTGGTAGAGTGG + Intergenic
1002102076 5:176862625-176862647 TGCCCAGCAGAGTGCCACCGTGG + Exonic
1004470786 6:15927317-15927339 TGCCCACTGAAGTGCCTAACAGG - Intergenic
1005228459 6:23671369-23671391 TGCACCCTGCAATGCCACAGGGG - Intergenic
1008457218 6:51725147-51725169 TTCCCACTGCAGGGACACAGAGG - Intronic
1010884421 6:81218455-81218477 TGCACTCTGCAGTGCCACAGGGG + Intergenic
1011955906 6:93025291-93025313 TGTACACTGCAGAGCCACAGGGG - Intergenic
1015216528 6:130756356-130756378 AGCCCACTGGAGAGGAACAGAGG + Intergenic
1019596002 7:1858721-1858743 GGCCCACAGGAAAGCCACAGAGG + Intronic
1021893761 7:25214150-25214172 TGTGCTCTGGAGCGCCACAGAGG - Intergenic
1022571265 7:31456390-31456412 TGACTGCTGGAGAGCCACAGGGG - Intergenic
1023736580 7:43240965-43240987 TGGCCACTTGAGTCCAACAGAGG + Intronic
1025287235 7:57674113-57674135 GTCCCCCTGCAGTGCCACAGGGG - Intergenic
1026372474 7:69715422-69715444 AGGCCACTGGAGTGCTGCAGTGG + Intronic
1029528760 7:101111599-101111621 TGTCCCCTGTAGTACCACAGAGG + Intergenic
1034202873 7:149293469-149293491 TGAGCACAGGTGTGCCACAGTGG - Intronic
1034993417 7:155562349-155562371 TCCCCACCAGAGTGGCACAGTGG - Intergenic
1039148639 8:34478854-34478876 TGGGCCCTGCAGTGCCACAGAGG - Intergenic
1043233235 8:77829808-77829830 TGCCCACCTGAGAGCCACATGGG + Intergenic
1045244981 8:100435010-100435032 TGCCCTGTGTAGTGGCACAGTGG + Intergenic
1045551389 8:103175790-103175812 TGCCCACAGCAGAGCCACACTGG + Intronic
1045632986 8:104148718-104148740 TGCCCACTGCAGTGTCAGACTGG - Intronic
1046876781 8:119263704-119263726 TGCCCTTTGGGGTGCCTCAGTGG - Intergenic
1049432156 8:142570158-142570180 AGCCCTGTGCAGTGCCACAGGGG + Intergenic
1051003715 9:12315779-12315801 AGCCCACTGGAGAGCTACATGGG - Intergenic
1052420827 9:28241497-28241519 CGCCCACCTGAGAGCCACAGGGG + Intronic
1053076396 9:35138317-35138339 TGCACACTGTGGAGCCACAGTGG + Intergenic
1054460464 9:65459555-65459577 TGCGACCTGCAGTGCCACAGAGG + Intergenic
1056943788 9:90976819-90976841 GGCCTGCTGGAGTGCCACAGAGG + Intergenic
1058703062 9:107616621-107616643 TGCCCACAAGGATGCCACAGAGG - Intergenic
1059591689 9:115669247-115669269 TGCCCACTGGAGTGGCAATCTGG - Intergenic
1060758924 9:126232698-126232720 TGGCCACTGGAATCCAACAGTGG + Intergenic
1061187129 9:129061139-129061161 TGCCCATTGGTCGGCCACAGCGG - Intronic
1187031246 X:15490894-15490916 TGCACACTGGTGTGCCACCCTGG - Intronic
1189057309 X:37711540-37711562 TTCCCACTGGAGATCCACAAAGG - Intronic
1189850918 X:45175510-45175532 TCACCACTGGGTTGCCACAGAGG - Intronic
1191225291 X:58035707-58035729 TGCCCACTTGAGAGCCACATGGG - Intergenic
1192248062 X:69389375-69389397 TGCTCACTGGGGTGCAGCAGGGG - Intergenic
1193256525 X:79355304-79355326 TGCACCCTGAAGAGCCACAGGGG + Intergenic
1194435126 X:93860296-93860318 TGTACCCTGCAGTGCCACAGGGG + Intergenic
1197313134 X:124930768-124930790 TGCCCAAGGGAGCCCCACAGAGG + Intronic
1198236076 X:134736939-134736961 TGGCTTCTGGAGTGCCACATAGG - Intronic
1200100459 X:153687400-153687422 TGCCCACTGTGGAGACACAGAGG + Intronic