ID: 905938097

View in Genome Browser
Species Human (GRCh38)
Location 1:41840720-41840742
Sequence TGGCACGGCCAGGATCTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 83}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905938097_905938105 9 Left 905938097 1:41840720-41840742 CCCATCAGATCCTGGCCGTGCCA 0: 1
1: 0
2: 0
3: 8
4: 83
Right 905938105 1:41840752-41840774 TCACTGGACGACATAACCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 46
905938097_905938106 17 Left 905938097 1:41840720-41840742 CCCATCAGATCCTGGCCGTGCCA 0: 1
1: 0
2: 0
3: 8
4: 83
Right 905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 74
905938097_905938109 27 Left 905938097 1:41840720-41840742 CCCATCAGATCCTGGCCGTGCCA 0: 1
1: 0
2: 0
3: 8
4: 83
Right 905938109 1:41840770-41840792 AGAGGAAGCTTGGCACTGGAAGG 0: 1
1: 0
2: 1
3: 26
4: 234
905938097_905938101 -7 Left 905938097 1:41840720-41840742 CCCATCAGATCCTGGCCGTGCCA 0: 1
1: 0
2: 0
3: 8
4: 83
Right 905938101 1:41840736-41840758 CGTGCCAGCCAGCCAGTCACTGG 0: 1
1: 0
2: 1
3: 13
4: 142
905938097_905938110 30 Left 905938097 1:41840720-41840742 CCCATCAGATCCTGGCCGTGCCA 0: 1
1: 0
2: 0
3: 8
4: 83
Right 905938110 1:41840773-41840795 GGAAGCTTGGCACTGGAAGGAGG 0: 1
1: 0
2: 0
3: 21
4: 263
905938097_905938107 23 Left 905938097 1:41840720-41840742 CCCATCAGATCCTGGCCGTGCCA 0: 1
1: 0
2: 0
3: 8
4: 83
Right 905938107 1:41840766-41840788 AACCAGAGGAAGCTTGGCACTGG 0: 1
1: 0
2: 0
3: 17
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905938097 Original CRISPR TGGCACGGCCAGGATCTGAT GGG (reversed) Intronic
900191258 1:1353258-1353280 TGGGGCTGCCAGGTTCTGATGGG + Exonic
900892514 1:5459712-5459734 TGGTGCAGCCAGGGTCTGATAGG + Intergenic
902190446 1:14759191-14759213 TGGCACAGCCAGGCTGAGATAGG - Intronic
902415202 1:16234490-16234512 TGTCCAGCCCAGGATCTGATGGG - Intronic
903344159 1:22673672-22673694 TAGCCCGGCCAGGAGCTGAGCGG - Intergenic
905786381 1:40760991-40761013 TGCCAAGGGCAGGCTCTGATTGG + Intronic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
906056802 1:42924322-42924344 TGGAACCGCCAGGGTGTGATTGG + Intergenic
906678349 1:47709018-47709040 TGGCAGGGCCAGGCTCTGAAAGG - Intergenic
910538614 1:88329149-88329171 TGGCAAGTCCAAAATCTGATGGG + Intergenic
911744162 1:101420772-101420794 TGGCAAGTCCAAAATCTGATAGG - Intergenic
912949549 1:114111393-114111415 TGGCACAGCCAGGATGTGGACGG + Intronic
1071822549 10:89293063-89293085 TGTCAAGGGCAGGACCTGATGGG + Intronic
1078397966 11:10998789-10998811 TGGGACTGGCAGGATCAGATGGG - Intergenic
1080457468 11:32429718-32429740 TGGCCCTGCCAGGATCCCATAGG - Intronic
1084026332 11:66452376-66452398 TGGCAGGGGCTGGATCTGAAGGG + Intronic
1086938116 11:92766387-92766409 TGGCACTGCCTGGATAGGATGGG + Intronic
1088159815 11:106855336-106855358 TGGCCTGGCCAGGATCGGTTTGG - Intronic
1089329613 11:117680401-117680423 TGGCCTAGCCAGGATCTGAGGGG - Intronic
1095788079 12:46132679-46132701 TTGCAGAGCCAGGATGTGATTGG + Intergenic
1100198437 12:92273279-92273301 TGGCAAGTCCACAATCTGATGGG - Intergenic
1105007068 12:132728079-132728101 GTGCACGGCCGGGAACTGATGGG + Exonic
1109356255 13:61232855-61232877 TAGCTCAGCCAGGATCTGCTGGG + Intergenic
1114905073 14:27118041-27118063 TGGCACTGCTAGCAGCTGATTGG + Intergenic
1117454266 14:55881994-55882016 TGGAACTGCCAGGCTCTGGTCGG + Intergenic
1121779555 14:96613636-96613658 TGGCATGTGCAGGATCTGAGAGG + Intergenic
1123161032 14:106277987-106278009 TGGCGAGTCCAGGAACTGATGGG + Intergenic
1123165999 14:106325213-106325235 TGGCGAGTCCAGGAACTGATGGG + Intergenic
1123208738 14:106738539-106738561 TGGCGAGTCCAGGAACTGATGGG + Intergenic
1123480237 15:20624384-20624406 TGGCAAGTGCAGGAACTGATGGG + Intergenic
1123637769 15:22375979-22376001 TGGCAAGTGCAGGAACTGATGGG - Intergenic
1125153405 15:36559898-36559920 TGGTAGAGCCAGGATCTGAATGG + Intergenic
1125231657 15:37463517-37463539 TGGCATGGCAGGGACCTGATGGG - Intergenic
1127997178 15:64160031-64160053 TGGGAGGGCCAGGTTCTGCTGGG - Intronic
1128883546 15:71265003-71265025 GGGCAGGGCCCTGATCTGATAGG + Intronic
1129974650 15:79812115-79812137 TGCCCTGGCCAGGATCTGGTGGG + Intergenic
1130389715 15:83445079-83445101 TAGCAAGGGCAGCATCTGATTGG - Intergenic
1134247660 16:12552021-12552043 TGGCAAGTCCAGGCTCAGATGGG + Intronic
1138393870 16:56689803-56689825 TGGTAGGGCCAGCATCTGTTTGG - Intronic
1140794559 16:78425008-78425030 TGACACGGGCAGGAGCTGAGCGG - Exonic
1141667465 16:85473318-85473340 GGGCAGGGCCAGGAGCTGGTGGG + Intergenic
1151579115 17:74968267-74968289 TGGCAAGGTCAGGGACTGATGGG - Intronic
1153101844 18:1480539-1480561 TGTCAAGGCCAGGACCTGGTGGG - Intergenic
1156559904 18:38111892-38111914 TAGCATTGCCAGGACCTGATTGG - Intergenic
1158768517 18:60485787-60485809 TGTGAAGGCCAGGACCTGATAGG + Intergenic
1162797792 19:13095588-13095610 GGGCAGGGGCAGGAACTGATGGG - Exonic
1163595018 19:18216200-18216222 GGGTACAGCCAGGATCTGCTGGG + Intronic
1166364497 19:42271813-42271835 TGCCACTGCCAGGACCTGAAAGG - Intronic
1167006164 19:46777713-46777735 TGGTATGGGCAGGATCTGGTGGG - Intronic
1167696638 19:51019125-51019147 TCTCATGGCCAGGATCTGCTGGG + Exonic
925481801 2:4283779-4283801 TGCCAGGGGCAGGAACTGATGGG - Intergenic
929484059 2:42339267-42339289 TGGCACCACCAGGAGCTGAGGGG + Intronic
933264715 2:80169383-80169405 TGGGAAGGCCAGATTCTGATTGG - Intronic
937024873 2:118689649-118689671 TTGCACGGGGAGAATCTGATTGG - Intergenic
938118820 2:128619902-128619924 TGACACAGCCAGGATTTGAGTGG + Intergenic
940146118 2:150546018-150546040 TGGCACGGACATGAGCGGATAGG - Intergenic
947587587 2:231366102-231366124 TGGCAAGCGCAGAATCTGATGGG + Intronic
947904376 2:233749674-233749696 TGTCAAGGACAGGATCTGGTGGG + Intronic
1173569259 20:44066169-44066191 TGGCAGGGCCAGGGTTTGAAAGG - Intronic
1179557173 21:42187131-42187153 TGGCAGGGTCAGGGTCTGGTGGG + Intergenic
1181394973 22:22614806-22614828 AGGCATGGGCAGGATCTGAGGGG - Intergenic
1181697754 22:24602364-24602386 TGGAGGGGCCAGGATTTGATGGG + Intronic
1183376762 22:37469816-37469838 TGGCAAGCCCAGGATCTGAGTGG - Exonic
1183583743 22:38740273-38740295 CCGCACGGCCTGGATCTGCTGGG + Exonic
1184444385 22:44538974-44538996 TGGAAAGGCCAGGATCTGCCTGG - Intergenic
1203298320 22_KI270736v1_random:59531-59553 TGGAACGGACAGGATTGGATAGG + Intergenic
951966332 3:28389762-28389784 TGGCAAGTCCAGTTTCTGATGGG + Intronic
957217694 3:77342965-77342987 AGGCACGGTCAGGTTCTGGTAGG + Intronic
961302066 3:125928493-125928515 AGGCCAGGCCAGGATCAGATGGG + Intergenic
963948558 3:151172506-151172528 AGGCACAGCCAGGATCTTTTGGG + Intronic
968995577 4:3943352-3943374 AGGCCAGGCCAGGATCAGATGGG - Intergenic
981807963 4:148738822-148738844 TGGCACGGCCCGGGGATGATGGG + Intergenic
983494494 4:168427960-168427982 TTGCAGGGCCAGGAACTGATGGG - Intronic
988083793 5:26446826-26446848 TGTCAGGGGCAGGACCTGATGGG - Intergenic
988775796 5:34477255-34477277 AGGCAGGGCCCCGATCTGATAGG + Intergenic
997393814 5:133540165-133540187 TGGCAAATCCAGAATCTGATGGG - Intronic
1003661127 6:8063843-8063865 TCGCACGACCAGGAACAGATCGG + Intronic
1010840276 6:80641691-80641713 TGGCACAGGCAGGCTCTGAATGG + Intergenic
1013342650 6:109230170-109230192 TGGCATGTTCAGGATCTGCTGGG + Intergenic
1015079041 6:129201237-129201259 TGGCAAGGCCAGGCTGTGTTTGG - Intronic
1016899893 6:149091010-149091032 TGGCCTGGCCAGGAACTGCTAGG + Intergenic
1019542133 7:1556225-1556247 CGGCAAGGCCAGGATCTGAAGGG + Exonic
1020126735 7:5536970-5536992 GGGCACAGCCAGGAGCTGAAGGG + Intronic
1033224276 7:139548343-139548365 TGGCAAAGCCAGGATTTGTTGGG + Intergenic
1049479765 8:142816329-142816351 TCTCACGGCCAGGCTCTGCTCGG - Intergenic
1050249847 9:3733341-3733363 TGGCACGGGTAGGATCTCATGGG + Intergenic
1053289094 9:36868336-36868358 AGGCAGGGCCAGGATCTGAGAGG + Intronic
1056443562 9:86643482-86643504 TGGCGGGGCCAGGATCTGAAGGG + Intergenic
1056871718 9:90288023-90288045 TGGCTGGGGCAGGCTCTGATGGG - Intergenic
1057487088 9:95494183-95494205 TGGCACTGCCAGCAGCTGGTGGG - Intronic
1062288887 9:135785839-135785861 GGGCAAGGCCAGGATGTGCTGGG + Intronic
1187538395 X:20165426-20165448 TGGAAAGGCCAGGATCTCATGGG - Intronic