ID: 905934085

View in Genome Browser
Species Human (GRCh38)
Location 1:41810026-41810048
Sequence AGTCAGGTATAAAACTTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905934085_905934090 11 Left 905934085 1:41810026-41810048 CCAGTCAAGTTTTATACCTGACT 0: 1
1: 0
2: 0
3: 11
4: 97
Right 905934090 1:41810060-41810082 TAATCAGGCTCCAGTGTTCAGGG 0: 1
1: 0
2: 1
3: 8
4: 137
905934085_905934089 10 Left 905934085 1:41810026-41810048 CCAGTCAAGTTTTATACCTGACT 0: 1
1: 0
2: 0
3: 11
4: 97
Right 905934089 1:41810059-41810081 TTAATCAGGCTCCAGTGTTCAGG 0: 1
1: 0
2: 0
3: 8
4: 123
905934085_905934088 -4 Left 905934085 1:41810026-41810048 CCAGTCAAGTTTTATACCTGACT 0: 1
1: 0
2: 0
3: 11
4: 97
Right 905934088 1:41810045-41810067 GACTGGCATAAAACTTAATCAGG 0: 1
1: 0
2: 0
3: 2
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905934085 Original CRISPR AGTCAGGTATAAAACTTGAC TGG (reversed) Intronic
904488044 1:30840558-30840580 AGGCAGGTATCAGCCTTGACAGG - Intergenic
904992705 1:34606476-34606498 AGTCATGTAAAAGATTTGACAGG + Intergenic
905934085 1:41810026-41810048 AGTCAGGTATAAAACTTGACTGG - Intronic
909711032 1:78649141-78649163 AGTCAGGTATAAAGCAAGAGGGG + Intergenic
910531431 1:88240663-88240685 AGCCAGGGATAATACTTAACAGG - Intergenic
910794815 1:91087508-91087530 AATCAGCTATAAAATTTGACAGG + Intergenic
915202663 1:154244309-154244331 AGTGAGTTATCAAACTTGAAAGG - Intronic
917498103 1:175560811-175560833 ATTCTGGCATAAAACTTGTCAGG + Intronic
917826478 1:178826862-178826884 AGAAAGTTATAAAACTTTACAGG + Intronic
918394609 1:184100843-184100865 TTTCTGGTATAAAACTTGGCCGG + Intergenic
919360326 1:196584684-196584706 AATCTGATATAAAAGTTGACAGG - Intronic
919714078 1:200756713-200756735 AATCAGGTAGTAAACTTGAGGGG + Intronic
923309054 1:232717529-232717551 ATTTAGGAATAAAAATTGACAGG - Intergenic
924906391 1:248457295-248457317 AGTCAGTTGTCCAACTTGACAGG - Intergenic
924921498 1:248634745-248634767 AGTCAGTTGTCCAACTTGACAGG + Intergenic
1066056121 10:31681701-31681723 AGGCAGGAAGAAAACTTGGCAGG + Intergenic
1068144226 10:53045600-53045622 AGGCAGGCAGACAACTTGACAGG - Intergenic
1068174601 10:53441866-53441888 AGTTACTTAAAAAACTTGACTGG - Intergenic
1068701294 10:60022963-60022985 AGTCAGGTATAAGACATTAAGGG - Intergenic
1070708769 10:78661689-78661711 GATCATGTATCAAACTTGACGGG - Intergenic
1072499537 10:95999263-95999285 AGACATGGAGAAAACTTGACAGG - Intronic
1073945862 10:108749773-108749795 ATTCAGCTATAAAAATTCACAGG + Intergenic
1079283695 11:19109897-19109919 AGTGAGGGATAAAAATTGTCAGG - Intergenic
1083537207 11:63480483-63480505 AGTAAGGTATAAAACTAAATGGG + Intronic
1087510675 11:99088483-99088505 AATAAGGTATAAATCTTGAGAGG + Intronic
1092271392 12:7026211-7026233 AATCAGCTATAAAACTCTACAGG - Intronic
1092977285 12:13757627-13757649 ATTCAGGTAATAAATTTGACTGG - Intronic
1094431144 12:30370759-30370781 AATCAGCTATAAAATTTAACAGG - Intergenic
1098618313 12:72557795-72557817 TGTCAGGCATATAACTTGAATGG - Intronic
1100144304 12:91658645-91658667 TGTAAGGAATAAAATTTGACTGG - Intergenic
1108799659 13:54079880-54079902 AGTCAGGTATACAACTGGTCAGG + Intergenic
1110264335 13:73520882-73520904 TCTCACGTGTAAAACTTGACTGG - Intergenic
1113277593 13:108749937-108749959 AGTCAGCAATAAAACAGGACTGG + Intronic
1113840856 13:113360527-113360549 GGTCGGGTATAAAACTGGAGTGG - Intronic
1117178822 14:53172000-53172022 AGTCAGGTATTAAACAGGGCTGG + Intergenic
1121816143 14:96930151-96930173 AGTGAGGAATAACACATGACAGG - Intronic
1128351163 15:66890344-66890366 AATCAGCTATAAAATTTAACAGG - Intergenic
1129090181 15:73141638-73141660 AGTGAGGTTTAAAACTTAAGTGG - Intronic
1131681052 15:94723869-94723891 TGTCGGCTATAAAACTTGAAGGG + Intergenic
1131914444 15:97249118-97249140 AATCAGCTATAAAATTTAACAGG - Intergenic
1131955054 15:97726525-97726547 AGACAGGTATAAAACATCAGTGG - Intergenic
1133680921 16:8119073-8119095 AGTCAGGTATAAAATTACCCAGG + Intergenic
1136757667 16:32698466-32698488 TGTATGGTATAAAAATTGACAGG + Intergenic
1136810439 16:33171909-33171931 TGTATGGTATAAAAATTGACAGG - Intergenic
1136816915 16:33281989-33282011 TGTATGGTATAAAAATTGACAGG - Intronic
1138172308 16:54864245-54864267 AGTCATCTTTAAAACTTGATGGG + Intergenic
1203059816 16_KI270728v1_random:958815-958837 TGTATGGTATAAAAATTGACAGG + Intergenic
1145414854 17:22706474-22706496 AGTCTAGTATAAAACTTGGGAGG - Intergenic
1146496400 17:33326400-33326422 AGTCAGATAAAATGCTTGACTGG + Intronic
1156892872 18:42209845-42209867 AATCAGGTTTTGAACTTGACAGG - Intergenic
1156980456 18:43281668-43281690 AGTCAAGAATAAAACTTGCTAGG + Intergenic
1159310706 18:66704557-66704579 AGTCGTGTATAAAACATGTCTGG - Intergenic
1162923098 19:13915145-13915167 AGTTTGGCATAAAACTTGTCAGG + Intronic
926243860 2:11107699-11107721 AGTCAGTTATAAAACCTCTCTGG + Intergenic
931239822 2:60442206-60442228 AGTGAGGTATAGACCTTGAGTGG - Intergenic
932164371 2:69492888-69492910 AATCAGGCAAAAAACTTGACTGG + Intronic
937220938 2:120343121-120343143 ACTCAGGTAAAAAACTATACAGG + Intergenic
940528445 2:154846680-154846702 GGTCAGGTAGAAAACATGACAGG - Intronic
941209176 2:162614734-162614756 AGTGAAGTATAAAACATGACAGG + Intronic
1169958296 20:11130489-11130511 AGTCAGTTATAAGACTTTAACGG - Intergenic
1171005841 20:21465012-21465034 AAAAAGGTATAATACTTGACAGG - Intergenic
1171295699 20:24014945-24014967 AGTCAAGGATAAAACGAGACTGG - Intergenic
1173290325 20:41709239-41709261 AGTGAGTTATCAAACTTGAGGGG + Intergenic
1174649555 20:52113029-52113051 AAAGAGGTATAAAACTAGACAGG + Intronic
1174676708 20:52364441-52364463 AATCAGTTATTAAACTTGAGGGG + Intergenic
1185396687 22:50595257-50595279 TGTCAGGTAAGAAACTTGAGTGG + Intronic
949829842 3:8202072-8202094 AGTCATGCATAAAACTGGAAGGG - Intergenic
953600017 3:44353243-44353265 AGTCAGGGAGGAAACTTAACTGG - Intronic
953613341 3:44466679-44466701 AAGCAGGTATAAAATTTAACAGG + Intronic
956130173 3:66045901-66045923 AAACAAGTATAACACTTGACTGG - Intergenic
956620829 3:71220084-71220106 AGTTTAGTATAAAACTTGATGGG - Intronic
962356305 3:134697332-134697354 ACTGTGGGATAAAACTTGACAGG + Intronic
963679727 3:148359151-148359173 AGTCAGGTAGAAATCATGACAGG - Intergenic
964772239 3:160236488-160236510 AGTCAGGAAGAAAACCTGACAGG - Intronic
966935086 3:184701845-184701867 AATCAGCTATAAAATTTAACAGG - Intergenic
971081390 4:23216152-23216174 GGCAAGGTATAAAACTTGAAAGG + Intergenic
976112100 4:81686458-81686480 AGTCAAATCTAAAACTCGACCGG - Intronic
978230150 4:106387649-106387671 ATTTAAGTATAAAACTTGATGGG - Intergenic
980364249 4:131778529-131778551 AGACATGTATTGAACTTGACAGG - Intergenic
984010643 4:174367578-174367600 AATCAGCTATAAAACCTGACAGG + Intergenic
985656480 5:1134171-1134193 AGTGAGTTAAAAAACTTGGCTGG + Intergenic
994236100 5:97364664-97364686 AGTCAAGCATAAAATTTTACTGG + Intergenic
1002034315 5:176454888-176454910 TGTCAGGAATACAACTTGACTGG - Intronic
1007467164 6:42061445-42061467 AATCAGCTATAAAATTTAACAGG - Intronic
1007657834 6:43462923-43462945 TTTCAGGGATAAAGCTTGACTGG - Intergenic
1008794553 6:55286904-55286926 AGTCAAGTATTTACCTTGACGGG - Intergenic
1010466461 6:76172307-76172329 AGTCAGTCATATAACTTGAGTGG - Intergenic
1011162719 6:84409933-84409955 AGACAGGTAAAGAATTTGACTGG - Intergenic
1011506446 6:88048802-88048824 ATTAAGCAATAAAACTTGACAGG + Intronic
1016741841 6:147536933-147536955 AATCAGCTATAAAATTTAACAGG - Intronic
1018791789 6:167154379-167154401 AGTCAGGTCTAAGACTCGCCGGG - Intronic
1018802176 6:167232140-167232162 AATCAGCTATAAAATTTAACAGG + Intergenic
1023567866 7:41541230-41541252 AGTCAGGTAGAACAATTGATTGG - Intergenic
1026633191 7:72056468-72056490 AGACAGGTAAAGAACTTGAAAGG + Intronic
1028799276 7:94943561-94943583 AGACAGCTATAAAATTTGCCTGG - Intronic
1032913143 7:136457426-136457448 AGTCAGGTATAAAACTCTATTGG + Intergenic
1034479775 7:151310625-151310647 ACTCATATATGAAACTTGACAGG + Intergenic
1034633619 7:152550150-152550172 ACTCAGGTATAAAACTTTCAAGG - Intergenic
1036815640 8:11901036-11901058 AGTCAGGAGCAAAACTGGACAGG - Intergenic
1038814883 8:30891836-30891858 AATCAGGTAAAAAACTTGAATGG - Intergenic
1056727588 9:89134698-89134720 AATCAGCTATAGAATTTGACAGG + Intronic
1059461508 9:114433567-114433589 TGTCAGGTGTAAAACTTTAATGG + Intronic
1059690711 9:116683151-116683173 AATCAGCTATAAAATTTAACAGG + Intronic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1188216425 X:27483588-27483610 ACTTAGGTTTAAAGCTTGACAGG + Intergenic
1189670484 X:43403189-43403211 AGTCAAGTAGAATACTTGAGAGG + Intergenic
1195048287 X:101074342-101074364 AATCAGCTATAAAATTTAACAGG + Intergenic
1195899736 X:109785206-109785228 TGTCAGTTATAAAACTGAACTGG + Intergenic
1196711190 X:118764809-118764831 TATAAGATATAAAACTTGACTGG - Intronic