ID: 905938100

View in Genome Browser
Species Human (GRCh38)
Location 1:41840735-41840757
Sequence CAGTGACTGGCTGGCTGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 6, 3: 33, 4: 382}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905938100_905938113 29 Left 905938100 1:41840735-41840757 CCGTGCCAGCCAGCCAGTCACTG 0: 1
1: 0
2: 6
3: 33
4: 382
Right 905938113 1:41840787-41840809 GGAAGGAGGCCAGGCATGCTGGG 0: 1
1: 0
2: 3
3: 61
4: 430
905938100_905938105 -6 Left 905938100 1:41840735-41840757 CCGTGCCAGCCAGCCAGTCACTG 0: 1
1: 0
2: 6
3: 33
4: 382
Right 905938105 1:41840752-41840774 TCACTGGACGACATAACCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 46
905938100_905938106 2 Left 905938100 1:41840735-41840757 CCGTGCCAGCCAGCCAGTCACTG 0: 1
1: 0
2: 6
3: 33
4: 382
Right 905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 74
905938100_905938112 28 Left 905938100 1:41840735-41840757 CCGTGCCAGCCAGCCAGTCACTG 0: 1
1: 0
2: 6
3: 33
4: 382
Right 905938112 1:41840786-41840808 TGGAAGGAGGCCAGGCATGCTGG 0: 1
1: 1
2: 24
3: 216
4: 1941
905938100_905938107 8 Left 905938100 1:41840735-41840757 CCGTGCCAGCCAGCCAGTCACTG 0: 1
1: 0
2: 6
3: 33
4: 382
Right 905938107 1:41840766-41840788 AACCAGAGGAAGCTTGGCACTGG 0: 1
1: 0
2: 0
3: 17
4: 133
905938100_905938110 15 Left 905938100 1:41840735-41840757 CCGTGCCAGCCAGCCAGTCACTG 0: 1
1: 0
2: 6
3: 33
4: 382
Right 905938110 1:41840773-41840795 GGAAGCTTGGCACTGGAAGGAGG 0: 1
1: 0
2: 0
3: 21
4: 263
905938100_905938111 20 Left 905938100 1:41840735-41840757 CCGTGCCAGCCAGCCAGTCACTG 0: 1
1: 0
2: 6
3: 33
4: 382
Right 905938111 1:41840778-41840800 CTTGGCACTGGAAGGAGGCCAGG 0: 1
1: 1
2: 1
3: 20
4: 320
905938100_905938109 12 Left 905938100 1:41840735-41840757 CCGTGCCAGCCAGCCAGTCACTG 0: 1
1: 0
2: 6
3: 33
4: 382
Right 905938109 1:41840770-41840792 AGAGGAAGCTTGGCACTGGAAGG 0: 1
1: 0
2: 1
3: 26
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905938100 Original CRISPR CAGTGACTGGCTGGCTGGCA CGG (reversed) Intronic
900661298 1:3785374-3785396 AAGTGAGTGCCTGGCTGGCCGGG - Intronic
901190594 1:7407700-7407722 CAGAGACCTGCAGGCTGGCACGG - Intronic
902265190 1:15258237-15258259 CAGGGACTGGGGGGCTGGGAGGG - Intronic
902341260 1:15784951-15784973 CACTGACTAGCTGTCTGGTAGGG + Intronic
902715541 1:18270202-18270224 GAGTGAGTGGATGGCAGGCAGGG - Intronic
903005894 1:20298524-20298546 CAGTGCCTGGCTGACTGTGAAGG - Intronic
903303528 1:22396000-22396022 CAGGGGTTGGCTGGCTGTCATGG + Intergenic
903577943 1:24350819-24350841 CAGTGCCTGGCTGCCTACCATGG + Intronic
904337285 1:29806155-29806177 AAGTGACTTGCTGGAAGGCATGG + Intergenic
904760282 1:32798547-32798569 CAGTGACTGTCTGGGTGCGATGG + Intronic
904867893 1:33596359-33596381 CACTGATGGGCTGCCTGGCATGG - Intronic
905879804 1:41456061-41456083 CATTGTGGGGCTGGCTGGCATGG + Intergenic
905938100 1:41840735-41840757 CAGTGACTGGCTGGCTGGCACGG - Intronic
906150195 1:43583197-43583219 CAGAGACTGGCAGGCAGGCACGG - Intronic
906316574 1:44790193-44790215 CAGGGACTGTCTGGCTTGGAAGG - Intergenic
906584204 1:46961923-46961945 GAGCTTCTGGCTGGCTGGCAGGG + Intergenic
907280685 1:53345143-53345165 CAGTGGGTGGTTGCCTGGCAGGG + Intergenic
907389948 1:54151651-54151673 CAGTGACTGGGTGACTGGCAAGG + Intronic
908317861 1:62951593-62951615 TTCTGACTGGCTGGCTGGCTGGG + Intergenic
908533787 1:65058501-65058523 CAGTGACTGACAGGCTGCCCTGG - Intergenic
911048851 1:93652396-93652418 CAGCGATTGGGTGGCTGGCTGGG - Intronic
911056156 1:93710287-93710309 CTGGGCCTGGCTGCCTGGCATGG + Intronic
911183426 1:94881161-94881183 CAGTGACTGGATTTCTGGCCAGG + Intronic
912498888 1:110108765-110108787 CAGTGTCTGGCTGGGTGGATGGG + Intergenic
914047401 1:144103517-144103539 CACTGGCTGGGTGGCTGGCCTGG + Intergenic
914047647 1:144104586-144104608 CACTGGCTGGGTGGCTGGCCTGG + Intergenic
915598866 1:156910087-156910109 CAGTGCCAGGCTGGCTGGATGGG + Exonic
915798247 1:158760522-158760544 CAGTGTCTGAGTGGCTGCCAAGG - Intergenic
916558918 1:165916024-165916046 CTGGGAGTGGCTGGCTGGCTTGG + Intergenic
918259561 1:182783236-182783258 CAGTTGGTGGCTGCCTGGCATGG + Intergenic
921477804 1:215631706-215631728 GAGGGACTGGCTGGCTGCCAGGG - Intronic
922776370 1:228215933-228215955 CAGTGACCTGCAGGCTGACAGGG - Intronic
1062992719 10:1835234-1835256 CCCTGCCTGGCTGCCTGGCATGG + Intergenic
1068259828 10:54565414-54565436 AAGAGACTGGCTGGCTGTTAAGG - Intronic
1068936563 10:62640649-62640671 CAGTGAGTGGCTGCCAGCCAGGG - Intronic
1069718915 10:70537970-70537992 CAGTGACTGGCTTGCTGTGGAGG + Intronic
1069781731 10:70961273-70961295 CATTGCCTGGCTGGCAAGCAGGG + Intergenic
1070430580 10:76333762-76333784 GAGTGGCTGGCTGGCTGACTGGG + Intronic
1070574575 10:77667843-77667865 CAGTATCTGGCTGGATGCCAGGG + Intergenic
1070748624 10:78950703-78950725 CAGTCACTGAGTGCCTGGCATGG - Intergenic
1070761390 10:79026537-79026559 CAGGGCCTGGCTGGGGGGCACGG + Intergenic
1070770499 10:79079660-79079682 GAGTGAGTGGCAGGCAGGCATGG + Intronic
1071345112 10:84685037-84685059 CAGCGACAGGCCGGCTGGCTGGG - Intergenic
1071773289 10:88754378-88754400 CAGGGGAAGGCTGGCTGGCAGGG + Intergenic
1072726399 10:97816681-97816703 TGGTGGCTGGCTGGCTGGTAAGG + Intergenic
1073627138 10:105110900-105110922 CTGTGACTGGCTGGTGGGGAAGG - Intronic
1073713070 10:106067917-106067939 CAGAGACTGGGTGGTTAGCAGGG + Intergenic
1075318096 10:121468180-121468202 CTGTGACTTGCTGGCTTGCTGGG + Intergenic
1076076234 10:127535945-127535967 CAGTGTCTGGCTTCCTGGGAGGG - Intergenic
1076212736 10:128661870-128661892 CAGAGGCTAGCTGGCTGGCAAGG - Intergenic
1076402464 10:130193042-130193064 CAGGGACAGGGTGGCTGCCAGGG - Intergenic
1076499947 10:130929487-130929509 CAGTCCATGGCTGCCTGGCATGG - Intergenic
1077280956 11:1745226-1745248 CTGTGGCTGGCCGGCTGGCATGG - Intronic
1077522193 11:3043075-3043097 CACTGAGGGGCTGGCTGGCAGGG - Intronic
1078084288 11:8224539-8224561 GAGTGGCTGGCTGGCCGGCCAGG + Exonic
1078091194 11:8265759-8265781 CAGGGCCTGACAGGCTGGCAAGG + Intronic
1078403518 11:11047826-11047848 CAATGACCAGCTGGATGGCAGGG + Intergenic
1078550711 11:12278778-12278800 GAGTGACTGAATGGCTGGTATGG + Intronic
1079840788 11:25397091-25397113 CAGTCACTGACTGGCAGGGAAGG - Intergenic
1080265140 11:30392632-30392654 CAGGGACTGGCTTTCTGCCAGGG - Intronic
1080472118 11:32556465-32556487 AATTGGCTGGCTGGCTGGCTGGG - Intergenic
1081813987 11:45928586-45928608 CAGTGGCTGCCTGGCTTGCCTGG - Intronic
1081820714 11:45991492-45991514 CAGTATCTGGCTTGCTGGTAAGG + Intronic
1083272058 11:61577575-61577597 CAGTGACTGGAGGGTTGGCCTGG + Intronic
1083899870 11:65638405-65638427 CACTCACCGGCTGGCTGGCCAGG - Intronic
1084570989 11:69959755-69959777 CAGTGAATGACAAGCTGGCAGGG - Intergenic
1084911057 11:72389633-72389655 CAGCGATTCTCTGGCTGGCATGG + Intronic
1085266514 11:75240876-75240898 CACTTACTGGCTGACTGGCCGGG - Intergenic
1085793419 11:79515882-79515904 GATTCACTGGCTGGCTGCCATGG + Intergenic
1086486069 11:87303346-87303368 CACTGACTGGGTGGCTGGAGAGG - Intronic
1086893702 11:92288259-92288281 CAGTGACATGATGGTTGGCAGGG + Intergenic
1089823274 11:121247387-121247409 CACTGATTGGCTTGCTGGCCAGG + Intergenic
1090446672 11:126770351-126770373 CAGTGACTGACGGGCAGGGATGG - Intronic
1090809031 11:130220737-130220759 CAGTCAGGGGCTGGCTGCCACGG + Intergenic
1090884706 11:130865556-130865578 CAGTGTGCGGCTGGCAGGCACGG - Intergenic
1091195494 11:133727473-133727495 CAGTGAATGGGTGGCTGGCTGGG - Intergenic
1091215692 11:133900034-133900056 CAGTGCCTGACTGAATGGCAGGG + Intergenic
1092435400 12:8443053-8443075 CAGAAACAGGCTGGCTTGCAGGG - Intergenic
1092907973 12:13119285-13119307 CAATGCATGGCTGGCAGGCATGG + Intronic
1093014514 12:14142879-14142901 CAGTGCTTGACTGACTGGCAAGG + Intergenic
1096631183 12:52927605-52927627 CAGAGAAGGCCTGGCTGGCATGG - Intronic
1096798249 12:54091924-54091946 CAGTGACTGGGAGGATGCCAGGG - Intergenic
1097537655 12:60893964-60893986 CACTGACTGCCTAGCTGCCATGG + Intergenic
1100354914 12:93820033-93820055 GAATGACTGGGTGGCTGGTATGG - Intronic
1101631213 12:106496763-106496785 CATTGAGCTGCTGGCTGGCAAGG + Exonic
1102952161 12:117038174-117038196 CAGGGCCTGGCTGGCTGACCCGG - Intergenic
1104643933 12:130484015-130484037 CAGGCACTGGCTTGCTGGCATGG + Intronic
1105792213 13:23812644-23812666 CAGTGTCTGGTTTGCTGGTAGGG - Intronic
1105815639 13:24033775-24033797 AAGTCACAGGCTGGATGGCAGGG - Intronic
1106183575 13:27388413-27388435 CAGGGACTTGCTGGGTGGCCAGG + Intergenic
1111673720 13:91360682-91360704 CAATGAATGGCTGGCTGGGGTGG + Intergenic
1112622503 13:101066530-101066552 CAGTAACTGGCAGGCAGTCATGG - Intronic
1112785233 13:102944079-102944101 CAGTAGCAGGCTGTCTGGCATGG + Intergenic
1113387894 13:109867791-109867813 CAGAGACTGAGTGGCAGGCATGG - Intergenic
1113880609 13:113623523-113623545 CAGTTACTGGAAGGATGGCATGG - Intronic
1114600808 14:23954098-23954120 CAGGGACAGGAGGGCTGGCAAGG - Intronic
1115781069 14:36768805-36768827 TAGCTACTGGCTGGGTGGCATGG + Intronic
1116262929 14:42654171-42654193 GTGTGTCTGGCTGGCTGGCTGGG - Intergenic
1117300461 14:54421089-54421111 CAATGACTGGCTGGGCGTCATGG + Intergenic
1117395387 14:55304477-55304499 GAGGGACTGGCTGGCTGCTATGG - Intronic
1118318408 14:64739182-64739204 CAATGTCTGGCATGCTGGCAGGG - Intronic
1118478795 14:66143502-66143524 AACTGACTAGGTGGCTGGCATGG + Intergenic
1118543426 14:66857812-66857834 CAGCAACTGGCTGCATGGCATGG + Intronic
1121165543 14:91793158-91793180 CAGTGACTTGCTGACTGAGATGG - Intronic
1121455886 14:94038673-94038695 GAGTGCCTGGCTGGGTGCCACGG - Intronic
1121824783 14:97001142-97001164 CAGTGGCAGGCTGTCTGGAAAGG + Intergenic
1121858071 14:97288750-97288772 CAGTGCCTGGCATGCAGGCATGG + Intergenic
1121918183 14:97855205-97855227 CAATGACTTCCTGGCTTGCATGG - Intergenic
1121946903 14:98131861-98131883 CAGTGGCTGTGTGGCTGGAAGGG + Intergenic
1202859694 14_GL000225v1_random:73341-73363 GAGCGTCTGGCTGGCTGTCAGGG - Intergenic
1123416753 15:20100846-20100868 TCTTGGCTGGCTGGCTGGCATGG + Intergenic
1123417434 15:20103658-20103680 GCTTGGCTGGCTGGCTGGCATGG + Intergenic
1123417952 15:20105837-20105859 TCTTGGCTGGCTGGCTGGCATGG + Intergenic
1123447367 15:20340877-20340899 CCTTGGCTGGCTGGCTGGCTGGG - Intergenic
1123447897 15:20343256-20343278 CAGTGGCTGGCTGGCTTGGCTGG - Intergenic
1123526092 15:21107952-21107974 TCTTGGCTGGCTGGCTGGCATGG + Intergenic
1123526698 15:21110477-21110499 TCTTGGCTGGCTGGCTGGCATGG + Intergenic
1123526810 15:21110936-21110958 GCTTGGCTGGCTGGCTGGCATGG + Intergenic
1123527294 15:21112931-21112953 TCTTGGCTGGCTGGCTGGCATGG + Intergenic
1125062185 15:35437736-35437758 CACTGACTGGTTTGCTGGCCTGG - Intronic
1126624641 15:50674417-50674439 CAGGCACTGGCTGGGTGCCACGG - Intronic
1126667017 15:51084629-51084651 GAGTGACTCGGTGGCTGTCAAGG + Intronic
1126672028 15:51125027-51125049 CAGTGGCAGGCTGGCAGGCTGGG - Intergenic
1127565531 15:60184577-60184599 CTCTCACTGGCAGGCTGGCAGGG - Intergenic
1128291373 15:66481011-66481033 CAGTGACCGGATGGGTGGGATGG + Intronic
1129199801 15:73992070-73992092 CGGTGAGTGGCCGCCTGGCACGG - Exonic
1129227116 15:74176478-74176500 CTGTGACTGTCAAGCTGGCAAGG + Exonic
1130912395 15:88279937-88279959 GAGTGATTTGCTGGCTGGCCTGG - Intergenic
1131443647 15:92477537-92477559 TCATGACTGGCAGGCTGGCATGG + Intronic
1132285470 15:100659063-100659085 CAGTGACTGGTGGCCGGGCAGGG + Intergenic
1132347272 15:101115924-101115946 CAGTGACTGTCCTGCTGGCCCGG - Intergenic
1132525134 16:410611-410633 CAGTGAGCGGGTGGCTGTCAGGG - Intronic
1132654459 16:1036087-1036109 CTGTGCCTGGCTGCCTGGCGGGG + Intergenic
1133231474 16:4369081-4369103 GAGTCAGTGGCTGGCTGGCTGGG - Intronic
1134310097 16:13068004-13068026 CAGTTTCCGGCTGGCTGGGATGG + Intronic
1134839173 16:17387615-17387637 CATTGGCTGCCTGGCAGGCAAGG + Intronic
1136071756 16:27791644-27791666 GGGTGACTGGGTGGCTGACAGGG - Intronic
1136146258 16:28318234-28318256 CCCTGGCTGGCTGGGTGGCACGG - Intronic
1136566355 16:31073109-31073131 CAGGGGCTGCCTGGCTGGCGGGG - Intronic
1136567435 16:31078756-31078778 CTGTCACTGGCTGGCAGGCTGGG + Exonic
1136645255 16:31608503-31608525 CAGTGAGGGGCTGGTTGGCTTGG + Intergenic
1136716038 16:32285316-32285338 GCCTGGCTGGCTGGCTGGCATGG + Intergenic
1136822714 16:33335929-33335951 GCCTGGCTGGCTGGCTGGCATGG + Intergenic
1136834343 16:33491242-33491264 GCCTGGCTGGCTGGCTGGCATGG + Intergenic
1136834410 16:33491509-33491531 GCTTGACTGGCTGGCTGGCTTGG + Intergenic
1137620101 16:49870480-49870502 CAGTGACAGCATGGCTGCCAGGG + Intergenic
1137775496 16:51050833-51050855 CATTAACTGGCTGGGTGGCCTGG + Intergenic
1138531111 16:57634910-57634932 CATAGCCTGGCTGTCTGGCAAGG + Intronic
1139344065 16:66290653-66290675 CAGGGAGTGGCTGGCTGGTCTGG - Intergenic
1139801509 16:69526753-69526775 CAGTGTCTCGTTTGCTGGCATGG + Intergenic
1139842770 16:69894873-69894895 CAGTGGCGTGCTGGCTGCCAGGG - Intronic
1141943518 16:87294333-87294355 TGGTGGCTGGCTGGCTGGCTGGG + Intronic
1142080789 16:88147659-88147681 CAGGGACTCCCTAGCTGGCAGGG - Intergenic
1142154755 16:88527900-88527922 CCATGGCTGGCTGGCTGCCAGGG - Intronic
1142284930 16:89167799-89167821 CAGTGTCAGGCTGGCTGGGCAGG + Intergenic
1203010394 16_KI270728v1_random:232528-232550 GCTTGACTGGCTGGCTGGCTTGG - Intergenic
1203010573 16_KI270728v1_random:233286-233308 GCCTGGCTGGCTGGCTGGCATGG - Intergenic
1203144498 16_KI270728v1_random:1791472-1791494 GCTTGACTGGCTGGCTGGCTTGG + Intergenic
1203144668 16_KI270728v1_random:1792225-1792247 GCCTGGCTGGCTGGCTGGCATGG + Intergenic
1143479069 17:7218351-7218373 CCGCTGCTGGCTGGCTGGCAAGG + Intronic
1143640783 17:8195960-8195982 CAGTGGCTGGCTGGGTGCCGTGG + Intergenic
1143848421 17:9791068-9791090 CAGGGACTGGCAGGATGGCAGGG - Intronic
1144493472 17:15733211-15733233 CAGTGAAAGCCTGGCCGGCAGGG + Intronic
1144906790 17:18643441-18643463 CAGTGAAAGCCTGGCCGGCAGGG - Intronic
1145240020 17:21235738-21235760 GAGTGGATGGCTGGCTGGCTGGG - Intergenic
1145328225 17:21849294-21849316 CAGGGCCTGGCTGGCAGCCATGG + Intergenic
1145415160 17:22708584-22708606 CAGGGCCTGGCTGGCAGCCATGG + Intergenic
1146296626 17:31655235-31655257 CACAGACTGGCTGGATGGCTGGG - Intergenic
1146835182 17:36104952-36104974 AAGTCACTGCCAGGCTGGCAGGG + Intronic
1147165678 17:38591956-38591978 CAGTGACTGGCTGCCAGACAGGG - Intronic
1148079027 17:44957360-44957382 GGCTGACTGGCTGGCTGGCCTGG - Intergenic
1148224552 17:45889584-45889606 CAACAACTGCCTGGCTGGCATGG + Intergenic
1150388297 17:64776934-64776956 AGCTGCCTGGCTGGCTGGCAGGG + Intergenic
1151674840 17:75592079-75592101 CAGTGAGTGGCAGGGTTGCAGGG + Intergenic
1153365519 18:4251376-4251398 CAGTGAGTTGCGGGCAGGCAAGG + Intronic
1153708515 18:7772642-7772664 CAGAGGCTGGCTGGCTGGCTGGG + Intronic
1155659926 18:28236687-28236709 CAGTGATTGAGTGGCTGTCAAGG + Intergenic
1156748668 18:40423503-40423525 CACTGGCAGGCTGGCTGGGAGGG - Intergenic
1157676579 18:49573064-49573086 CACAGGCTGGCTGGCAGGCAAGG - Intronic
1158409112 18:57188850-57188872 CTATCACTGGCTGGCTGGAAGGG - Intergenic
1160586248 18:79915119-79915141 CTTTGCCTGGCTGGCAGGCATGG + Intronic
1160628970 18:80232226-80232248 CAGGGACTGGGTGGGTGGGATGG + Intronic
1161605847 19:5214509-5214531 CAGGGACAGGCTGACTGGCAGGG + Intronic
1161739519 19:6012067-6012089 CAGAGACTGTCTGGCCTGCAAGG + Intronic
1162301913 19:9849260-9849282 CGGCCACTGGCTGGCGGGCAAGG - Exonic
1162382674 19:10340709-10340731 CAGTGACCAGCTGCCTGGAAGGG - Intergenic
1162925939 19:13930570-13930592 CACATACTGGCTGGCAGGCATGG - Exonic
1163155823 19:15439466-15439488 TAGTGCCTGGCTGGCTGGCAGGG + Intronic
1163452028 19:17384007-17384029 CTGTGACTGGAGGGCTGGAAAGG + Intergenic
1163509886 19:17728063-17728085 CACTGAGTGGTCGGCTGGCACGG - Exonic
1163550504 19:17964182-17964204 CAGTGAGTGTCAGGATGGCAAGG - Intronic
1163551549 19:17968478-17968500 CAGTAACTTGCTCCCTGGCAGGG + Intronic
1163725382 19:18920477-18920499 CAGTGAGTGGCAGGCTGGACTGG - Intronic
1163729391 19:18940722-18940744 CAGGGACTGGAGGGGTGGCAGGG - Intronic
1164983066 19:32628503-32628525 CACTGGCGGGCTGGCTGCCAGGG - Intronic
1164984946 19:32641512-32641534 AAGAGACTGGCTGGCAGGGATGG - Intronic
1165105697 19:33468600-33468622 GAGTCAGCGGCTGGCTGGCATGG - Intronic
1165345855 19:35248600-35248622 AAGTGACTGGCCCGCTGGGAGGG - Intronic
1166125892 19:40715155-40715177 CAGCAACTCGCTGACTGGCACGG + Intronic
1166816476 19:45549345-45549367 CGATGACTGGCTGCCTGTCAGGG + Intronic
1167331965 19:48861595-48861617 CAGTGGCTGGCTGGCTGGCTTGG - Intronic
1202687344 1_KI270712v1_random:58595-58617 CACTGGCTGGGTGGCTGGCCTGG + Intergenic
1202687372 1_KI270712v1_random:58711-58733 CACTGGCTGGGTGGCTGGCCTGG + Intergenic
925407814 2:3617350-3617372 ATCTGTCTGGCTGGCTGGCAGGG - Intronic
925903943 2:8527928-8527950 CAGTGACTACAGGGCTGGCAAGG + Intergenic
926197264 2:10771595-10771617 CAGGGACAGGGAGGCTGGCAGGG - Intronic
927121572 2:19969024-19969046 CTCTGCCTGGCTGGTTGGCAGGG + Intronic
930151743 2:48066988-48067010 CAGTGTCTGGCTGGCTGTTTTGG + Intergenic
930541394 2:52711386-52711408 CAGTCTCTGGCTAGCAGGCAGGG - Intergenic
931226791 2:60338687-60338709 CAGTGACAGGGTGGGAGGCAAGG + Intergenic
933958806 2:87396101-87396123 CCTTGTCTGGCTGGCTGGCTTGG - Intergenic
933959596 2:87399523-87399545 GCTTGGCTGGCTGGCTGGCATGG - Intergenic
933960647 2:87406315-87406337 GCTTGACTGGCTGGCTGGCTTGG - Intergenic
933960692 2:87406515-87406537 GCTTGGCTGGCTGGCTGGCATGG - Intergenic
933960783 2:87406920-87406942 AAGTGGCTGGCTGGCTGGCTTGG - Intergenic
933960849 2:87407210-87407232 GATTGGCTGGCTGGCTGGCTTGG - Intergenic
933961920 2:87412190-87412212 GCTTGACTGGCTGGCTGGCTTGG - Intergenic
933962948 2:87416814-87416836 GCTTGACTGGCTGGCTGGCTTGG - Intergenic
933963206 2:87417892-87417914 GCTTGGCTGGCTGGCTGGCATGG - Intergenic
933963502 2:87419137-87419159 GTTTGGCTGGCTGGCTGGCATGG - Intergenic
933963542 2:87419321-87419343 AAGTGGCTGGCTGGCTGGCTTGG - Intergenic
933964781 2:87425067-87425089 GAGTGGCTGGCTGGCTGGCTTGG - Intergenic
933964894 2:87425576-87425598 GAGTGGCTGGCTGGCTGGCTTGG - Intergenic
934242970 2:90288255-90288277 CCTTGTCTGGCTGGCTGGCTTGG - Intergenic
934243054 2:90288620-90288642 CACTGGCTGGGTGGCTGGCCTGG - Intergenic
934244163 2:90293567-90293589 GCTTGGCTGGCTGGCTGGCATGG - Intergenic
934244982 2:90298196-90298218 GATTGACTGGCTGGCTGGCTTGG - Intergenic
934263751 2:91498781-91498803 GCTTGACTGGCTGGCTGGCTTGG + Intergenic
934264688 2:91503864-91503886 GCTTGGCTGGCTGGCTGGCATGG + Intergenic
934264745 2:91504108-91504130 GCGTGGCTGGCTGGCTGGCTTGG + Intergenic
934270059 2:91527784-91527806 CACTGGCTGGGTGGCTGGCCTGG + Intergenic
934270225 2:91528506-91528528 CCTTGTCTGGCTGGCTGGCTTGG + Intergenic
936018871 2:108979839-108979861 CAGAGCCAGGCTGGCTGTCAGGG - Intronic
936738296 2:115473623-115473645 CTCTGTCTGGCTGGCTGCCATGG + Intronic
937259796 2:120578133-120578155 CAGTGACAGCCTGCATGGCAGGG + Intergenic
937441081 2:121916813-121916835 CAGTCACTGGCTGCCAGGCTGGG - Intergenic
937710595 2:124976295-124976317 CCCTGGGTGGCTGGCTGGCAGGG - Intergenic
937873696 2:126804460-126804482 CATTGACTGGCTGAATGGCGTGG - Intergenic
939039976 2:137176881-137176903 TTGTGACTGGCTCCCTGGCATGG + Intronic
941111238 2:161420559-161420581 CTGGGGCTGGCTGGCTGGCTGGG + Intronic
941708759 2:168689000-168689022 CAGTGACAGGCAGGAGGGCAAGG - Intronic
946105314 2:217364108-217364130 AAGTGACTGTCTGGCTGCTATGG - Intronic
946131540 2:217610586-217610608 CAGTGACTTGCTGAGTGACATGG + Intronic
946168888 2:217882030-217882052 GAGGGAGTGGCTGGCGGGCAGGG - Intronic
946353785 2:219172387-219172409 CAGTGGCTGGCTGCTTGGCCAGG - Exonic
946409807 2:219510349-219510371 CAGAGACAGGCTGGCCGGGAGGG - Intergenic
946432914 2:219635084-219635106 CAGTGGCTTGCTGGCCTGCAGGG + Intronic
946823830 2:223656346-223656368 CAGTGATTGTCTGGGTGGCAGGG + Intergenic
1171208517 20:23299500-23299522 CAGGAGCTGGCTGGCTGTCAGGG + Intergenic
1171798157 20:29582417-29582439 CAGTGACTGGGAGGATGCCAGGG + Intergenic
1171850080 20:30301744-30301766 CAGTGACTGGGAGGATGCCAGGG - Intergenic
1172357178 20:34288267-34288289 CTGTGACTGGGTGGGTGTCAGGG + Intronic
1172875349 20:38160751-38160773 CAGTGCCTGGCTGGGTTGCGTGG + Intronic
1173842099 20:46164328-46164350 CTGTGATTGGCTGGGTGGGATGG + Intergenic
1173901712 20:46595406-46595428 CAGTGACTGGGTGGCCGGTCAGG - Intronic
1175100579 20:56576092-56576114 CAGGGAGGGGCTGGCTGGGAAGG - Intergenic
1175710596 20:61217354-61217376 CAGTTAGTGGCTGGTTGCCAAGG - Intergenic
1175799204 20:61791675-61791697 CAGTGAGGGGCAGGCTGGGATGG + Intronic
1176076358 20:63250118-63250140 CAGTACCTGGCTGGCGGGCCTGG - Intronic
1176365120 21:6028045-6028067 CAGTCAGTGGCTGCCTTGCAGGG + Intergenic
1176411958 21:6453968-6453990 CGGTGAGTGGGTGGCGGGCACGG - Intergenic
1177129507 21:17239521-17239543 CAGTGGCTGGTTAACTGGCAAGG + Intergenic
1179148267 21:38787993-38788015 GTGTGACTGGCTGGCCTGCACGG + Intergenic
1179687452 21:43062290-43062312 CGGTGAGTGGGTGGCGGGCACGG - Exonic
1179758398 21:43510500-43510522 CAGTCAGTGGCTGCCTTGCAGGG - Intergenic
1179925346 21:44531097-44531119 CACTGACAGGGTGGCTGGGAAGG + Exonic
1180046505 21:45308732-45308754 CAGTGCCTGGCAGGCTGGGCTGG + Intergenic
1180553550 22:16559326-16559348 GGGTGACTGGCTTGCTGGCTTGG - Intergenic
1180553558 22:16559365-16559387 GGGTGACTGGCTTGCTGGCTTGG - Intergenic
1180554282 22:16562914-16562936 CACTGACTGGCTGGCTTGGCTGG - Intergenic
1180554575 22:16564185-16564207 GTGTGGCTGGCTGGCTGGCTTGG - Intergenic
1180555235 22:16566991-16567013 CGCTGGCTGGCTGGCTGGCCTGG - Intergenic
1181345093 22:22214377-22214399 CAGTGACTCTCTGGCTACCATGG + Intergenic
1181558935 22:23688486-23688508 CAGTGCCTGGCAGGATGGGAAGG + Intronic
1182842339 22:33401499-33401521 TGCTGACTGGCTGGTTGGCATGG - Intronic
1183485570 22:38086148-38086170 CTGTCACCGGCTGTCTGGCAGGG - Intronic
1183951134 22:41353718-41353740 CTGGGCCAGGCTGGCTGGCAGGG + Intronic
1184767659 22:46579967-46579989 CAGGGACTGGCTGGGTGGCCTGG + Intronic
1184975381 22:48057929-48057951 CAGTGCCTGCGTGGCTGGCTCGG + Intergenic
1185109267 22:48891843-48891865 CAGGGAGTGCTTGGCTGGCAGGG + Intergenic
949305279 3:2633284-2633306 CAGTGCCTAGCTAGCAGGCAAGG - Intronic
949933930 3:9101993-9102015 CAGTGAGAAGCTGGCAGGCAGGG + Intronic
950420936 3:12899195-12899217 CCTTGGCTGGCTGGCTGGCCAGG - Exonic
950971237 3:17190479-17190501 CAGTGACTGCCTGGTTGCCTAGG - Intronic
951640413 3:24829519-24829541 CAGGGACCGGCTGCCTAGCAGGG + Intergenic
953384777 3:42500325-42500347 CAGTGAATGGCTGGTGGGCAGGG - Intronic
953451454 3:43009901-43009923 CAGTGAGTTGCTGGGGGGCAGGG + Intronic
953548995 3:43885959-43885981 CTGTGACTGGGGGGCAGGCAGGG - Intergenic
954711773 3:52508422-52508444 CAGTGACTGGCTGTGTGTCTGGG + Intronic
954761248 3:52875932-52875954 CAGTGTGAGGGTGGCTGGCAAGG + Intronic
955756257 3:62228011-62228033 CAGAGACTGGCAAACTGGCAAGG - Intronic
956181593 3:66522795-66522817 AAGTGACAGGCAGGCGGGCAGGG + Intergenic
956478681 3:69651140-69651162 CACTTACTAGCTGGGTGGCATGG - Intergenic
958039778 3:88212954-88212976 CAGTGACTTGATGGCTGCTAGGG + Intergenic
958610696 3:96421443-96421465 CAGAGACTTGCTGACTTGCATGG - Intergenic
959806718 3:110562898-110562920 CTGGCACTGGCTGCCTGGCATGG - Intergenic
961110886 3:124282139-124282161 CAGTGACTGGCTGGATGTCAGGG + Intronic
961823915 3:129588875-129588897 CTGGGACGGGGTGGCTGGCAGGG + Intronic
962849728 3:139299377-139299399 CAGTCGCTGGCTGCCAGGCATGG + Intronic
967007709 3:185399930-185399952 GAGTGACTGGCTGGATGTGATGG - Intronic
967150069 3:186640395-186640417 CAGGGACTGGCTGGCTTGTAAGG - Exonic
968530769 4:1090234-1090256 GAGTGACTGGCTGGCAAGCAGGG + Intronic
968548337 4:1209993-1210015 CAGTGTCTGGCTGCCTCTCAGGG + Intergenic
969161256 4:5260985-5261007 CAGTGATTGGCTGATTGACATGG - Intronic
969454001 4:7290890-7290912 TAGTCCCTGGCTGGCTGGCTGGG + Intronic
969630701 4:8334251-8334273 CAGTGACTGGCTAGAAGGAAGGG + Intergenic
972148410 4:36058913-36058935 CAGAGATTGTCTGCCTGGCAAGG + Intronic
976459559 4:85293475-85293497 CAGTGCCAGGCTGGCTCCCATGG + Intergenic
976588341 4:86823665-86823687 CAGGGACTAGCTGGCTGGACTGG - Exonic
976756191 4:88500272-88500294 CAGTCACTGGCAGGCTGGTTGGG + Intronic
976812417 4:89111328-89111350 CAGTGCCTCCCTGGCCGGCAGGG - Intronic
978153039 4:105459870-105459892 CAGTCACTGGTTGGTTGCCAGGG + Intronic
978447041 4:108789586-108789608 CAGTGTCTGTCTGGTTGCCAAGG + Intergenic
978768545 4:112430218-112430240 AAGTGACTGGCTGGCATGAAGGG - Intronic
979448427 4:120840497-120840519 CAGTGACTGCATGGCTGGCCGGG + Intronic
985803424 5:2021289-2021311 CAGTGACTGAGGGGCTGGAAAGG - Intergenic
986659302 5:10044806-10044828 CAGTCATTGGGTGGCTGTCAGGG + Intergenic
986714112 5:10510332-10510354 CTGTGTCTGGGTGACTGGCAGGG + Intronic
986758017 5:10855823-10855845 CAGTCAATGACTGGTTGGCATGG + Intergenic
986799325 5:11243307-11243329 CTGAGTCTTGCTGGCTGGCAGGG + Intronic
986928924 5:12794709-12794731 CAGGGACTGGCGGGGTGGCTCGG + Intergenic
991455567 5:66799795-66799817 CAGTGCCTGGCTGCCTGGGTTGG + Intronic
992018275 5:72597466-72597488 CAGTGACAGGCTTTCTTGCAAGG + Intergenic
992509543 5:77419422-77419444 CAGGAAATGGCAGGCTGGCACGG - Intronic
996029853 5:118692943-118692965 CTGTCACTGTCTGGCTGGCAGGG + Intergenic
997481094 5:134185085-134185107 CACTGAATGACTGACTGGCATGG - Intronic
997677556 5:135724570-135724592 CAGTGTGTGCCTGGCTGACATGG + Intergenic
998384732 5:141750257-141750279 CAGAGACTTGCTCCCTGGCAGGG + Intergenic
998453974 5:142256194-142256216 CAGTTCCTTGCTGGCTGGCAAGG - Intergenic
998456794 5:142279991-142280013 CAGTGACGGGCAGGCAGGCAGGG + Intergenic
999318927 5:150601324-150601346 CAGGGCCTGGCTGTCTGGGACGG + Intronic
999451163 5:151679339-151679361 GAGTGAGTGACTGGGTGGCAGGG + Intronic
999600186 5:153253947-153253969 CAGTGCCAGGCTGGCTCCCAGGG - Intergenic
999838316 5:155398417-155398439 CAGTAACAGGCTGGTTAGCAAGG - Intergenic
1000131085 5:158300362-158300384 CAGTGACCGGCTGGAAAGCAAGG - Intergenic
1000903238 5:166933592-166933614 CATTGCCGGGGTGGCTGGCATGG + Intergenic
1001009772 5:168086971-168086993 CAGTGAGAAGCTGGCTTGCAAGG - Intronic
1001343432 5:170867933-170867955 CAGTGATTTCCTGGCTGGGAGGG - Intronic
1002419638 5:179138909-179138931 CAGTTACCAGCTGGCGGGCAGGG - Intronic
1002927363 6:1612040-1612062 CAGAGACTGGCTGGAAGGGAAGG - Exonic
1006294609 6:33164592-33164614 CAGGGAATGGCTGGAAGGCAAGG + Intronic
1006716227 6:36122477-36122499 CGGTGACTGGCCGAATGGCAGGG - Intergenic
1006729111 6:36222348-36222370 CAAGGACTGGCTGCCTGGTACGG - Intronic
1008555369 6:52668695-52668717 CACTGACTGGCTGGCTGCTCAGG - Intergenic
1008886109 6:56432762-56432784 CAGCGTCTGTCTGGTTGGCAAGG + Intergenic
1012385222 6:98673320-98673342 CACTGACTGACTGCCAGGCATGG - Intergenic
1015863553 6:137705213-137705235 CTTTCAGTGGCTGGCTGGCAGGG - Intergenic
1016935224 6:149444942-149444964 TATTAACTGGCTGGCTGACATGG - Intergenic
1017245055 6:152215809-152215831 CATTTACTAGCTGGCTGGCCTGG - Intronic
1017634647 6:156431852-156431874 CAGTGTCTGACTTCCTGGCAGGG - Intergenic
1017690712 6:156961464-156961486 CAGCGGCTTGCTGGCTGGCGCGG + Intronic
1018059500 6:160079324-160079346 CAGTGGCTGGCTGGCAGGGGTGG + Intronic
1018686811 6:166309617-166309639 CAGAGACAGGCTGGCAGGGATGG - Intergenic
1019049265 6:169170511-169170533 CAGTGACTTGCTGGAGGGCGAGG - Intergenic
1019165375 6:170094788-170094810 AGGTGTCTGGCTGGCTGGCAGGG - Intergenic
1023897539 7:44446562-44446584 GGGTGGCTGGATGGCTGGCAGGG + Intronic
1024061887 7:45704230-45704252 CAGTGCCTGGCTGGCTGTCGGGG - Intronic
1024308989 7:47951998-47952020 CAGTGACTGGCAGTCTTGCTAGG - Intronic
1025709296 7:63892090-63892112 CACTGAGTGCCTGGGTGGCAGGG + Intergenic
1026438393 7:70420325-70420347 CAGCTCCTGGCTGGATGGCAGGG - Intronic
1027960417 7:84939613-84939635 CAGGGATGGGCAGGCTGGCATGG - Intergenic
1028875921 7:95823328-95823350 CAATGCCTGGCTGGCTGGCACGG + Intronic
1029632526 7:101761990-101762012 AAGTGACTGGCAGCCAGGCAGGG + Intergenic
1033760819 7:144434945-144434967 AACTGAGTGGCTGGATGGCAGGG - Intergenic
1035391823 7:158509266-158509288 CTGTGACTGACGGGCCGGCAAGG - Intronic
1035662061 8:1355818-1355840 GAGGGACTGGCTGGTGGGCATGG - Intergenic
1036397443 8:8381339-8381361 TGGTGACTGGCTGGCAGCCAGGG - Intronic
1036768827 8:11565287-11565309 CACTGACAAGCTGGGTGGCAAGG - Intergenic
1037690474 8:21177452-21177474 CAGTGAGGACCTGGCTGGCAAGG - Intergenic
1041505019 8:58587194-58587216 CAGTGACCAGCTGTCTGGGATGG - Intronic
1043097554 8:75994656-75994678 CAGTGATTGGCTGGCTGTGAGGG - Intergenic
1044429325 8:92090103-92090125 CACTGACTTGCTGGGTGGCCTGG - Intronic
1045294187 8:100859785-100859807 ATGTTACTGGCTGACTGGCAGGG + Intergenic
1045509907 8:102806358-102806380 CACTGAGTGGGTGGCTGGGAAGG - Intergenic
1045560273 8:103255120-103255142 CAATGCCTGGCTTGTTGGCAAGG - Intergenic
1046753824 8:117953287-117953309 CAGTGAATGGCAGTCTAGCATGG - Intronic
1047208950 8:122825316-122825338 TAGTGCCTGGCTGCCTGGCTGGG + Intronic
1048034983 8:130669178-130669200 CAGTGACTGGCCGGGTGAGATGG + Intergenic
1048055131 8:130855725-130855747 CAGTGACTGGCTGGATGTGGGGG - Intronic
1049554044 8:143273508-143273530 GAGTGAGTGGCTGGCTGGACTGG + Intronic
1049565409 8:143335443-143335465 GAGTGAGAGGCTGGTTGGCAGGG - Intronic
1049575141 8:143386392-143386414 CAGTGGCCGGTGGGCTGGCAAGG + Intergenic
1049693117 8:143971410-143971432 CCGTCACTGGCTGGCTGGCAAGG + Intronic
1049795351 8:144494807-144494829 CTGTGAGTGGCTGGCAGGGAGGG + Intronic
1053787855 9:41665037-41665059 CAGTGACTGGGAGGATGCCAGGG - Intergenic
1054157275 9:61649730-61649752 CAGTGACTGGGAGGATGCCAGGG + Intergenic
1054176131 9:61876379-61876401 CAGTGACTGGGAGGATGCCAGGG - Intergenic
1054477049 9:65580735-65580757 CAGTGACTGGGAGGATGCCAGGG + Intergenic
1054661408 9:67704429-67704451 CAGTGACTGGGAGGATGCCAGGG + Intergenic
1057250548 9:93497790-93497812 CTGAGACTTCCTGGCTGGCAGGG - Intronic
1057312557 9:93951358-93951380 CAGCGACTCTCTGGCTGGCAAGG + Intergenic
1057411228 9:94817975-94817997 CAGTGGCTGGATGGCTTCCAAGG - Intronic
1057509637 9:95666653-95666675 CAGTAACTGGCTGGGTGCCCCGG - Intergenic
1057729446 9:97596161-97596183 AGGTGACTGGCTGGCTGGGGTGG - Intronic
1057828443 9:98389077-98389099 CAGGGCCTGGCTGGATGTCAGGG - Intronic
1059429254 9:114240331-114240353 CAGGGGCTGGCTGCCTGGCTTGG + Intronic
1059908934 9:119021110-119021132 CACAGAGTGGCTAGCTGGCATGG + Intergenic
1060408840 9:123386739-123386761 CAGTGACCTGCTGGCAGGAAAGG + Intronic
1060797716 9:126523855-126523877 CCGTGACTGGCTGCCTTGTAAGG - Intergenic
1061868763 9:133509080-133509102 CAGAGGCTGGCTGGCTGGAAAGG - Intergenic
1062475513 9:136724920-136724942 CAGGGATGGGCAGGCTGGCATGG - Intergenic
1062506939 9:136882390-136882412 CAGTGAGTGGCTGGCATCCACGG + Intronic
1185525046 X:771859-771881 CAGTGGCTGGATGGTTGGCAGGG - Intergenic
1189232975 X:39466407-39466429 CAGTGAGTGGGGGGCTGTCAAGG - Intergenic
1189364725 X:40379852-40379874 CAGGGACTGGCTGGCTAGAAGGG + Intergenic
1190107692 X:47571508-47571530 CATTGATTGGCTGGTGGGCAAGG - Exonic
1190266356 X:48829445-48829467 CAGTGCCTGGCTGTCTGTGATGG + Exonic
1192207703 X:69107183-69107205 CAGTGGCTGGCCGGCTGGCCAGG - Intergenic
1192248459 X:69391805-69391827 TAGTGATTGCCTAGCTGGCATGG + Intergenic
1194979785 X:100428492-100428514 CAGTGACTGGCATCCTTGCAAGG - Intergenic
1195321849 X:103727324-103727346 CATTGGCTGGCAGGCAGGCAGGG - Intronic
1195684864 X:107576415-107576437 AAGTGGCTGGCTGGCAGGCCTGG - Exonic
1196206087 X:112941713-112941735 CAGTGATTGGCTGGGCGCCATGG + Intergenic
1197892233 X:131279043-131279065 CAGGGAGTGGCTGGTTGGGAGGG - Intronic
1198620383 X:138501837-138501859 TAGTGACTGGATGGATGTCATGG + Intergenic
1199891938 X:152093403-152093425 GAATGACTGGCTGAATGGCAGGG - Intergenic
1199976118 X:152895873-152895895 CAGGGCCTGGCAGCCTGGCAGGG + Intergenic
1199981358 X:152922297-152922319 CAGTGACTGAGTGGCAGGTATGG - Intronic
1200073120 X:153538674-153538696 CAGGGGCTGGCCGGTTGGCATGG - Intronic
1200211503 X:154348737-154348759 CAGTGACAGGCGGGCGGCCAGGG + Exonic
1201238068 Y:11930698-11930720 CATTGACTGGCAGAATGGCATGG + Intergenic
1201411774 Y:13705434-13705456 CATCGCCTGTCTGGCTGGCAGGG + Exonic