ID: 905938099

View in Genome Browser
Species Human (GRCh38)
Location 1:41840730-41840752
Sequence ACTGGCTGGCTGGCACGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 304}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905938099_905938109 17 Left 905938099 1:41840730-41840752 CCTGGCCGTGCCAGCCAGCCAGT 0: 1
1: 0
2: 0
3: 22
4: 304
Right 905938109 1:41840770-41840792 AGAGGAAGCTTGGCACTGGAAGG 0: 1
1: 0
2: 1
3: 26
4: 234
905938099_905938107 13 Left 905938099 1:41840730-41840752 CCTGGCCGTGCCAGCCAGCCAGT 0: 1
1: 0
2: 0
3: 22
4: 304
Right 905938107 1:41840766-41840788 AACCAGAGGAAGCTTGGCACTGG 0: 1
1: 0
2: 0
3: 17
4: 133
905938099_905938111 25 Left 905938099 1:41840730-41840752 CCTGGCCGTGCCAGCCAGCCAGT 0: 1
1: 0
2: 0
3: 22
4: 304
Right 905938111 1:41840778-41840800 CTTGGCACTGGAAGGAGGCCAGG 0: 1
1: 1
2: 1
3: 20
4: 320
905938099_905938106 7 Left 905938099 1:41840730-41840752 CCTGGCCGTGCCAGCCAGCCAGT 0: 1
1: 0
2: 0
3: 22
4: 304
Right 905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 74
905938099_905938105 -1 Left 905938099 1:41840730-41840752 CCTGGCCGTGCCAGCCAGCCAGT 0: 1
1: 0
2: 0
3: 22
4: 304
Right 905938105 1:41840752-41840774 TCACTGGACGACATAACCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 46
905938099_905938110 20 Left 905938099 1:41840730-41840752 CCTGGCCGTGCCAGCCAGCCAGT 0: 1
1: 0
2: 0
3: 22
4: 304
Right 905938110 1:41840773-41840795 GGAAGCTTGGCACTGGAAGGAGG 0: 1
1: 0
2: 0
3: 21
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905938099 Original CRISPR ACTGGCTGGCTGGCACGGCC AGG (reversed) Intronic
900014229 1:137602-137624 ACTTGCTGGGAGGCAGGGCCGGG + Intergenic
900044092 1:492804-492826 ACTTGCTGGGAGGCAGGGCCGGG + Intergenic
900065502 1:727710-727732 ACTTGCTGGGAGGCAGGGCCGGG + Intergenic
900195201 1:1372322-1372344 CCTCGCTGGCTGGCACGTCCAGG + Intergenic
900425499 1:2576567-2576589 ACTGGAGGGCTGGCCAGGCCTGG - Intergenic
901882623 1:12203110-12203132 TCTCACTGGCTGGCACTGCCAGG - Intronic
902079926 1:13813880-13813902 ACTGGCTGGCTAGAGAGGCCTGG + Intronic
903657646 1:24959021-24959043 ACTGGCTCAGTGGCAAGGCCGGG + Intronic
903894998 1:26596838-26596860 ACGGGCTGGCTGGCCGGGCGGGG - Intergenic
903921366 1:26803485-26803507 ACTGGGTGGCTGGCCAGGCGGGG + Intergenic
904020329 1:27459184-27459206 ACTGCATGACAGGCACGGCCAGG - Intronic
905393750 1:37654171-37654193 ACTGACAGTTTGGCACGGCCAGG + Intergenic
905938099 1:41840730-41840752 ACTGGCTGGCTGGCACGGCCAGG - Intronic
908317862 1:62951598-62951620 ACTGGCTGGCTGGCTGGGAAAGG + Intergenic
911259590 1:95669815-95669837 GCTGGCGGGCTGGCACTGCTGGG + Intergenic
912752160 1:112294415-112294437 ACTGGGTGGCTGGCCAGGCGGGG - Intergenic
914047323 1:144103158-144103180 GCTGGCTGGCTTGGCCGGCCGGG + Intergenic
914047761 1:144105068-144105090 GCTGGCTGGCTTGGCCGGCCGGG + Intergenic
914915685 1:151817772-151817794 ACTGTCTGGCTGGGAAGGACTGG - Intronic
916671974 1:167029808-167029830 ACTGGGCGGCTGGCAGGGCGGGG - Intergenic
917801309 1:178573137-178573159 ACTGACTGGTTGGAAGGGCCTGG - Intergenic
919805971 1:201381305-201381327 CCTGGCCGGCTGCCATGGCCAGG - Exonic
920827227 1:209433542-209433564 ACTGGCTGGGGGGCAGGGCTTGG - Intergenic
921671122 1:217925126-217925148 TCTCGCTGGCTGTCACGGCGGGG - Intergenic
924343555 1:243055174-243055196 ACTTGCTGGGAGGCAGGGCCGGG + Intergenic
1064289775 10:14023035-14023057 TCTGCCTGGCTGCCACTGCCTGG - Intronic
1066732562 10:38448927-38448949 ACTTGCTGGGAGGCAGGGCCGGG - Intergenic
1067346347 10:45441583-45441605 CCTGGCTGAATGGCACGGGCTGG - Intronic
1068259827 10:54565409-54565431 ACTGGCTGGCTGTTAAGGTCAGG - Intronic
1070794529 10:79209072-79209094 ACTGGCTGGGTGGCGGGGCAGGG + Intronic
1073468626 10:103709009-103709031 CCTGGCTTGCAGGCACAGCCTGG + Intronic
1073472633 10:103732550-103732572 ACTGGCTGGCCAGCAAGGGCAGG + Intronic
1074503439 10:114045366-114045388 TCGGGCTGTCTGGCCCGGCCCGG + Exonic
1076970427 11:129279-129301 ACTTGCTGGGAGGCAGGGCCGGG + Intergenic
1077058940 11:609395-609417 TCTGGATGGCGGCCACGGCCAGG - Exonic
1077561326 11:3263547-3263569 TCTGGCTGGCTGGGAGGGCAGGG + Intergenic
1077567222 11:3309376-3309398 TCTGGCTGGCTGGGAGGGCAGGG + Intergenic
1079459953 11:20670217-20670239 TCCGGCTGGCGGGCGCGGCCGGG + Intronic
1079485607 11:20933201-20933223 GCTGGCAGGCAGGCACAGCCTGG + Intronic
1083293969 11:61705367-61705389 GCAGGCAGGCTGGCAGGGCCAGG - Intronic
1083300949 11:61739398-61739420 ACTGGCTGGGGGGCAGGGGCAGG - Intronic
1084049115 11:66588260-66588282 ACTGGGCGGCTGGCAGGGCGGGG - Intergenic
1084703759 11:70804139-70804161 GCTGCCTGGCTGGCAGGGGCAGG - Intronic
1087014686 11:93543460-93543482 ACTCGCTGGCTGCCCCCGCCCGG + Exonic
1087208312 11:95419666-95419688 ACTGTCTGACTAGCATGGCCTGG + Intergenic
1089482734 11:118820410-118820432 ACTGGATGGCTGGCCAGGCGCGG - Intergenic
1089616836 11:119699531-119699553 TCTGGCGGGCAGGCACGGCTGGG + Intronic
1091300009 11:134501858-134501880 ACTGGCTGGCATGCAGGGCCAGG - Intergenic
1091318939 11:134636184-134636206 ACTGGGAGGCAGGCAGGGCCGGG - Intergenic
1091370280 11:135051698-135051720 ACTGAGTGGGTGGCACAGCCAGG - Intergenic
1091711357 12:2742708-2742730 TCTCGATGGCTGGCACGTCCAGG + Intergenic
1094108795 12:26839346-26839368 GCTGGCAGGCTGGCACTGCTGGG - Intergenic
1096167375 12:49436582-49436604 ACGGGGTGGCTGGCCGGGCCGGG + Intronic
1097180999 12:57171902-57171924 ACAGGCTGGAGGGCAGGGCCAGG - Intronic
1098412763 12:70202305-70202327 ACTGGGCGGCTGGCCCGGCGGGG - Intergenic
1099127197 12:78777063-78777085 AGAGGCTGGCTGGAAGGGCCTGG + Intergenic
1102014722 12:109640345-109640367 GCTGCCTGGCTGGCAGGGACTGG + Intergenic
1103710599 12:122909824-122909846 ACTAACTGGCTGCCAAGGCCTGG - Intergenic
1103748097 12:123140017-123140039 ACAGGCTGGCTGGGACACCCAGG + Intronic
1104409625 12:128547302-128547324 ACTGGCTGGATGGCACTCACAGG + Intronic
1104774035 12:131381961-131381983 ACAGGCTGGCTGGGGGGGCCAGG - Intergenic
1104810971 12:131620276-131620298 TGTGGATGGCTGGCACCGCCCGG + Intergenic
1104846435 12:131849582-131849604 ACAGGCTGGATGGGATGGCCCGG + Intronic
1105068453 12:133219282-133219304 CCTGGCTGGAGGGCAGGGCCTGG + Exonic
1106810958 13:33358154-33358176 ACTGGTGGGCTGGCACTGCTGGG - Intergenic
1107477616 13:40754736-40754758 ACTGGATGGCTGGCCAGGCGAGG + Intronic
1111441914 13:88291993-88292015 GCTGGCGGGCTGGCACTGCTGGG - Intergenic
1113489627 13:110680918-110680940 AGAGGCTGGCAGGCAGGGCCCGG + Intronic
1113728663 13:112624377-112624399 ACTGGGTGGGTGCCACTGCCTGG + Intergenic
1114522447 14:23347819-23347841 GCTGGCTGGGTGGGAAGGCCCGG - Intronic
1116311017 14:43326778-43326800 GCTGGCAGGCTGGCACTGCTGGG - Intergenic
1121127807 14:91418669-91418691 ACTGGCTGGAAGGCAAGCCCGGG + Intergenic
1123416621 15:20100282-20100304 GCTGGCTGGCTGGCTTGGCTGGG + Intergenic
1123416774 15:20100933-20100955 GCTGGCTGGCTTGGCCGGCCTGG + Intergenic
1123417288 15:20103064-20103086 GCTGGCTGGCTTGCCCGGCTTGG + Intergenic
1123417493 15:20103943-20103965 GCTGGCTGGCTTGCCCGGCTGGG + Intergenic
1123417505 15:20103987-20104009 GCTGGCTGGCTTGCCCGGCTTGG + Intergenic
1123417530 15:20104083-20104105 GCTGGCTGGCTGGGCCGGCTTGG + Intergenic
1123447969 15:20343570-20343592 GCTGGCTGGCTGGCTTGGCTTGG - Intergenic
1123525959 15:21107388-21107410 GCTGGCTGGCTGGCTTGGCTGGG + Intergenic
1123526113 15:21108039-21108061 GCTGGCTGGCTTGGCCGGCCTGG + Intergenic
1123526868 15:21111221-21111243 GCTGGCTGGCTTGCCCGGCTGGG + Intergenic
1123526880 15:21111265-21111287 GCTGGCTGGCTTGCCCGGCTTGG + Intergenic
1123925676 15:25108108-25108130 AATGGCTGACTAGCATGGCCAGG - Intergenic
1124426419 15:29567129-29567151 ACTCACTGGCTGGCACAGCCCGG + Intronic
1127044415 15:55011014-55011036 CCTGGCTGGGTGCCACAGCCTGG + Intergenic
1127565530 15:60184572-60184594 ACTGGCAGGCTGGCAGGGCTAGG - Intergenic
1128374497 15:67065648-67065670 GCTCGCTGGCTGGGCCGGCCCGG - Intronic
1128582916 15:68821197-68821219 GGCGGCTGGCTGGCAAGGCCGGG - Intronic
1129538095 15:76330462-76330484 CCAGGCTGGCTAGCATGGCCTGG - Intergenic
1130076620 15:80695373-80695395 GCTGGCTGGCTGGCTGGCCCGGG - Exonic
1131249820 15:90822956-90822978 ACTCCCAGGCTGGCAGGGCCTGG - Intergenic
1132598156 16:762513-762535 AGTGGCTGGAGGGCAGGGCCAGG + Intronic
1132862890 16:2080190-2080212 ACTGGGAGGCCGGCACGTCCAGG - Exonic
1135299384 16:21312967-21312989 ACCGGTGGGCTGGCACTGCCGGG + Intergenic
1136414242 16:30093987-30094009 GCTGGCTGGCTGGCTCTGCCTGG + Intronic
1136822971 16:33337026-33337048 CCTGGCTGGCTGGCTTGGCTGGG + Intergenic
1136823153 16:33337833-33337855 GCTGGCTGGCTGGCTTGGCTGGG + Intergenic
1136823219 16:33338116-33338138 GCTGGCTGGCTGGCTTGGCTGGG + Intergenic
1136823304 16:33338481-33338503 GCTGGCTGGCTGGCTTGGCTGGG + Intergenic
1136823523 16:33339423-33339445 GCTGGCTGGCTGGCTTGGCTGGG + Intergenic
1137505656 16:49051809-49051831 ACTGGCTCCCTGGCAAGGCCAGG - Intergenic
1137560510 16:49499268-49499290 ACTGTCTGGCAGGCAGGGACGGG - Intronic
1139517496 16:67460427-67460449 ACTGGCTGGCTGGATCTGCAGGG + Intronic
1139527960 16:67528306-67528328 ACTGTCTGGCTGGTAAGTCCAGG - Intronic
1139573164 16:67825839-67825861 GCTGGCAGGCAGGCAGGGCCAGG + Intronic
1141693387 16:85608705-85608727 ACTGCCTGCCTTGCAGGGCCGGG + Intergenic
1142218090 16:88839671-88839693 AGTGGCTGGATGGCCCGGGCTGG - Intronic
1142358123 16:89613678-89613700 ACTTGCTCCCTGGCAGGGCCCGG - Intronic
1142449823 16:90168203-90168225 ACTTGCTGGGAGGCAGGGCCGGG - Intergenic
1203144775 16_KI270728v1_random:1792689-1792711 GCTGGCTGGCTGGCTTGGCTGGG + Intergenic
1142457263 17:63643-63665 ACTTGCTGGGAGGCAGGGCCGGG + Intergenic
1143010175 17:3861890-3861912 CCCGGCTGGTTGGCATGGCCTGG - Intronic
1143741758 17:8959601-8959623 GGAGGCTGGCTGGCTCGGCCAGG + Intronic
1144804663 17:17956678-17956700 ACTGGCGGGCCGGCACTGCTGGG + Intronic
1145798655 17:27670041-27670063 CCTGGCTCCCTGACACGGCCTGG + Intergenic
1145897756 17:28470450-28470472 CCTGGGTGGCTGGCATGCCCTGG - Intronic
1147422348 17:40328138-40328160 ACAGGCTGGCTGGCTCAGCTGGG + Intronic
1147554378 17:41467101-41467123 ACTGGCTGCCTGGCAGGAACTGG + Exonic
1147992556 17:44344001-44344023 GCTGGGTGCCTGGCACGGGCTGG - Intergenic
1148049531 17:44762612-44762634 ACATGCTGGCTGGCAGGGCCTGG + Intronic
1149581298 17:57752164-57752186 ACTGTCTGCCTGGCAAGGCTGGG + Intergenic
1150267471 17:63840862-63840884 GCTGGCTGGCTGGTTAGGCCTGG - Intronic
1151814220 17:76463182-76463204 ACTGACTCGCTGCCACGGCCGGG - Intronic
1151973631 17:77471785-77471807 GCTGGAGGGCTGGCACGGGCTGG + Intronic
1152610969 17:81314868-81314890 ACTGTAGGGCTGGCAGGGCCTGG - Intronic
1152688818 17:81708202-81708224 ATGGCCTGGCTGGAACGGCCAGG + Intergenic
1154278540 18:12980669-12980691 ACAGGGTGGCTGGCAGGGCGGGG + Intronic
1155367613 18:25064124-25064146 AGTGACTGGCTGGCAAGGCAAGG + Intronic
1155428056 18:25726554-25726576 ACTGGCCGGCTGCCACCACCTGG - Intergenic
1157294983 18:46435812-46435834 ACTGCCTTGCTGGCATGCCCTGG - Intronic
1157676577 18:49573059-49573081 GCTGGCTGGCAGGCAAGGCTGGG - Intronic
1158930997 18:62325184-62325206 ACCACCTGGCTGGCACCGCCGGG + Intergenic
1160647623 19:200748-200770 ACTTGCTGGGAGGCAGGGCCGGG + Intergenic
1160941652 19:1622887-1622909 TCTGACTGGTTGGCACTGCCTGG + Intronic
1162775297 19:12975439-12975461 AGGGGCCGGCTGGCACTGCCCGG - Intergenic
1163560592 19:18017160-18017182 GCAGGCTGGCTGGGACAGCCTGG - Intergenic
1166191968 19:41181117-41181139 ACGGGCTGGCTGGCCGGGCGGGG - Intergenic
1166816478 19:45549350-45549372 ACTGGCTGCCTGTCAGGGCAGGG + Intronic
1167857436 19:52254028-52254050 AGGGGCTGGCTGGAACAGCCTGG - Intergenic
1202686719 1_KI270712v1_random:55901-55923 GCTGGCTGGCTGGGCCGGCTTGG + Intergenic
1202687245 1_KI270712v1_random:58211-58233 GCTGGCTGGCTTGCATGGCTTGG + Intergenic
927121574 2:19969029-19969051 CCTGGCTGGTTGGCAGGGTCTGG + Intronic
927713961 2:25341232-25341254 AATGGCAGCCTGGCACGACCCGG - Intronic
927956284 2:27209765-27209787 ACTGGCTGGCTGGCAAGATATGG + Intronic
928445913 2:31333155-31333177 ATTCTCTTGCTGGCACGGCCAGG - Intergenic
930038021 2:47099906-47099928 ACTGGTGGGCTGGCACTGCTGGG - Intronic
930039221 2:47107454-47107476 ACTGGTGGGCTGGCACTGCTGGG - Intronic
930208729 2:48614439-48614461 ACTGGGTGGCTGGCCAGGCGGGG + Intronic
930420879 2:51151805-51151827 GCTGGCGGGCTGGCACTGCTGGG + Intergenic
931747186 2:65300549-65300571 GCTGGCTGGAAGGCCCGGCCCGG - Intergenic
933962563 2:87415052-87415074 GCTGGCTGGCTTGGATGGCCGGG - Intergenic
933963082 2:87417372-87417394 GCTGGCTGGCTTGGATGGCCGGG - Intergenic
933965205 2:87427009-87427031 GCTGGCTGGCTGGCTTGGCTGGG - Intergenic
934265119 2:91505737-91505759 GCTGGCTGGCTTGGATGGCCGGG + Intergenic
934265363 2:91506829-91506851 GCTGGCTGGCTTGGATGGCCGGG + Intergenic
934265601 2:91507881-91507903 GCTGGCTGGCTTGGATGGCCGGG + Intergenic
934265759 2:91508567-91508589 GCTGGCTGGCTTGGATGGCCGGG + Intergenic
934265853 2:91508991-91509013 GCTGGCTGGCTTGGATGGCCGGG + Intergenic
934266113 2:91510153-91510175 GCTGGCTGGCTTGGATGGCCGGG + Intergenic
934266292 2:91510993-91511015 GCTGGCTGGCTTGGATGGCCGGG + Intergenic
934266541 2:91512103-91512125 GCTGGCTGGCTTGGATGGCCGGG + Intergenic
934266786 2:91513195-91513217 GCTGGCTGGCTTGGATGGCCGGG + Intergenic
934267024 2:91514246-91514268 GCTGGCTGGCTTGGATGGCCGGG + Intergenic
934267183 2:91514927-91514949 GCTGGCTGGCTTGGATGGCCGGG + Intergenic
934267375 2:91515806-91515828 GCTGGCTGGCTTGGATGGCCGGG + Intergenic
934267792 2:91517705-91517727 GCTGGCTGGCTTGGATGGCCGGG + Intergenic
934268131 2:91519172-91519194 GCTGGCTGGCTTGGATGGCCGGG + Intergenic
934268362 2:91520218-91520240 GCTGGCTGGCTTGGATGGCCGGG + Intergenic
934268564 2:91521101-91521123 GCTGGCTGGCTTGGATGGCCGGG + Intergenic
934268760 2:91521992-91522014 GCTGGCTGGCTTGGATGGCCGGG + Intergenic
934269004 2:91523092-91523114 GCTGGCTGGCTTGGATGGCCCGG + Intergenic
934269260 2:91524219-91524241 GCTGGCTGGCTTGGATGGCCGGG + Intergenic
934269506 2:91525309-91525331 GCTGGCTGGCTTGGATGGCCGGG + Intergenic
934269760 2:91526426-91526448 GCTGGCTGGCTTGGATGGCCGGG + Intergenic
934933936 2:98451190-98451212 GCTGGCTGGCTGGCAGGCCTGGG - Intronic
937112445 2:119377092-119377114 CCTGGCAGGCTGGCCTGGCCTGG + Intergenic
937403804 2:121609615-121609637 ACTGGGTGGCTGGGAGGGTCAGG - Intronic
937947547 2:127353632-127353654 ACGGGGTGGCTGGCCGGGCCGGG - Intronic
939972535 2:148678587-148678609 ACTGGTGGGCTGGCACTGCTGGG + Intronic
943411917 2:187557173-187557195 ACGGGGTGGCTGGCCCGGCGGGG - Intronic
943520613 2:188944611-188944633 TCTGGCAGGCTGGCACTGCTGGG + Intergenic
946029913 2:216695582-216695604 ACTGGCTGGCAGCCAGGGGCCGG - Intergenic
948595794 2:239078678-239078700 AAAGGCTGGCTGGGCCGGCCGGG + Intronic
948802890 2:240440820-240440842 ACTCTCTGGGCGGCACGGCCAGG - Intronic
1172722831 20:37012752-37012774 ACTGGGTGGCTGGCCAGGCGGGG - Intronic
1173933258 20:46839450-46839472 AATGGCAGGCAGACACGGCCAGG + Intergenic
1175302178 20:57950870-57950892 CCTGGCTGGCTGTCTCAGCCAGG - Intergenic
1175624442 20:60478748-60478770 CCTGGCTGGCCGTCACAGCCTGG - Intergenic
1175780458 20:61679145-61679167 AGTGGCTGCGTGGCATGGCCTGG + Intronic
1179944943 21:44666815-44666837 ACAGGCTGGCTGGCAGGGGCTGG + Exonic
1180876431 22:19177255-19177277 CCTGGCTAGCTGGCAGGCCCAGG + Intronic
1181465546 22:23108768-23108790 GCTCTCTGGCTGGCACAGCCTGG + Intronic
1182775898 22:32830734-32830756 ACTGGCTGGCTCCCCAGGCCTGG - Intronic
1182982367 22:34684295-34684317 ACGGGGTGGCTGGCCAGGCCGGG + Intergenic
1183477846 22:38045901-38045923 CCTGGCTTGCTGGCTCGGCTGGG + Intergenic
1183585275 22:38749816-38749838 ACTGGTGGGCTGGCACCACCTGG - Exonic
1184111322 22:42397193-42397215 GCTGGCTGGCTGGCCAGGCTGGG + Intronic
1185238641 22:49728840-49728862 CCTGGCTGGCTGGCTCCCCCGGG - Intergenic
1185239833 22:49736707-49736729 ACAGGCTTGCTGGCAGGGGCAGG + Intergenic
949281497 3:2352564-2352586 ACTGGCGGGCTGGCACTGCTGGG - Intronic
949292761 3:2485082-2485104 ACTGGCCGGCCGGCACTGCTGGG - Intronic
950819570 3:15742667-15742689 ACGGGCAGGCTGGCATGGGCAGG - Intronic
951551874 3:23882722-23882744 GCTGGCAGGCTGGCACTGCTGGG + Intronic
952250543 3:31648792-31648814 CCTGGGTGGCTGGCATGGCATGG - Intergenic
952308920 3:32169939-32169961 ACGGGGTGGCTGGCCGGGCCGGG - Intergenic
961375496 3:126462808-126462830 ACTGGCTGCCTGGCAAAGCCAGG + Intronic
961626131 3:128264920-128264942 TCTGGCTGCCTGGCCCCGCCCGG + Intronic
961823917 3:129588880-129588902 ACGGGGTGGCTGGCAGGGCTGGG + Intronic
961962537 3:130868387-130868409 ACTGGGCGGCTGGCCAGGCCGGG - Intronic
962356380 3:134697903-134697925 GCTGGCTGGCAGGCGGGGCCTGG + Intronic
962623037 3:137198467-137198489 ACGGGCTGGCTGGCCGGGCGGGG + Intergenic
962722420 3:138187872-138187894 ACTGGCTGGGCGGCGCGGCTTGG + Intronic
964993500 3:162844800-162844822 ACTGGCAGGCTGGCACTGCTGGG + Intergenic
967096419 3:186181076-186181098 ACTGGCTTGCTGGCCTTGCCTGG + Intronic
967992456 3:195141687-195141709 ATTGGCTGGCTGGCGCTGGCTGG - Intronic
968370224 3:198219367-198219389 ACTTGCTGGGAGGCAGGGCCGGG - Intergenic
969302752 4:6306998-6307020 ACTGCCTGGCTTGCTGGGCCAGG - Intergenic
969511600 4:7620999-7621021 AGTGGCTGGCAGGCACGGGGGGG + Intronic
969666586 4:8560785-8560807 CCTGGCTCGCTGGCACAGCCGGG + Intronic
972337716 4:38122420-38122442 ACAGTCTGGCTGGCAAGGCAGGG - Intronic
975818813 4:78248269-78248291 CCTGGCTGGTTGGCATGGCGAGG - Intronic
978254876 4:106681640-106681662 ACTGGTGGGCTGGCACTGCTGGG + Intergenic
981620509 4:146692721-146692743 AGGGACTGGCTGGCACAGCCTGG - Intergenic
982223109 4:153141451-153141473 ACTGGCTGGCTGGTTCCGCAAGG - Intergenic
982412543 4:155095149-155095171 AATGGATGGATGGCAGGGCCTGG - Intergenic
983029356 4:162780133-162780155 AGTGGCTGGCTGGCTCAGCCAGG + Intergenic
985203260 4:187505805-187505827 GCTGGCGGGCTGGCACTGCTGGG - Intergenic
990345275 5:54865251-54865273 GCTGGCGGGCTGGCACTGCTGGG - Intergenic
994229976 5:97301323-97301345 ACTGGTGGGCTGGCACTGCTGGG - Intergenic
998456795 5:142279996-142280018 ACGGGCAGGCAGGCAGGGCCAGG + Intergenic
1002181326 5:177432575-177432597 CCAGGCTGGCTGGCACACCCTGG + Intronic
1002279775 5:178123495-178123517 AGGGGCTGCCAGGCACGGCCAGG - Exonic
1002729751 5:181326125-181326147 ACTTGCTGGGAGGCAGGGCCGGG - Intergenic
1004244390 6:13959090-13959112 TCTGGCTGGCTGGCAAGTTCAGG - Intronic
1005117721 6:22356592-22356614 GCTGGCAGGCTGGCACTGCTGGG + Intergenic
1005356334 6:24987184-24987206 CATGGCTGGCTGGCACAGCCAGG + Intronic
1005759815 6:28958019-28958041 ACTGGTGGGCTGGCACTGCTGGG - Intergenic
1008106313 6:47444003-47444025 ACTGGGTGGCTGGCCGGGCAGGG + Intergenic
1008405739 6:51116791-51116813 ACTGGCTGTCTGACAGTGCCTGG + Intergenic
1010209828 6:73354076-73354098 ACTGGCGGGCTGCCCCGGCTCGG - Intronic
1011448213 6:87465907-87465929 ACTGGCTGGCTGTTAAGGCAGGG + Intronic
1012307324 6:97675019-97675041 GCAGGCTGTCTGGCACGGTCTGG + Intergenic
1012481094 6:99667828-99667850 ACTGGCAGGGTGGCACAACCAGG - Intergenic
1014265201 6:119269265-119269287 CCTGGGTGGCTGTCACTGCCTGG + Intronic
1014718572 6:124892148-124892170 ACTGGTGGGCTGGCACTGCTGGG - Intergenic
1015107223 6:129551076-129551098 CCTGGCTGGCTGACACGGCATGG - Intergenic
1015130292 6:129801986-129802008 ACTGGCTGGCAGGCAACTCCAGG + Intergenic
1016265217 6:142224778-142224800 ACTTGCTGGGTGGCATGGACTGG - Intergenic
1017058007 6:150455206-150455228 ACAAGCTGGCTGGCACTGCCAGG - Intergenic
1019189610 6:170244085-170244107 TCTGGTTGGCTGGCGGGGCCCGG + Intergenic
1019433541 7:1010607-1010629 ACTGGCTGCCTGGCTCCCCCTGG + Intronic
1019460821 7:1157961-1157983 GCAGGCTGGCTAGCAGGGCCAGG - Intronic
1019479874 7:1261478-1261500 ACTGGGAGGATGGCACGGGCAGG + Intergenic
1019514840 7:1435049-1435071 GCTGGCTGGCTGGGTGGGCCGGG - Intronic
1020096113 7:5370558-5370580 ACTGGCTGGCATGAACGCCCTGG - Exonic
1021428546 7:20532589-20532611 ACTGGCTGGATTGCCAGGCCTGG + Intergenic
1023400976 7:39792909-39792931 ACTTGCTGGGAGGCAGGGCCGGG - Intergenic
1023927216 7:44678195-44678217 ACTGGGTGTCTGGGATGGCCTGG + Intronic
1024074425 7:45811378-45811400 ACTTGCTGGGAGGCAGGGCCGGG - Intergenic
1024074758 7:45812736-45812758 ACTTGCTGGGAGGCAGGGCCGGG - Intergenic
1024608017 7:51038809-51038831 TCTGTCTGGCTGGCAAGGCCAGG - Intronic
1024648656 7:51387868-51387890 ACTTGCTGGGAGGCAGGGCCGGG + Intergenic
1024896837 7:54270304-54270326 ACTGGGTAGCTGGAATGGCCGGG - Intergenic
1025052603 7:55742693-55742715 ACTTGCTGGGAGGCAGGGCCGGG + Intergenic
1025052986 7:55744150-55744172 ACTTGCTGGGAGGCAGGGCCGGG + Intergenic
1025129888 7:56369700-56369722 ACTTGCTGGGAGGCAGGGCCGGG + Intergenic
1025130185 7:56370929-56370951 ACTTGCTGGGAGGCAGGGCCGGG + Intergenic
1025130505 7:56372227-56372249 ACTTGCTGGGAGGCAGGGCCGGG + Intergenic
1025130824 7:56373521-56373543 ACTTGCTGGGAGGCAGGGCCGGG + Intergenic
1025131142 7:56374818-56374840 ACTTGCTGGGAGGCAGGGCCGGG + Intergenic
1026115636 7:67493550-67493572 TCTGGCAGTCTGGCAGGGCCCGG - Intergenic
1026941907 7:74291888-74291910 ACTGTCAGGGTGGCAGGGCCAGG - Intronic
1030878267 7:114843014-114843036 CCTGGATGGCTCGCATGGCCAGG + Intergenic
1031551309 7:123116555-123116577 AGTGGCTGGCTTGCATGGACAGG - Intronic
1032051468 7:128653246-128653268 ACTTGCTGGGAGGCAGGGCCAGG - Intergenic
1033032303 7:137838898-137838920 AATGGCCGGCTGGCATGCCCTGG - Intronic
1034961797 7:155367689-155367711 ACTGGGTGGCTGGCCGGGCGGGG + Intronic
1035456989 7:159015162-159015184 ACTAGTTGGCTGGCACTTCCTGG + Intergenic
1035662060 8:1355813-1355835 ACTGGCTGGTGGGCATGGCCAGG - Intergenic
1037946248 8:22991301-22991323 ATTAGCAGGCTGGGACGGCCAGG - Intronic
1038870709 8:31490041-31490063 ACTGGTGGGCTGGCACTGCTGGG - Intergenic
1039952921 8:42185724-42185746 ACTGACTGGGTGCCACAGCCTGG - Intronic
1040043473 8:42939596-42939618 ACGGGCTGGCTGGCCGGGCGGGG + Intronic
1040622226 8:49103196-49103218 ACTGGTGGGCTGGCACTGCTGGG + Intergenic
1040731647 8:50454549-50454571 AGTGGCTGGGTGGCAGGGCGTGG + Intronic
1044880876 8:96720976-96720998 ACTGGCATTCTGGCACAGCCAGG - Intronic
1045243887 8:100426050-100426072 GCGGGCTGGCTGGCCTGGCCAGG - Intergenic
1045668139 8:104513736-104513758 ACTGGCTGGCTGGCTGGCCAAGG - Intronic
1046958995 8:120090211-120090233 ACTGGCTGCCTGATACAGCCAGG - Intronic
1047773963 8:128053839-128053861 ACAGGCTGGCTGCCCTGGCCTGG - Intergenic
1049196073 8:141316354-141316376 GGGGGCTGGCTGGCAGGGCCAGG - Intergenic
1049434024 8:142577973-142577995 ACAGGCTGGCAGGCAGGGCAAGG - Intergenic
1049642010 8:143720059-143720081 ACAGGCTGGGTGGCACGCCCTGG + Intronic
1052492696 9:29188935-29188957 ACGGGGTGGCTGGCCCGGCGGGG + Intergenic
1053112143 9:35470505-35470527 ACAGGCAGGCTGGCTCTGCCTGG + Intergenic
1053752373 9:41269400-41269422 AGTGGGTGGGAGGCACGGCCTGG - Intergenic
1054257901 9:62833732-62833754 AGTGGGTGGGAGGCACGGCCTGG - Intergenic
1055501534 9:76906525-76906547 ACTGGCTGGCTGGCGCGTTACGG + Intergenic
1056152802 9:83804732-83804754 ACGGGGTGGCTGGCCCGGCGGGG - Intronic
1057192725 9:93096392-93096414 CCTGGATGGGTGGCCCGGCCCGG + Intronic
1057509635 9:95666648-95666670 ACTGGCTGGGTGCCCCGGGCAGG - Intergenic
1057600038 9:96450095-96450117 ACTGGCTGTCTGGCGCAGCGGGG + Intergenic
1057744847 9:97742698-97742720 AGTGGCTGGCTGGAACAGCCTGG + Intergenic
1058801237 9:108546223-108546245 ACTGGCAGGCTAGCAAGGCAAGG - Intergenic
1059331459 9:113538263-113538285 ACTGGCTGGTTGCCACTGTCAGG + Intronic
1061328469 9:129878316-129878338 ACTGGCAGGCGGGCAGGGACGGG - Exonic
1061365832 9:130172201-130172223 TCCGGCTGGCTGGCGAGGCCGGG + Intergenic
1061714292 9:132509333-132509355 ACTGGCTGGCTGCCCAGCCCGGG + Intronic
1061866092 9:133492451-133492473 CCAGGCTGGCTTGCAGGGCCAGG + Intergenic
1062227272 9:135459959-135459981 CCTGGCTGGCTGGGAAGCCCAGG + Intergenic
1062413519 9:136436524-136436546 TCAGGCTGGCTGCCACAGCCTGG + Intronic
1203552069 Un_KI270743v1:171771-171793 AGTGGTTGGGAGGCACGGCCTGG + Intergenic
1203577723 Un_KI270745v1:21394-21416 ACTTGCTGGGAGGCAGGGCCGGG - Intergenic
1186323246 X:8452677-8452699 ACTGGTGGGCTGGCACTGCTGGG + Intergenic
1188367627 X:29333684-29333706 ACTGGGTGGCTGGCCGGGCGGGG + Intronic
1188367903 X:29334301-29334323 ACTGGGTGGCTGGCCGGGCGGGG + Intronic
1190045864 X:47111190-47111212 ACTGGTTGGCTGGCACTGCTGGG + Intergenic
1190779046 X:53578496-53578518 ACTGGGCGGCTGGCCGGGCCGGG - Intronic
1190877645 X:54471039-54471061 GGTGGCTGGCTGTCATGGCCAGG + Intronic
1192809124 X:74534305-74534327 TATGGCTGGCTGACACAGCCTGG + Intergenic
1196667905 X:118335537-118335559 AGTGGCTGGCTGGTATGGTCGGG - Intergenic
1199104027 X:143840675-143840697 TCTGCATGGCTGGCAAGGCCTGG + Intergenic
1200250917 X:154553234-154553256 CCTGGCTGGCTGGCAGCTCCTGG + Intronic
1201285475 Y:12375196-12375218 ACCGGTTGGCTGGCACTGCTGGG + Intergenic
1201487073 Y:14505824-14505846 ACTGGTGGGCTGGCACTGCTGGG - Intergenic
1202202420 Y:22367344-22367366 GCTGGTTGGCTGGCACTGCTGGG + Intronic