ID: 905938095

View in Genome Browser
Species Human (GRCh38)
Location 1:41840712-41840734
Sequence CCAGGATCTGATGGGCTCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905938095_905938106 25 Left 905938095 1:41840712-41840734 CCACGGAGCCCATCAGATCCTGG 0: 1
1: 0
2: 0
3: 12
4: 182
Right 905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 74
905938095_905938105 17 Left 905938095 1:41840712-41840734 CCACGGAGCCCATCAGATCCTGG 0: 1
1: 0
2: 0
3: 12
4: 182
Right 905938105 1:41840752-41840774 TCACTGGACGACATAACCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 46
905938095_905938101 1 Left 905938095 1:41840712-41840734 CCACGGAGCCCATCAGATCCTGG 0: 1
1: 0
2: 0
3: 12
4: 182
Right 905938101 1:41840736-41840758 CGTGCCAGCCAGCCAGTCACTGG 0: 1
1: 0
2: 1
3: 13
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905938095 Original CRISPR CCAGGATCTGATGGGCTCCG TGG (reversed) Intronic
900077202 1:827393-827415 CCGGGGTCTGCTGGTCTCCGCGG - Intergenic
900394447 1:2447429-2447451 CCAGGTTCTGCTGTGCTCCCAGG + Intronic
900683119 1:3928804-3928826 CCTGGATCTGCTGGCCTCAGAGG + Intergenic
902376014 1:16030233-16030255 CGAGGAAGTGATGGGCCCCGGGG - Intronic
903701217 1:25249627-25249649 CCAGGATTTGCTGGGCACAGTGG - Intronic
904599577 1:31666053-31666075 CCAGGATCTGAAGGCCTCCCAGG - Exonic
905938095 1:41840712-41840734 CCAGGATCTGATGGGCTCCGTGG - Intronic
907019609 1:51054085-51054107 CCAGAATCAGATGGCCTCCTGGG - Intergenic
907493578 1:54826467-54826489 ACAGGATCTGTAGGGCTCCAGGG + Intronic
920025881 1:202995575-202995597 CCTGGATCTGATGGCTTCTGTGG + Intergenic
1063094684 10:2899081-2899103 CCAGGGTCTGCTGGTCTCTGTGG - Intergenic
1066412608 10:35188238-35188260 CCAGGATCTGATGGTGTTCAGGG + Exonic
1075336442 10:121612369-121612391 GCAGGCTCTGATGGGCACGGTGG - Intergenic
1076538595 10:131199038-131199060 CCAAGATCTCATGGGCACCCTGG + Intronic
1076715444 10:132361715-132361737 CCAGGCTGTGGTGGGCTCCAGGG + Intronic
1076885590 10:133261042-133261064 CCAGTAGCTGCTGGACTCCGGGG + Intergenic
1077174571 11:1182851-1182873 GGAGGATGTGCTGGGCTCCGTGG - Intronic
1077174786 11:1183970-1183992 GGAGGATGTGCTGGGCTCCGTGG - Intronic
1078473930 11:11614229-11614251 CCAGCATCTGCTAGGCTCCTGGG + Intronic
1084433040 11:69122123-69122145 CCAGGCTCTGAGGGGCTCACAGG + Intergenic
1087276405 11:96164715-96164737 CAAAGATCTGATGGGCACCGCGG + Intronic
1089163216 11:116455443-116455465 CCAGGAGCTGCTGGGCTTAGTGG + Intergenic
1091901211 12:4145558-4145580 GCAGGATCTGGTGGGGTCCAAGG - Intergenic
1094841955 12:34345952-34345974 CCCGGAGCTGCTGGGCCCCGCGG - Intergenic
1096240461 12:49957194-49957216 CCTGGATCTTGTGGGCTCCCAGG - Exonic
1101663422 12:106787681-106787703 ACAGGATCTGATGGGCTTATCGG - Intronic
1102047784 12:109840584-109840606 ACAGGGTCTGATGGTCTCCCAGG + Intergenic
1106733240 13:32563490-32563512 CCAGGATCTGCTGGGGACCCAGG - Intergenic
1107737271 13:43412970-43412992 GCAGAATCTGATGACCTCCGAGG - Exonic
1109166489 13:59041371-59041393 CCAGGATCTGCTTGGCTTCTGGG + Intergenic
1111234748 13:85394422-85394444 CCAGGATCTGATCAGCTTCTGGG + Intergenic
1112255553 13:97827319-97827341 CCTGCATCTGATGGGCTTTGGGG - Intergenic
1113053153 13:106236873-106236895 CCAGGAGCTCATGGTCTCTGGGG - Intergenic
1113905654 13:113818080-113818102 CCGGGATCTGAGGGACGCCGCGG + Intergenic
1113905685 13:113818184-113818206 CCGGGATCTGAGGGACGCCGCGG + Intergenic
1113948931 13:114060495-114060517 CCAGGATTTGCTCGGCACCGTGG - Intronic
1114076455 14:19163935-19163957 CTAGGATCTGATGAGCACCTGGG - Intergenic
1114085710 14:19235634-19235656 CTAGGATCTGATGAGCACCTGGG + Intergenic
1117406761 14:55411732-55411754 CCGGGACCTGGTGGACTCCGTGG - Exonic
1118145600 14:63131642-63131664 CCAGGATCTGATGGCTTCATTGG + Intergenic
1118907269 14:70031978-70032000 ACAGGATCTGATGGGGTCTTGGG + Intronic
1120854551 14:89201518-89201540 CCAGGCTCTGAGGTGCTCTGGGG - Intronic
1122865246 14:104600966-104600988 CCAGAGTCTGATGGGGTCAGTGG + Intronic
1123115420 14:105892192-105892214 CCAGGAGGGGATGGGATCCGGGG + Intergenic
1123139792 14:106063820-106063842 CCAGGATCTTAGGGGCACTGGGG + Intergenic
1124846352 15:33295010-33295032 CCAGAATCTGATGGGCTTTGTGG + Intergenic
1128107876 15:65057724-65057746 AGAGGCTCTGATGGGCTCCTTGG - Intronic
1128481869 15:68046446-68046468 CCAGGAACCGAAGGGCTCCAAGG - Intergenic
1131149021 15:90035360-90035382 CCAAGAGCTGATGGGCTCATGGG - Intronic
1131990406 15:98088274-98088296 CCAGTATCTTCTGGCCTCCGTGG - Intergenic
1132666321 16:1082839-1082861 CCGGGGTCTGATGGCCTCAGTGG + Intergenic
1132939395 16:2499445-2499467 GCTGGCTCTGATGGGCTCCAGGG + Intronic
1132939401 16:2499467-2499489 GCTGGCTCTGATGGGCTCCAGGG + Intronic
1133042330 16:3067208-3067230 CCAGGCTGTGAGGGGCTCCTGGG + Intronic
1134209904 16:12267478-12267500 CCAGGCTGTGATGTGCTCCTGGG + Intronic
1136287323 16:29252256-29252278 TCAGGATCTGCTGTGCTCTGGGG + Intergenic
1139435621 16:66935017-66935039 CCAGGGTCTGAGGGTCTCCGCGG - Exonic
1139438011 16:66948064-66948086 CCAGGGTCTGAGGGTCTCCGCGG - Intergenic
1141576463 16:84967021-84967043 CCTGGATCTGGGGGGCCCCGCGG + Intergenic
1142092936 16:88224885-88224907 TCAGGATCTGCTGTGCTCTGGGG + Intergenic
1142109387 16:88323206-88323228 CCAGGCTCTGCAGAGCTCCGAGG + Intergenic
1142189817 16:88712660-88712682 CCAGGAGCTGGTGGGATCCGAGG + Exonic
1143199208 17:5100502-5100524 CCAGGATGCCATGGGCTCCAGGG - Intergenic
1144025293 17:11271817-11271839 CCAGGAACAGATGGGGTCCCAGG - Intronic
1145229743 17:21164851-21164873 CCAGGATCTGAGGTGATCCCTGG + Intronic
1146302459 17:31700193-31700215 CCATGATCTGCTGGGCACTGGGG + Intergenic
1149512607 17:57256205-57256227 CCTGGATCACATGGGCTGCGGGG - Intronic
1150651483 17:67013114-67013136 CCAGGACCCGATGGGTTCCAGGG - Intronic
1150685184 17:67314850-67314872 GTAGGATCGGATGGGCACCGTGG + Intergenic
1152174996 17:78781846-78781868 GCAGGATCTCAGGGGCTCTGAGG - Intronic
1152566622 17:81103220-81103242 CCAGGCCCTGATGGGCCCCGCGG + Intronic
1152854819 17:82658686-82658708 CCAGGATCTTGGGGACTCCGGGG + Exonic
1158603708 18:58876567-58876589 TCAGGATCTGAATGGATCCGGGG + Intronic
1160117734 18:76097574-76097596 CTAGGATCTGATGGGATCCAGGG - Intergenic
1160662871 19:309156-309178 CCAGGAGCTGGAGGGCTCTGAGG - Intronic
1161505794 19:4642779-4642801 GCAGGATCTTATGGGCTGCCAGG + Intronic
1162207370 19:9065826-9065848 CCAGGCCCTGATTGGCTCCCTGG + Intergenic
1162320749 19:9969654-9969676 CCAGGTCCTGATGGGCCCCCAGG - Exonic
1162597183 19:11638708-11638730 CCAGGTTCTGATCGGTTCTGGGG + Intergenic
1163294143 19:16401427-16401449 CCAGGAGCAGAAGGGCTCCAGGG + Intronic
1163421005 19:17213595-17213617 ACAGGAACAGATGGGCTCCCAGG + Intronic
1164654286 19:29909706-29909728 TCAGGATTTAATGGGCCCCGGGG - Intergenic
1165434340 19:35788142-35788164 CCGGGATCTGAACGGCTTCGGGG - Exonic
1165471351 19:36006589-36006611 CCAGGACCTGGTGGGGTCTGGGG - Exonic
1166558794 19:43718687-43718709 CCAGGAGCTGCTGGCCTCCACGG + Exonic
1167097715 19:47383510-47383532 ACAGGCTCAGATGGGCTCCCTGG + Intergenic
925122664 2:1431353-1431375 CCAGGATCTGCTTGGCTTCTGGG - Intronic
929107099 2:38376656-38376678 CCAGGGCATGATGGGCCCCGCGG - Intronic
931882169 2:66578648-66578670 CCAGGAGCCCAGGGGCTCCGGGG - Intergenic
935059292 2:99593777-99593799 CCTGGTTTTGGTGGGCTCCGGGG + Exonic
937544917 2:123004963-123004985 GCAGGGTCTGCTGGGCCCCGTGG - Intergenic
938491050 2:131761450-131761472 CTAGGATCTGATGAGCACCTGGG - Intronic
946190857 2:218007220-218007242 CCAGAATCTGAGGGGCTGAGAGG - Intergenic
948245968 2:236486174-236486196 CCAGGATCTGATGCCCTACAGGG + Intronic
948806700 2:240456213-240456235 GCAGGTTCTGAGGGGCTCCTCGG - Intronic
1170464460 20:16610255-16610277 CCAGGATGTGCTGGGCACAGTGG + Intergenic
1173979410 20:47211681-47211703 CCAGGATGTGATGGGATCTTAGG - Intronic
1174444074 20:50578849-50578871 CCAGCATCTGCTCGGCTCCTGGG + Intronic
1175695269 20:61098660-61098682 CCAGCATCTGATGTGCTTCAGGG - Intergenic
1175964121 20:62651962-62651984 AAAGGATCTGATGGGGTCCCTGG - Intronic
1176196183 20:63837146-63837168 CCAGGAGGTGATGGGGGCCGGGG + Intergenic
1178436868 21:32567538-32567560 ATAGGATCTGAAGGGCTCCCAGG + Intergenic
1179591500 21:42412252-42412274 CCAGCACCTGTCGGGCTCCGTGG + Intronic
1180292263 22:10857559-10857581 CTAGGATCTGATGAGCACCTGGG - Intergenic
1180495069 22:15886981-15887003 CTAGGATCTGATGAGCACCTGGG - Intergenic
1181022807 22:20112520-20112542 ACAGGAGCTGAAGGGCTCCCAGG - Exonic
1181307176 22:21923400-21923422 CCGGGCGCTGACGGGCTCCGAGG - Exonic
1181680983 22:24495585-24495607 TCAGGGTCTGAAGGGCTCAGGGG + Intronic
1181914856 22:26271718-26271740 CCAGCATCTGCTGGGCTTCTGGG - Intronic
1182849394 22:33459129-33459151 CCAGGGTCTGTTGGGGGCCGAGG - Intronic
1183382127 22:37495570-37495592 CTAGGAGCTGCTGGGCTCTGTGG + Exonic
1183484452 22:38081754-38081776 CCCGGATCTGCTGGGTTCCCGGG - Intronic
952160806 3:30691369-30691391 CCATGAGTTGGTGGGCTCCGCGG - Intronic
954081713 3:48216119-48216141 CCAGGATCTGAGTGCCTTCGGGG - Intergenic
954097210 3:48338234-48338256 CCAGGATCAGATGGGAGCCAGGG + Intergenic
954135708 3:48581267-48581289 CCAGGACCTGTTGGCCCCCGAGG - Exonic
961918503 3:130401816-130401838 CCAGGACCTCATGGGACCCGAGG + Exonic
962244847 3:133784038-133784060 CCCGGATCTGCTCGGCTCCATGG - Exonic
966135621 3:176695023-176695045 CCAGGAGCTCATGGTCTCAGAGG - Intergenic
966464817 3:180218607-180218629 CCAGGCTCAGATGGGTTCTGTGG + Intergenic
966797769 3:183732161-183732183 CCAGGGTCGGCTGGGCACCGTGG + Intronic
967921588 3:194617992-194618014 CCAGCATCTGCTGGGCTTCTGGG - Intronic
967967658 3:194974812-194974834 CTAGGGTCTGATGGTCTCCATGG + Intergenic
968711791 4:2124810-2124832 CCAGGATGTGCCTGGCTCCGAGG - Intronic
970862895 4:20723798-20723820 CCAGGATCTGATGGTCAGGGTGG - Intronic
975553251 4:75634464-75634486 TCAGGATCTCATGGGGCCCGGGG - Intergenic
975933061 4:79550328-79550350 CCAGGATCAGATGGGTTCACAGG + Intergenic
978930054 4:114298867-114298889 CCAGCATCTGATGGCTTCAGAGG - Intergenic
982245382 4:153345102-153345124 CCAGGTTCTCAAGGGCCCCGTGG - Intronic
984869106 4:184311159-184311181 CCAGAAGCTCATGGGCTCCTGGG - Intergenic
985014955 4:185624012-185624034 CAAGGACCTGATGAACTCCGAGG - Exonic
985894997 5:2743587-2743609 CCAGGAGCAGATGGGCTTTGGGG - Intergenic
986514923 5:8551282-8551304 CCAGAATCTGGTGGGGTCTGAGG + Intergenic
993925862 5:93865365-93865387 CCAGGATCGGCTGGGCGCGGTGG - Intronic
994146562 5:96402112-96402134 CCAGTACATGATGGGCTCTGGGG - Intronic
995169567 5:109091464-109091486 CAAGGCTCTGAGGGTCTCCGTGG - Intronic
997434781 5:133866519-133866541 CCAGGATTTTCTGGGCTCTGGGG - Intergenic
1004378344 6:15110736-15110758 GCAGGATCTGCTGGGCACAGTGG - Intergenic
1004871255 6:19906824-19906846 CCAGGCTCTGCTGGGCTTCCAGG + Intergenic
1006419410 6:33923993-33924015 CCAGCATCTGGTGTGCTCCTCGG + Intergenic
1007112035 6:39318438-39318460 CCTGGATCTGATGGTTTCCTTGG + Intronic
1011781921 6:90799305-90799327 CCAGCATCTGGTGGGCTTCTGGG + Intergenic
1014745729 6:125198204-125198226 CCAGTATCTGATGGCCTCTTGGG - Intronic
1017537985 6:155369164-155369186 CCAGGGTCTGCTGGTCTCTGTGG + Intergenic
1018398055 6:163395958-163395980 CCAGGGTCTGATGGGCTGCTTGG + Intergenic
1018800348 6:167217309-167217331 CCAGGCTCTGCTGAGCTCTGAGG - Intergenic
1018812752 6:167309198-167309220 CCAGGCTCTGCTGAGCTCCGAGG + Intronic
1019833740 7:3359655-3359677 CCAGGAGATGCTGGGCTCCCGGG + Intronic
1020224222 7:6267166-6267188 CCAGCATCTGCTCGGCTCCTGGG - Intronic
1021772337 7:24017945-24017967 CCAGATTCTGAAGGGCTCCAGGG - Intergenic
1023184937 7:37523452-37523474 CCAGGACCTGATGTGCTGGGTGG + Intergenic
1024061412 7:45701726-45701748 CCAGCCTCAGATGGTCTCCGGGG - Intronic
1026102519 7:67394772-67394794 CCAGGCTCTGATGTGCTTCTTGG + Intergenic
1029389493 7:100265537-100265559 CTAGGATCGGCTGGGCGCCGTGG - Intronic
1030894721 7:115043605-115043627 CAAGGTTCTCATGGGCTCCCGGG - Intergenic
1032161791 7:129516582-129516604 CCAGCATCTGCTGGGCTTCTGGG + Intergenic
1032257195 7:130306593-130306615 CCAGGCTTTGAAGGGCTCAGAGG + Intronic
1033208448 7:139442286-139442308 CCTGCATCTGATGAGCTCAGCGG + Intergenic
1035515968 8:232484-232506 CCGGGGTCTGCTGGTCTCCGCGG + Exonic
1039843491 8:41309506-41309528 CCGGGAGCTGATTGGCTGCGCGG - Intergenic
1039884537 8:41647539-41647561 GCAGGATCAGATGGGCTTCAGGG - Intronic
1042328502 8:67554245-67554267 CCAGCATCTGCTGGGCTTCTAGG + Intronic
1043195639 8:77288327-77288349 CCAGGTTCTGCTGAGTTCCGTGG + Intergenic
1047085097 8:121507172-121507194 CCAGGATGTTATGTGCTCCTGGG + Intergenic
1047305712 8:123651723-123651745 GCAGGAGCTCATGGGCTCCATGG - Exonic
1047610288 8:126514525-126514547 CCAGCATCTGCTGGGCTTCTAGG + Intergenic
1048871637 8:138804023-138804045 CCAGGAGCTGAGGGGCTGAGAGG - Intronic
1048917693 8:139200417-139200439 CCAGAATCTGATGGGGTTGGGGG + Intergenic
1053612683 9:39731367-39731389 CCAGGATAAGATGGGCTGTGCGG - Intergenic
1053870727 9:42489328-42489350 CCAGGATAAGATGGGCTGTGCGG - Intergenic
1054085569 9:60739788-60739810 CCAGGATAAGATGGGCTGTGCGG + Intergenic
1054240832 9:62611023-62611045 CCAGGATAAGATGGGCTGTGCGG + Intergenic
1056612220 9:88132740-88132762 CCAGGAGCAGATGGGTTCGGAGG + Intergenic
1057216391 9:93231134-93231156 CCAGCTTCTCATGGGCTCCAAGG - Intronic
1057371757 9:94480086-94480108 ACAGGAACTGCTGGGCACCGGGG - Intergenic
1057941468 9:99288931-99288953 GCAGGAGCTGGTGGGCTTCGGGG + Intergenic
1058836608 9:108863117-108863139 CCAGGACCAGATGGGCATCGTGG + Exonic
1059561437 9:115338553-115338575 CCAGGAACCCATGGGCACCGGGG + Intronic
1060276475 9:122186645-122186667 CCAGAATCTGATGGGCACCATGG - Intronic
1060727514 9:126016227-126016249 CCAGGATCAGATGGGTTTTGGGG + Intergenic
1061134556 9:128725879-128725901 GCAGGATCTGATGTGCTCAGTGG + Intergenic
1061847072 9:133393820-133393842 CCAGGGACTGATGGACTCAGAGG + Intronic
1185893961 X:3842846-3842868 GCAGGAGCAGCTGGGCTCCGGGG - Intronic
1185899078 X:3881270-3881292 GCAGGAGCAGCTGGGCTCCGGGG - Intergenic
1185904195 X:3919699-3919721 GCAGGAGCAGCTGGGCTCCGGGG - Intergenic
1190167741 X:48087202-48087224 CCATGATCTGTTGTGTTCCGTGG - Intergenic
1191153896 X:57250890-57250912 CCAGGACCTGATGGCTTCCCTGG + Intergenic
1193002354 X:76577061-76577083 CCAGGATCAGATGGATTCAGAGG - Intergenic
1193082546 X:77420416-77420438 CCATGATCTGCTGGGCACGGTGG - Intergenic
1193305716 X:79949151-79949173 CCATGACCTGATGTGCTCTGAGG + Intergenic
1193384760 X:80857069-80857091 CCAGGCCCTGATGGGCACTGTGG - Intergenic
1193397557 X:81003737-81003759 CCCGGATCTGCGCGGCTCCGTGG + Intergenic
1195227495 X:102813425-102813447 CCAGGATCTGCTTGGCTTCTAGG + Intergenic
1195746219 X:108121378-108121400 CCAGAATCTGTTGGACTCAGTGG - Intronic
1200787894 Y:7274939-7274961 GCAGGAGCAGCTGGGCTCCGGGG + Intergenic