ID: 905938094

View in Genome Browser
Species Human (GRCh38)
Location 1:41840711-41840733
Sequence CAGGATCTGATGGGCTCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 80}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905938094_905938106 26 Left 905938094 1:41840711-41840733 CCCACGGAGCCCATCAGATCCTG 0: 1
1: 0
2: 1
3: 6
4: 80
Right 905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 74
905938094_905938105 18 Left 905938094 1:41840711-41840733 CCCACGGAGCCCATCAGATCCTG 0: 1
1: 0
2: 1
3: 6
4: 80
Right 905938105 1:41840752-41840774 TCACTGGACGACATAACCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 46
905938094_905938101 2 Left 905938094 1:41840711-41840733 CCCACGGAGCCCATCAGATCCTG 0: 1
1: 0
2: 1
3: 6
4: 80
Right 905938101 1:41840736-41840758 CGTGCCAGCCAGCCAGTCACTGG 0: 1
1: 0
2: 1
3: 13
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905938094 Original CRISPR CAGGATCTGATGGGCTCCGT GGG (reversed) Intronic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
907985441 1:59525104-59525126 CTGGATCTGATGTGCTGCATGGG - Intronic
908923721 1:69227268-69227290 CAGCATCTCAAGGGCTCTGTAGG - Intergenic
913426598 1:118738181-118738203 CAGCATCTGATGGGATCCTAAGG - Intergenic
914248371 1:145902106-145902128 GAGGGTCTGCTGGGCTCAGTTGG + Intronic
917981024 1:180269276-180269298 CAGGGTATCATGGGCTCCCTTGG + Intronic
923067041 1:230527492-230527514 CAGGATCTCATGGCTTCCCTTGG + Intergenic
1064144377 10:12815821-12815843 CAGGACCTGATGGGCTGAGCAGG + Intronic
1066663425 10:37759028-37759050 AAGGATCAGATGGACTCCCTTGG + Intergenic
1068512560 10:57984669-57984691 TAAGATCTGATGGGGTCCTTAGG - Intergenic
1070159295 10:73856058-73856080 CAGAATCTGATGGGGTGCGGTGG - Intronic
1071451322 10:85793587-85793609 CAGGGTCTGATGGTCTCTGCAGG + Intronic
1074385946 10:113016833-113016855 CAGGATCTGGTGGGCAGCGGAGG - Intronic
1075302259 10:121335470-121335492 CAGGATCTTATGGGCCACATGGG - Intergenic
1076538596 10:131199039-131199061 CAAGATCTCATGGGCACCCTGGG + Intronic
1077174570 11:1182850-1182872 GAGGATGTGCTGGGCTCCGTGGG - Intronic
1077174785 11:1183969-1183991 GAGGATGTGCTGGGCTCCGTGGG - Intronic
1080493069 11:32788562-32788584 GAGGATCTCATGAGCTCCGGAGG - Intronic
1083397219 11:62400171-62400193 CAGGATATGAGGGGCTCCCCAGG + Intergenic
1090894058 11:130953607-130953629 CCTGATCTCATGGGCTCCATGGG + Intergenic
1096368475 12:51048368-51048390 CAGGGTGTGCTGGGCTCGGTCGG + Exonic
1101663421 12:106787680-106787702 CAGGATCTGATGGGCTTATCGGG - Intronic
1104676369 12:130714755-130714777 CAGGGTCTGACCGGCTCCGGAGG - Intronic
1107737270 13:43412969-43412991 CAGAATCTGATGACCTCCGAGGG - Exonic
1113463131 13:110495718-110495740 GAGGATCTGATGGGGTCTCTAGG - Intronic
1122865247 14:104600967-104600989 CAGAGTCTGATGGGGTCAGTGGG + Intronic
1124405114 15:29385056-29385078 GGGGATCTGATGGGCCCCCTGGG - Intronic
1127041554 15:54982548-54982570 CATGATTAGATGGGCACCGTGGG - Intergenic
1128157762 15:65402451-65402473 CAGGATCTGAAGGACGCCGTTGG + Exonic
1132175505 15:99711025-99711047 CAGGATCTGAAGGGGTCTGAAGG + Intronic
1132666322 16:1082840-1082862 CGGGGTCTGATGGCCTCAGTGGG + Intergenic
1137594388 16:49714161-49714183 CAGGAGATCATGGGCTCCGAAGG + Intronic
1142185813 16:88694261-88694283 CAGGATCTGCTGAGCTCTGACGG + Intergenic
1142189818 16:88712661-88712683 CAGGAGCTGGTGGGATCCGAGGG + Exonic
1148385731 17:47233332-47233354 CAGGTTCTGATGGCCTCCACTGG + Intergenic
1152174995 17:78781845-78781867 CAGGATCTCAGGGGCTCTGAGGG - Intronic
1152316817 17:79585827-79585849 AAGGTTAGGATGGGCTCCGTGGG + Intergenic
1152566623 17:81103221-81103243 CAGGCCCTGATGGGCCCCGCGGG + Intronic
1156332616 18:36138332-36138354 CAGGATCTGATGTCCTCCTCTGG - Exonic
1162207371 19:9065827-9065849 CAGGCCCTGATTGGCTCCCTGGG + Intergenic
1163235043 19:16025064-16025086 GAGGACCTAATGGGCTCAGTTGG + Intergenic
1167487750 19:49773060-49773082 GAGGATCTGAAGGGCACAGTGGG + Intronic
925494017 2:4426147-4426169 CAGGCTGTGATGGGATCCTTTGG + Intergenic
925625727 2:5840830-5840852 CAGGCACAGATAGGCTCCGTGGG - Intergenic
927467967 2:23351156-23351178 GTGGAGCTGATGGGCCCCGTGGG - Intergenic
928945435 2:36767808-36767830 GATGATCAGATGGGCTCCTTAGG - Intronic
930075665 2:47403551-47403573 CAGGTTCTGCTTGGCTCCGGAGG + Intronic
931821911 2:65960766-65960788 CAGAATCAGATTGGCTCCATAGG + Intergenic
938092148 2:128441018-128441040 CAGCATCTGATGGGCTCCCCTGG - Intergenic
946909098 2:224442710-224442732 CCGGTTCTGATGGGGTCCGCAGG + Intergenic
1175060349 20:56236492-56236514 CAAGATCTGATGGGCTTATTAGG + Intergenic
1175964120 20:62651961-62651983 AAGGATCTGATGGGGTCCCTGGG - Intronic
1179591501 21:42412253-42412275 CAGCACCTGTCGGGCTCCGTGGG + Intronic
1179992634 21:44956530-44956552 CAGCATCTGAGTGGCTCTGTAGG + Intronic
1180629019 22:17214512-17214534 CAGGATCAGATGGACTCCAGAGG + Intronic
1181022806 22:20112519-20112541 CAGGAGCTGAAGGGCTCCCAGGG - Exonic
1182490032 22:30665476-30665498 CAGGATCTGATGGGTTCATAAGG - Intronic
1183382128 22:37495571-37495593 TAGGAGCTGCTGGGCTCTGTGGG + Exonic
1183735552 22:39642973-39642995 CTGGCTCTGAGGGGCTCCCTAGG - Intronic
1184775475 22:46620850-46620872 CAGGTTCTGAGGGGCTTCCTGGG - Intronic
949894239 3:8757589-8757611 CAGGATCTTAGGGTCTCCGCTGG + Intronic
957668857 3:83274332-83274354 CAAGATCTGATGGGCTAATTGGG - Intergenic
975553250 4:75634463-75634485 CAGGATCTCATGGGGCCCGGGGG - Intergenic
976217971 4:82732528-82732550 CAGGATCTGATGTGATGGGTAGG - Intronic
979109040 4:116726893-116726915 CAGGAAATGATAGGCTCCTTGGG + Intergenic
988852150 5:35190746-35190768 CAGAATAAGATGGGCTCAGTAGG - Intronic
1001834951 5:174824100-174824122 CAGGCTCTGAGGGGCTCCTGAGG - Intergenic
1005779027 6:29168950-29168972 CTGGCTCTGATGGGCTCCAGTGG + Intergenic
1006452180 6:34111669-34111691 CAAGAGCTGATGGGCTGGGTGGG + Intronic
1007112036 6:39318439-39318461 CTGGATCTGATGGTTTCCTTGGG + Intronic
1018398056 6:163395959-163395981 CAGGGTCTGATGGGCTGCTTGGG + Intergenic
1018988099 6:168653162-168653184 CAAGAACTGATGGGCTGCCTGGG + Exonic
1022310051 7:29188654-29188676 CAGGATCTGCTCGGTTCCCTGGG + Intronic
1026441861 7:70451936-70451958 CTGGTTCTGAGGGGCTCTGTGGG + Intronic
1032011229 7:128349438-128349460 CAGGAGCTGATGGGCAAAGTTGG + Intergenic
1035092632 7:156327073-156327095 CAGTATCTGATGGTATCTGTTGG - Intergenic
1035318198 7:158010848-158010870 CAGCATCTGAGGTGCTCCATGGG - Intronic
1039884536 8:41647538-41647560 CAGGATCAGATGGGCTTCAGGGG - Intronic
1049303417 8:141883826-141883848 CAGGATGTGATGAGCCCAGTGGG - Intergenic
1056278910 9:85020462-85020484 CACGATCTTATGGGCTTTGTTGG + Intronic
1056718296 9:89052106-89052128 CAGGATGTCATCGGCTCCATCGG - Exonic
1057941469 9:99288932-99288954 CAGGAGCTGGTGGGCTTCGGGGG + Intergenic
1059427775 9:114231819-114231841 CAGGGACTGATGGGCAGCGTGGG + Exonic
1060936930 9:127521492-127521514 CAGGATGTGAAGGGGTCCCTGGG + Intronic
1061134557 9:128725880-128725902 CAGGATCTGATGTGCTCAGTGGG + Intergenic
1195327611 X:103770660-103770682 GAGGATCACATGGGATCCGTAGG + Intergenic
1198042991 X:132872994-132873016 CAGGAAGTGATGGGCTGGGTTGG - Intronic
1200787895 Y:7274940-7274962 CAGGAGCAGCTGGGCTCCGGGGG + Intergenic