ID: 905938098

View in Genome Browser
Species Human (GRCh38)
Location 1:41840721-41840743
Sequence CTGGCACGGCCAGGATCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 172}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905938098_905938105 8 Left 905938098 1:41840721-41840743 CCATCAGATCCTGGCCGTGCCAG 0: 1
1: 0
2: 0
3: 10
4: 172
Right 905938105 1:41840752-41840774 TCACTGGACGACATAACCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 46
905938098_905938106 16 Left 905938098 1:41840721-41840743 CCATCAGATCCTGGCCGTGCCAG 0: 1
1: 0
2: 0
3: 10
4: 172
Right 905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 74
905938098_905938101 -8 Left 905938098 1:41840721-41840743 CCATCAGATCCTGGCCGTGCCAG 0: 1
1: 0
2: 0
3: 10
4: 172
Right 905938101 1:41840736-41840758 CGTGCCAGCCAGCCAGTCACTGG 0: 1
1: 0
2: 1
3: 13
4: 142
905938098_905938110 29 Left 905938098 1:41840721-41840743 CCATCAGATCCTGGCCGTGCCAG 0: 1
1: 0
2: 0
3: 10
4: 172
Right 905938110 1:41840773-41840795 GGAAGCTTGGCACTGGAAGGAGG 0: 1
1: 0
2: 0
3: 21
4: 263
905938098_905938109 26 Left 905938098 1:41840721-41840743 CCATCAGATCCTGGCCGTGCCAG 0: 1
1: 0
2: 0
3: 10
4: 172
Right 905938109 1:41840770-41840792 AGAGGAAGCTTGGCACTGGAAGG 0: 1
1: 0
2: 1
3: 26
4: 234
905938098_905938107 22 Left 905938098 1:41840721-41840743 CCATCAGATCCTGGCCGTGCCAG 0: 1
1: 0
2: 0
3: 10
4: 172
Right 905938107 1:41840766-41840788 AACCAGAGGAAGCTTGGCACTGG 0: 1
1: 0
2: 0
3: 17
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905938098 Original CRISPR CTGGCACGGCCAGGATCTGA TGG (reversed) Intronic
901142986 1:7047420-7047442 CTGGCACACGCAGGACCTGAAGG + Intronic
901783875 1:11611952-11611974 TTGGCCCGGCCTGGATCTCATGG + Intergenic
902415203 1:16234491-16234513 CTGTCCAGCCCAGGATCTGATGG - Intronic
904079171 1:27861281-27861303 CTGTCAGGGCTGGGATCTGAGGG + Intergenic
905456066 1:38088698-38088720 CTGGCACAGCCTGGAGCTGCTGG - Intergenic
905938098 1:41840721-41840743 CTGGCACGGCCAGGATCTGATGG - Intronic
908181089 1:61606727-61606749 ATGGCACACCCAGGCTCTGATGG - Intergenic
908654380 1:66372471-66372493 CAGGGACTGCCAGGGTCTGATGG + Exonic
923190857 1:231619112-231619134 TTGGCATGGCCACTATCTGATGG + Intronic
924624284 1:245686813-245686835 CTCGCTCAGCCAGGAGCTGATGG - Exonic
924896969 1:248349494-248349516 CTGACACCACCAGGATGTGAGGG - Exonic
1068710393 10:60127357-60127379 GTGGCAGTGCCTGGATCTGATGG - Intronic
1069555140 10:69392809-69392831 CTGCCACGGCCAGGATGAGTTGG + Intronic
1071672125 10:87618644-87618666 CCTGCACAGCCAGGATCTGTAGG - Intergenic
1073340993 10:102744263-102744285 CTGGCGTGGACAGGATCTAAAGG + Intronic
1075920846 10:126211452-126211474 CTGGCAGGTCCAGGATCCCATGG - Intronic
1076150527 10:128158763-128158785 CTGGCTCAGCCAGGACATGAAGG - Intergenic
1076660106 10:132050239-132050261 CGGGCAGCGCGAGGATCTGAGGG - Intergenic
1076870165 10:133189101-133189123 CTGGCAGGGCTAGGCTTTGACGG - Intronic
1077864231 11:6210027-6210049 CTGGAGCAGGCAGGATCTGAGGG + Exonic
1084026331 11:66452375-66452397 TTGGCAGGGGCTGGATCTGAAGG + Intronic
1084433061 11:69122215-69122237 GTGGCAAGGCCAGAATCTGCAGG - Intergenic
1085412897 11:76302066-76302088 CTGGCAAGTCCTGGATTTGAGGG - Intergenic
1086146864 11:83561431-83561453 CTGTCAGTGCCAGGATCTGAAGG - Intronic
1089329614 11:117680402-117680424 GTGGCCTAGCCAGGATCTGAGGG - Intronic
1091716311 12:2779135-2779157 CAGACAAGCCCAGGATCTGATGG - Intergenic
1091727918 12:2858412-2858434 CTGTCCCTGCCAGGAGCTGAAGG - Exonic
1097388375 12:58978698-58978720 TTGGCAGGGCCATGCTCTGAAGG + Intergenic
1101273762 12:103176678-103176700 ATGGCAGGACCAGGATTTGAAGG + Intergenic
1104743858 12:131198212-131198234 CCTGCACGACCAGGATCTGGGGG - Intergenic
1104785214 12:131444475-131444497 CTGGCGGGACCAGGACCTGAGGG + Intergenic
1109356254 13:61232854-61232876 CTAGCTCAGCCAGGATCTGCTGG + Intergenic
1110805301 13:79747592-79747614 GTGGCATGGCCATGAACTGATGG + Intergenic
1113763855 13:112868666-112868688 CTGCCACCCCCAGAATCTGATGG + Intronic
1114830796 14:26139281-26139303 CTGCTACTGTCAGGATCTGAAGG + Intergenic
1117295604 14:54376525-54376547 GTGGAAGGGCCAGGATCTGAAGG - Intergenic
1122355261 14:101119425-101119447 CGGGCGTGGCCAGGATGTGACGG + Intergenic
1123925674 15:25108099-25108121 CTAGCATGGCCAGGGTCTCATGG - Intergenic
1124479308 15:30063994-30064016 CTGGCAAGTCCAGAATCTGTAGG - Intergenic
1124685216 15:31776703-31776725 CTGTGACTGCCAGGGTCTGAAGG + Intronic
1129740793 15:77988672-77988694 AGGGCACAGCCAGGGTCTGAGGG - Intronic
1129844932 15:78763868-78763890 AGGGCACAGCCAGGGTCTGAGGG + Intronic
1129974649 15:79812114-79812136 CTGCCCTGGCCAGGATCTGGTGG + Intergenic
1130022832 15:80245452-80245474 CTGTCCCAACCAGGATCTGAAGG - Intergenic
1130047213 15:80454602-80454624 CTGGCCAGTCCAGGCTCTGAAGG + Intronic
1130256894 15:82329972-82329994 AGGGCACAGCCAGGGTCTGAGGG - Intergenic
1130598054 15:85260016-85260038 AGGGCACAGCCAGGGTCTGAGGG + Intergenic
1131356736 15:91751795-91751817 CTGGCAGGGCCAAGATGGGATGG + Intergenic
1132297495 15:100751656-100751678 CTGGCATGTCCAGAATCTGCAGG + Intergenic
1132548050 16:542454-542476 CTGGGACGGCCAGAATCACAAGG - Intronic
1135798942 16:25474655-25474677 CTGACACAACCAGGAGCTGAAGG - Intergenic
1137447440 16:48540320-48540342 GTGGCACGGCTGGGATGTGAGGG - Exonic
1137447844 16:48543056-48543078 CTGGCATGGGCAGGTTCTGCTGG + Exonic
1138625557 16:58248879-58248901 CAGGCACTCCCTGGATCTGAGGG - Intronic
1139545701 16:67648598-67648620 GAGGCAGGGCCAGGATCTGGGGG - Intronic
1141717075 16:85732999-85733021 CAGGCACTGTCAGGATCTGCAGG + Intronic
1142235020 16:88918068-88918090 CTGGCATGGCCAGGCTGTGCAGG + Intronic
1143426010 17:6838579-6838601 CGTGCTCGGCCAAGATCTGATGG - Intergenic
1143480794 17:7226380-7226402 CCTGTACGGCCAGGATCTGAGGG - Intronic
1144831747 17:18135746-18135768 CTGCCACGGCCTGGATCTCTCGG - Exonic
1147664789 17:42139692-42139714 CTGGCACAGCCTGGATCACAAGG - Intronic
1148161338 17:45451844-45451866 CTGTGAAGGCCAGGCTCTGAGGG - Intronic
1148436595 17:47690461-47690483 CTGGCAGGGCCTGGCTCTGGGGG + Intergenic
1148466674 17:47869121-47869143 GTGGCACTGCCAGGCTCTGGAGG - Intergenic
1148889826 17:50799631-50799653 CTGGCAGAGCCAGGAGCTGTGGG + Intergenic
1149621220 17:58046758-58046780 CAGGCAGGGCCAGGAAGTGAAGG + Intergenic
1149978346 17:61288813-61288835 CTGGCTAGGCCAGGATTTGGTGG - Intronic
1151334731 17:73433260-73433282 CTGGCAAGGCTGGGATGTGAAGG + Intronic
1151530023 17:74698226-74698248 CTGGCACTGCCAGCTGCTGAGGG + Intronic
1151561332 17:74871527-74871549 CTGTGAAGGCCAGGATCTCAAGG - Intronic
1151579116 17:74968268-74968290 CTGGCAAGGTCAGGGACTGATGG - Intronic
1151973634 17:77471794-77471816 CTGGCACGGGCTGGATCTTGGGG + Intronic
1158990088 18:62859372-62859394 CTCCCACAGCCAGGATCTCAGGG - Intronic
1159355910 18:67337361-67337383 GTGGCAGGGCCAGGAGCTGTGGG - Intergenic
1159959049 18:74541411-74541433 CTGGCAGGTTCAGGAGCTGATGG + Intronic
1160204884 18:76823684-76823706 CTGGAAGGGCCAGGGTCTGGGGG - Intronic
1161114501 19:2489142-2489164 CTGGCACCGCCGGGCTCTGGAGG - Intergenic
1163053627 19:14702911-14702933 CACGCCCGGCCACGATCTGATGG - Intronic
1164145780 19:22511662-22511684 CTGGCAGGAGCAGGATCAGAAGG + Intronic
1165030978 19:32998073-32998095 CCTGCACGACCAGGCTCTGAAGG + Intronic
1165117352 19:33536871-33536893 CTGGGACGGTCAGGATTTTAGGG + Intergenic
1165422251 19:35728027-35728049 CTGGCAGGGGCAGGGTCTGAAGG - Intronic
1165938335 19:39403015-39403037 CTGGGACGCCCGAGATCTGAGGG + Intergenic
1166364375 19:42271033-42271055 CTGGCATGGCCAGGCACTGTGGG - Intronic
1167696637 19:51019124-51019146 CTCTCATGGCCAGGATCTGCTGG + Exonic
1168713778 19:58515811-58515833 CTGACACGGCCAAGGTCCGAGGG + Intronic
925106182 2:1294309-1294331 GGGGCATGGCCAGGACCTGAGGG - Intronic
925481802 2:4283780-4283802 CTGCCAGGGGCAGGAACTGATGG - Intergenic
925743885 2:7028905-7028927 CTGTAACAGCCAGGATTTGATGG + Intronic
927157734 2:20231272-20231294 CTGGCAAGGGCTGGATCAGAGGG + Intergenic
928096751 2:28409563-28409585 CCTGCAGGGCCAGGCTCTGAAGG - Intronic
928706385 2:33954142-33954164 GTGGCACCACCAGGCTCTGAGGG + Intergenic
929484058 2:42339266-42339288 TTGGCACCACCAGGAGCTGAGGG + Intronic
931515360 2:63047975-63047997 CAGGCCCGGCCAGGCTCTGGAGG - Intergenic
933378751 2:81516020-81516042 CTGGCACTGCCAGGAGCTCCAGG - Intergenic
946133248 2:217623844-217623866 CTGGCAAGTCCAGAATCTGTAGG - Intronic
946300763 2:218822788-218822810 CTGGGACTCCCAGGAGCTGAAGG + Exonic
948456835 2:238108475-238108497 CGGGCAGGGCCAGCAGCTGATGG - Intronic
1168922586 20:1552807-1552829 CTGGCAGGGCCAGGAGGTAATGG + Intronic
1168964289 20:1889831-1889853 TTGGCACAGCCTGGATTTGAAGG - Intergenic
1169147702 20:3264271-3264293 CTGGCAAGGCCAGCAGCTGCCGG + Intronic
1170552380 20:17489031-17489053 CTGGCTCGGGCAGGATCCTAAGG + Intergenic
1171159061 20:22905126-22905148 CTGGCAAGGTCAGGCTCTAAGGG - Intergenic
1172861360 20:38055566-38055588 CTGCCACTGCCAGCATCAGAGGG - Intronic
1176075326 20:63245610-63245632 CTGACAAGGCCAGGCTCTGGGGG - Intronic
1179241303 21:39595339-39595361 CTGGCAAGTCCAAGATCTGCAGG - Intronic
1179600899 21:42476634-42476656 CTGGCACTGACAGCAGCTGAGGG - Intronic
1179801356 21:43812920-43812942 TGGGCACCTCCAGGATCTGAGGG - Intergenic
1180195144 21:46189636-46189658 CAGGCAATGACAGGATCTGAGGG + Exonic
1180230812 21:46425860-46425882 CTGACAGCGCCAGGATCTGGTGG - Exonic
1181394974 22:22614807-22614829 TAGGCATGGGCAGGATCTGAGGG - Intergenic
1181697753 22:24602363-24602385 CTGGAGGGGCCAGGATTTGATGG + Intronic
1182419684 22:30242895-30242917 CTGGGATGGCCAGGGTCTGATGG - Exonic
1183583741 22:38740272-38740294 CCCGCACGGCCTGGATCTGCTGG + Exonic
1184450149 22:44577842-44577864 CTGGCACGGCCTAGACCAGAAGG + Intergenic
950476030 3:13215393-13215415 CTGGCATGGCCAGAGCCTGAAGG - Intergenic
952924417 3:38310711-38310733 CTGCCAGGGACAGGAGCTGAGGG - Intronic
953033397 3:39192076-39192098 CAGGCAGGCCCAGGATCTGGAGG - Intronic
955219170 3:57009549-57009571 CTGGACAGGCCAGGATGTGAAGG + Intronic
960986582 3:123284946-123284968 CTGGCACGAGCAGGTGCTGAGGG - Intronic
961260944 3:125601393-125601415 GTGGCAGAGCCAGGATTTGAAGG - Intergenic
961302065 3:125928492-125928514 CAGGCCAGGCCAGGATCAGATGG + Intergenic
961817040 3:129556413-129556435 CCAGCGCGGCCATGATCTGAGGG + Exonic
966835189 3:184044236-184044258 CTGGCAAGGGCAGAATTTGATGG - Intergenic
967725789 3:192861301-192861323 CTGGGACTGCCAGCATCTGCGGG + Intronic
967967657 3:194974803-194974825 CTGGCTCTGCTAGGGTCTGATGG + Intergenic
968286573 3:197512542-197512564 CTGGCACAGCCAGGTTCCCAGGG - Intronic
968596513 4:1488865-1488887 CTGGGACAGCCAGGCTCTGCGGG + Intergenic
968622791 4:1611244-1611266 CTGGCTGGGCCAGGATATGGGGG + Intergenic
968995578 4:3943353-3943375 CAGGCCAGGCCAGGATCAGATGG - Intergenic
970401901 4:15725231-15725253 CAGGCAGAACCAGGATCTGAAGG + Intronic
970662957 4:18306643-18306665 CTGGCAAGGCCAAAATCTGCAGG - Intergenic
973216767 4:47678031-47678053 CTGTCACAGCCAGGGTCTGGTGG - Exonic
974399232 4:61379964-61379986 GTGGCAAGGCCAGAATTTGAAGG - Intronic
975582385 4:75918671-75918693 TTGGCTCAGCAAGGATCTGAGGG - Intronic
980179308 4:129384811-129384833 CTGGCTTGTCCAGGCTCTGAGGG + Intergenic
982635198 4:157887167-157887189 CTGGCAGGGACAGGCTCTGGGGG - Intergenic
983494495 4:168427961-168427983 ATTGCAGGGCCAGGAACTGATGG - Intronic
984438377 4:179733883-179733905 CGCGCCCGGCCAAGATCTGATGG - Intergenic
985604388 5:850632-850654 CCGGCCCTCCCAGGATCTGACGG - Exonic
985648283 5:1095397-1095419 CAGGCACGGTGAGGAGCTGAAGG + Intronic
988623396 5:32846376-32846398 GTGGCACTTCCAGCATCTGAGGG - Intergenic
988657921 5:33233044-33233066 CTGGCATTGCCAGAATCTGTAGG - Intergenic
997831099 5:137150746-137150768 CTGTCACTGCCAGGCTCTGTAGG - Intronic
998530610 5:142881092-142881114 CCTGCACTGCCAGGAACTGAGGG - Intronic
1002173980 5:177391143-177391165 CTGGGAGGCCCAGGATCTGGGGG - Intronic
1003383837 6:5649476-5649498 CATGCAGGGCCAGGAGCTGAGGG + Intronic
1007786758 6:44284685-44284707 CTGGCACAGGGAGGATCTGAAGG - Intronic
1008418885 6:51273738-51273760 CTGCCAGGGCCAGGCCCTGAGGG + Intergenic
1008544985 6:52576590-52576612 CTGGCACGGCGCGGAGCTGGGGG + Intronic
1017054827 6:150427390-150427412 CTGCAAAGGCCAGGAACTGAGGG + Intergenic
1019542132 7:1556224-1556246 GCGGCAAGGCCAGGATCTGAAGG + Exonic
1020126734 7:5536969-5536991 AGGGCACAGCCAGGAGCTGAAGG + Intronic
1022221332 7:28316548-28316570 CAGACACTGCCAGGATCTGGCGG - Intronic
1023838139 7:44080316-44080338 CAGGCTGGGCCAGGATTTGAAGG + Intronic
1032496721 7:132368417-132368439 CTGGCAGGCCCAGGAGCTGCTGG - Intronic
1033756220 7:144399769-144399791 CTGGCAGGGCCAGGGGCTGCAGG + Exonic
1036191173 8:6671548-6671570 CTCCCACAGCCAGGGTCTGAAGG + Intergenic
1037607387 8:20449140-20449162 CAGGCACAGCCAGGACTTGAGGG - Intergenic
1037946246 8:22991292-22991314 CTGGGACGGCCAGGACCCCAGGG - Intronic
1041930303 8:63279523-63279545 CTTGCATGGCAAGGAACTGAGGG - Intergenic
1048889914 8:138937594-138937616 CTGGCAAGTCCAGAATCTGTAGG - Intergenic
1049361432 8:142214079-142214101 GAGGCATGGCCAGGGTCTGAGGG + Intronic
1049671024 8:143869905-143869927 CTGGCAGGGGCAGGAGGTGAAGG + Exonic
1050134585 9:2448564-2448586 TTGGCAGGGCCAGGCTTTGAGGG + Intergenic
1050249846 9:3733340-3733362 CTGGCACGGGTAGGATCTCATGG + Intergenic
1050451947 9:5791247-5791269 CTGGCAAGTCCAAAATCTGAAGG + Intronic
1053205781 9:36185032-36185054 CTGGCAAGTCCAGAATCTGCAGG - Intergenic
1055987924 9:82071383-82071405 CTGGCAAGTCCAAAATCTGAAGG - Intergenic
1056443561 9:86643481-86643503 GTGGCGGGGCCAGGATCTGAAGG + Intergenic
1059396037 9:114034715-114034737 CTGGCAGTGCCAGGAAGTGAGGG + Intronic
1060745520 9:126128397-126128419 GTGGCAGAGCCAGGTTCTGAGGG + Intergenic
1060754511 9:126203090-126203112 CTGCCACGGCAGGGATCTGTGGG - Intergenic
1061053995 9:128212157-128212179 CTTCCACAGCCAGGATCTCAGGG + Intronic
1185474908 X:409351-409373 CGTGCCCGGCCAAGATCTGATGG + Intergenic
1187538396 X:20165427-20165449 ATGGAAAGGCCAGGATCTCATGG - Intronic
1188423808 X:30023243-30023265 CTGGCAAGTCCAGAATCTGCAGG - Intergenic
1191900334 X:66033807-66033829 CTGGCACTTCCAGGATGGGACGG + Exonic
1192186268 X:68948720-68948742 CTGGAACCCCCAGGAGCTGATGG - Intergenic
1193679250 X:84497858-84497880 GTGGCAAAGCCAGGATTTGAGGG - Intronic
1194651859 X:96524659-96524681 CTGGCAAGGCCAAAATCTGCAGG + Intergenic
1199643477 X:149883974-149883996 CTGGTAGGGCCAGGAACTGTGGG - Intronic
1201427760 Y:13873067-13873089 TTGGCAGGGCCAGGATCTGGGGG + Intergenic