ID: 905938101

View in Genome Browser
Species Human (GRCh38)
Location 1:41840736-41840758
Sequence CGTGCCAGCCAGCCAGTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 142}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905938089_905938101 18 Left 905938089 1:41840695-41840717 CCCCTGGCCAGTGACACCCACGG 0: 1
1: 0
2: 2
3: 14
4: 172
Right 905938101 1:41840736-41840758 CGTGCCAGCCAGCCAGTCACTGG 0: 1
1: 0
2: 1
3: 13
4: 142
905938091_905938101 17 Left 905938091 1:41840696-41840718 CCCTGGCCAGTGACACCCACGGA 0: 1
1: 0
2: 1
3: 19
4: 136
Right 905938101 1:41840736-41840758 CGTGCCAGCCAGCCAGTCACTGG 0: 1
1: 0
2: 1
3: 13
4: 142
905938094_905938101 2 Left 905938094 1:41840711-41840733 CCCACGGAGCCCATCAGATCCTG 0: 1
1: 0
2: 1
3: 6
4: 80
Right 905938101 1:41840736-41840758 CGTGCCAGCCAGCCAGTCACTGG 0: 1
1: 0
2: 1
3: 13
4: 142
905938097_905938101 -7 Left 905938097 1:41840720-41840742 CCCATCAGATCCTGGCCGTGCCA 0: 1
1: 0
2: 0
3: 8
4: 83
Right 905938101 1:41840736-41840758 CGTGCCAGCCAGCCAGTCACTGG 0: 1
1: 0
2: 1
3: 13
4: 142
905938098_905938101 -8 Left 905938098 1:41840721-41840743 CCATCAGATCCTGGCCGTGCCAG 0: 1
1: 0
2: 0
3: 10
4: 172
Right 905938101 1:41840736-41840758 CGTGCCAGCCAGCCAGTCACTGG 0: 1
1: 0
2: 1
3: 13
4: 142
905938092_905938101 16 Left 905938092 1:41840697-41840719 CCTGGCCAGTGACACCCACGGAG 0: 1
1: 0
2: 0
3: 17
4: 169
Right 905938101 1:41840736-41840758 CGTGCCAGCCAGCCAGTCACTGG 0: 1
1: 0
2: 1
3: 13
4: 142
905938093_905938101 11 Left 905938093 1:41840702-41840724 CCAGTGACACCCACGGAGCCCAT 0: 1
1: 0
2: 0
3: 6
4: 119
Right 905938101 1:41840736-41840758 CGTGCCAGCCAGCCAGTCACTGG 0: 1
1: 0
2: 1
3: 13
4: 142
905938095_905938101 1 Left 905938095 1:41840712-41840734 CCACGGAGCCCATCAGATCCTGG 0: 1
1: 0
2: 0
3: 12
4: 182
Right 905938101 1:41840736-41840758 CGTGCCAGCCAGCCAGTCACTGG 0: 1
1: 0
2: 1
3: 13
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905938101 Original CRISPR CGTGCCAGCCAGCCAGTCAC TGG Intronic
902441706 1:16434405-16434427 AGTCCCAGCCAGCCACTCAGAGG - Intronic
902465082 1:16612702-16612724 CCAGCCAGCCAGCCAGACGCAGG + Intronic
902564779 1:17304340-17304362 CAGGCTAGCCAGCCAGTCTCTGG + Intergenic
903811352 1:26036616-26036638 CCTGCCAGTGAGACAGTCACGGG - Intergenic
905938101 1:41840736-41840758 CGTGCCAGCCAGCCAGTCACTGG + Intronic
906670423 1:47650324-47650346 GGTGCCAGCCAGCCCCTGACTGG - Intergenic
907389947 1:54151650-54151672 CTTGCCAGTCACCCAGTCACTGG - Intronic
910062711 1:83112916-83112938 CCTGCGGTCCAGCCAGTCACTGG + Intergenic
910483998 1:87691063-87691085 CAAGCAAGCCAGCCAGTCATTGG + Intergenic
912495074 1:110086280-110086302 TGTCCCAGCCTGCCAGGCACGGG + Intergenic
914422354 1:147541246-147541268 CCTGCGAGCCTGCCTGTCACTGG + Intergenic
922167325 1:223127171-223127193 CCTGCCAGCGAGCCTGTGACTGG - Intronic
1062992717 10:1835233-1835255 CATGCCAGGCAGCCAGGCAGGGG - Intergenic
1064029714 10:11876056-11876078 CGTGCCAGCCCCACAGTCAAAGG - Intergenic
1064124765 10:12650349-12650371 CCTGCCAGAGAGCCAGACACAGG - Intronic
1064953051 10:20875733-20875755 CCAGCCAGCCAGCCAGCCATGGG + Intronic
1069556264 10:69400520-69400542 GGTGCAAGCCAGCCAAGCACTGG - Intronic
1072780348 10:98246958-98246980 CAGGCCAGGCAGCCAGCCACCGG - Intergenic
1073627139 10:105110901-105110923 CTTCCCCACCAGCCAGTCACAGG + Intronic
1075318094 10:121468179-121468201 CCAGCAAGCCAGCAAGTCACAGG - Intergenic
1075782212 10:125024359-125024381 CGTGGCAGCGAGCCAGTGCCAGG - Intronic
1075901830 10:126049395-126049417 GGTGCCAGCCGGCCAGTCATTGG - Exonic
1076212737 10:128661871-128661893 CTTGCCAGCCAGCTAGCCTCTGG + Intergenic
1076270136 10:129145129-129145151 AATGCCACCCAGCCATTCACAGG - Intergenic
1076368113 10:129935306-129935328 GGTCCCAGGCCGCCAGTCACTGG - Intronic
1077110570 11:860380-860402 CCTGCCAGCCAGCCAGTAAAAGG + Intronic
1077533238 11:3107044-3107066 CCAGCCAGCCAGCCAGCCAGCGG + Intronic
1078855650 11:15204692-15204714 CTTGCCAGCCACCCACTCACCGG + Intronic
1079986000 11:27201527-27201549 GGTGGCAGCCAGCCAGACAATGG + Intergenic
1084069998 11:66727979-66728001 CGTGCCAGCCACACAGGTACCGG - Intronic
1084214814 11:67641515-67641537 CTTGCCTGCCAGCCTGTCCCTGG + Intergenic
1085409634 11:76283467-76283489 AGTGCCAGGCAGCCAGGCAGGGG - Intergenic
1090809030 11:130220736-130220758 CGTGGCAGCCAGCCCCTGACTGG - Intergenic
1090884707 11:130865557-130865579 CGTGCCTGCCAGCCGCACACTGG + Intergenic
1091195496 11:133727474-133727496 CCAGCCAGCCACCCATTCACTGG + Intergenic
1101341067 12:103841755-103841777 CGGCCCAGCCACCCACTCACAGG - Intronic
1101846716 12:108368698-108368720 CCAGCTAGCCAGCCAGTCAATGG - Intergenic
1102549193 12:113678778-113678800 CGTGCCAGCCAGTGAGTGATGGG + Intergenic
1104643932 12:130484014-130484036 CATGCCAGCAAGCCAGTGCCTGG - Intronic
1109198463 13:59405365-59405387 CCTTCCAGCCAGCCAGTCATGGG + Intergenic
1111040440 13:82740619-82740641 CCTGCCTGCCAGCCATTCCCAGG - Intergenic
1111947577 13:94681824-94681846 GGAGCCAGCCAGCCACTCCCCGG - Intergenic
1114234396 14:20812061-20812083 CCTGGCAGCAGGCCAGTCACTGG - Intergenic
1122609525 14:102972326-102972348 CGTGCCAGCCACACAGGCAATGG + Intronic
1122905096 14:104797967-104797989 CTTGAGACCCAGCCAGTCACAGG + Intergenic
1125758267 15:42080706-42080728 AGTGTCAGCCAGCCAGTAAGTGG + Intronic
1126624642 15:50674418-50674440 CGTGGCACCCAGCCAGTGCCTGG + Intronic
1129199802 15:73992071-73992093 CGTGCCAGGCGGCCACTCACCGG + Exonic
1129901944 15:79158014-79158036 CATGCCAGCCGGGCAGTGACAGG - Intergenic
1132654457 16:1036086-1036108 CCCGCCAGGCAGCCAGGCACAGG - Intergenic
1136146260 16:28318235-28318257 CGTGCCACCCAGCCAGCCAGGGG + Intronic
1140865004 16:79052409-79052431 TGTGCCAGCCATCCCGTTACTGG + Intronic
1141373693 16:83510084-83510106 CGTTTCAGCCATCCATTCACAGG - Intronic
1142889381 17:2933089-2933111 TGAGCCAGCCAGCCAGACAGTGG + Intronic
1143097576 17:4486562-4486584 CGGGCCTGGCAGCCTGTCACAGG + Exonic
1143848423 17:9791069-9791091 CCTGCCATCCTGCCAGTCCCTGG + Intronic
1145115935 17:20210868-20210890 CATGACTGCCAGACAGTCACTGG - Intronic
1148116458 17:45178140-45178162 CTTGCCAGCCCGGCAGCCACAGG - Intergenic
1148671309 17:49412508-49412530 CTTGTCAGCCAGCCACACACCGG + Intronic
1149505138 17:57188032-57188054 AGTGCCAGCCTCCCAGTCCCTGG - Intergenic
1152227609 17:79099779-79099801 CAGGCCAGCCAGGCAGTCTCAGG - Intronic
1155340015 18:24804313-24804335 CATGCTAGCCTGCCAGTCTCTGG + Intergenic
1155990789 18:32277055-32277077 TGTGACAGCTAGCAAGTCACTGG + Intronic
1156650210 18:39216822-39216844 AGTGCCAGCTAGTCAGTCATTGG + Intergenic
1162723514 19:12676166-12676188 GGGCCCAGTCAGCCAGTCACAGG + Intronic
1163268390 19:16234764-16234786 CTTGCCAGCCAGCCAGCTGCAGG + Exonic
1163373448 19:16915248-16915270 GGTCCCAGCCAGCCAGTCATGGG + Intronic
1163452027 19:17384006-17384028 CTTTCCAGCCCTCCAGTCACAGG - Intergenic
1166695357 19:44848632-44848654 CATGCCAGCCGGCCAGCCAGTGG - Intronic
1167240274 19:48339217-48339239 CCTGTCATCCCGCCAGTCACTGG - Intronic
1167253011 19:48410891-48410913 CATGTCATCCACCCAGTCACTGG - Intronic
1167849236 19:52189583-52189605 AGAGCCAGCCAGCCAGCCAGCGG + Intergenic
926924066 2:17968981-17969003 CGGGAAATCCAGCCAGTCACTGG + Intronic
927454458 2:23237681-23237703 TGGGCCAGGCAGCCAGCCACAGG + Intergenic
932416083 2:71574664-71574686 CACACCAGCCAGCCAGGCACAGG - Intronic
936738295 2:115473622-115473644 CATGGCAGCCAGCCAGACAGAGG - Intronic
936771100 2:115914708-115914730 CATGACAGCCAGCAAATCACAGG + Intergenic
936864122 2:117057421-117057443 CGTGCCAGAAATCCAGTGACTGG + Intergenic
936977169 2:118231909-118231931 GGAGCCAGCCAGCCACTCAGGGG + Intergenic
937056071 2:118937999-118938021 AGTGCCAGCCTCCCAGTAACAGG - Intergenic
937385799 2:121431455-121431477 CTTCCCAGTCAGCCAGGCACAGG - Intronic
937710598 2:124976296-124976318 CCTGCCAGCCAGCCACCCAGGGG + Intergenic
938399423 2:130976554-130976576 TGTGCCAGCCAGTGATTCACAGG + Intronic
946415368 2:219537445-219537467 CAGGCCTGCCAGCCAGTCAGGGG - Intronic
946880391 2:224171416-224171438 CGTGCCAACCAGTCTGGCACTGG - Intergenic
948197414 2:236106108-236106130 GCTGCCAGCCAGCCAGCCAAGGG - Intronic
948362514 2:237432966-237432988 ACTGCCAGGCAGCCATTCACAGG + Intergenic
1171121092 20:22569061-22569083 CGAGCCAGCCCGCCAGCCAGCGG + Intergenic
1173842098 20:46164327-46164349 CATCCCACCCAGCCAATCACAGG - Intergenic
1173880183 20:46406267-46406289 CGGGCCAGGCAGTCAGGCACGGG - Intronic
1176268311 20:64222173-64222195 CGAGCCAGGCAGCCTGTGACAGG + Intronic
1178239363 21:30881309-30881331 CTTGCCAGCCAACCTGTTACCGG - Exonic
1179807478 21:43848969-43848991 GGTGACTGCCAGCCAGCCACCGG - Intergenic
1180011934 21:45057086-45057108 CGTGCCGGACAGACAGACACAGG + Intergenic
1181374696 22:22447652-22447674 ACAGTCAGCCAGCCAGTCACTGG - Intergenic
1183951132 22:41353717-41353739 CCTGCCAGCCAGCCTGGCCCAGG - Intronic
1184129924 22:42511692-42511714 GCGGCCAGCCAGCCAGCCACAGG - Exonic
1184140030 22:42573186-42573208 CCTGGCAGCCGGCCAGCCACAGG - Intronic
1184379333 22:44135199-44135221 GGTGGCAGCCCGCCTGTCACAGG - Intronic
1184767658 22:46579966-46579988 CAGGCCACCCAGCCAGTCCCTGG - Intronic
950075485 3:10183954-10183976 CGGGGCAGCCTGGCAGTCACAGG - Intronic
950849832 3:16051681-16051703 CAGGCCAGCCAGCCAGCCATGGG - Intergenic
951551872 3:23882716-23882738 AGTGCCAGCCTGCCAGCAACAGG - Intronic
952334277 3:32391724-32391746 GGCGCCGGCCGGCCAGTCACCGG + Exonic
953384779 3:42500326-42500348 CCTGCCCACCAGCCATTCACTGG + Intronic
953548997 3:43885960-43885982 CCTGCCTGCCCCCCAGTCACAGG + Intergenic
954197083 3:49003301-49003323 TGTGGCAGCCATCCAGCCACAGG - Intronic
956073390 3:65478753-65478775 CCTCCTAGCCAGCCAGTCAGTGG - Exonic
959806719 3:110562899-110562921 CATGCCAGGCAGCCAGTGCCAGG + Intergenic
961110884 3:124282138-124282160 CCTGACATCCAGCCAGTCACTGG - Intronic
961823913 3:129588874-129588896 CCTGCCAGCCACCCCGTCCCAGG - Intronic
968466983 4:757295-757317 TGTGCCAGCCACGCAGGCACAGG - Intronic
969882725 4:10188534-10188556 CTGGCCAGCCAGCCAGACCCTGG - Intergenic
982268902 4:153566933-153566955 CGTGCCCGCCTGCCAGGGACAGG + Intronic
985757894 5:1730132-1730154 GGTGCCAGCCTGCCAGGCTCAGG - Intergenic
986997405 5:13622855-13622877 CGTGCCTGCCAGCCTAGCACTGG - Intergenic
987243302 5:16023463-16023485 TGTCCTATCCAGCCAGTCACTGG - Intergenic
991022940 5:61999606-61999628 CCTGCCAGGCAGCCAGGAACTGG + Intergenic
996346472 5:122493471-122493493 GTTCCCAGCCAGCCAGCCACGGG - Intergenic
1001008730 5:168077941-168077963 TGTGCCAGCCATCCTGTTACTGG - Intronic
1001583937 5:172820225-172820247 CTTGTCAACCAGCCAGTCACCGG + Intergenic
1003005276 6:2375505-2375527 CGGGCCAGCCAACATGTCACAGG + Intergenic
1003186878 6:3839798-3839820 CGTGCTAGCCAGGAAGTCATAGG + Intergenic
1005634257 6:27738496-27738518 CGCCCCAGCCAGCCAGTCAATGG + Intergenic
1006716229 6:36122478-36122500 CCTGCCATTCGGCCAGTCACCGG + Intergenic
1010507156 6:76674736-76674758 CCTGCCAGCCAGCCAGATCCTGG - Intergenic
1013420977 6:109966603-109966625 CATTCCAGCCAGCCAGAAACAGG + Intergenic
1019696718 7:2450429-2450451 CGTTCCAGGCAGGCAGGCACAGG + Intergenic
1024049931 7:45612382-45612404 TGTCCCAGCCTGCCACTCACTGG - Intronic
1024604333 7:51012092-51012114 AGTGGCAGCCAGCCAGGCAGAGG - Intergenic
1025844593 7:65184993-65185015 CGTACCAGCAAACCAGTCACTGG + Intergenic
1025894921 7:65691331-65691353 CGTACCAGCAAACCAGTCACTGG + Intergenic
1027173232 7:75887652-75887674 CGAGCCAGCCACACAGGCACTGG + Intronic
1028672708 7:93421776-93421798 TGTACCAGCCAGCCTCTCACGGG - Intergenic
1028875920 7:95823327-95823349 CGTGCCAGCCAGCCAGGCATTGG - Intronic
1028922323 7:96321988-96322010 AACGCCAGCCAGCCAGTCAGTGG - Exonic
1029685885 7:102147645-102147667 CTTGACAGACAGCCATTCACTGG - Intronic
1031592623 7:123611773-123611795 GGTGCCAGACAGTCAGTCAAAGG - Intronic
1034411083 7:150942520-150942542 TGTGACCTCCAGCCAGTCACTGG + Intergenic
1035855758 8:2974476-2974498 TGTGCCAGGAAGACAGTCACTGG - Exonic
1049300737 8:141868071-141868093 GGTGCCAGCCTGCCTCTCACAGG + Intergenic
1049567279 8:143347712-143347734 CCAGCCAGCCAGCCAGCCAGCGG + Intronic
1057312556 9:93951357-93951379 CTTGCCAGCCAGAGAGTCGCTGG - Intergenic
1057963397 9:99478800-99478822 GGGGCCAGCCAGCCACTAACAGG + Intergenic
1060400503 9:123346155-123346177 CGTGCCAGGCAGCCTGGCTCAGG - Intergenic
1061009267 9:127945629-127945651 AGGGCCAGGCAGCCACTCACCGG + Exonic
1061043402 9:128152145-128152167 GGTGTCTGCCAGCCACTCACTGG + Intronic
1061935518 9:133855442-133855464 AGGGCCAGCCAGCAAGGCACGGG + Intronic
1062040806 9:134403482-134403504 GGTGCCAGCCAGTCAGCCAAGGG - Intronic
1062506938 9:136882389-136882411 CGTGGATGCCAGCCACTCACTGG - Intronic
1187126102 X:16455937-16455959 CGTATCAACCAGCCAGTCAGTGG + Intergenic
1187471064 X:19570187-19570209 AGAGACAGCCAGCCAGCCACAGG + Intronic
1187703956 X:21991053-21991075 CCAACCAGCCAGCTAGTCACGGG - Intronic
1189548654 X:42070566-42070588 TGTGGGAGTCAGCCAGTCACAGG + Intergenic
1199169355 X:144717899-144717921 AATGCCAGCCAGCCTGCCACTGG - Intergenic
1199772177 X:150982272-150982294 CCTGCCAGTCATCCAGGCACCGG + Intronic
1201142855 Y:11042821-11042843 TGTTCCAGCCAGCCAGCAACGGG - Intergenic