ID: 905938102

View in Genome Browser
Species Human (GRCh38)
Location 1:41840740-41840762
Sequence TCGTCCAGTGACTGGCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 89}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905938102_905938109 7 Left 905938102 1:41840740-41840762 CCAGCCAGCCAGTCACTGGACGA 0: 1
1: 0
2: 0
3: 9
4: 89
Right 905938109 1:41840770-41840792 AGAGGAAGCTTGGCACTGGAAGG 0: 1
1: 0
2: 1
3: 26
4: 234
905938102_905938112 23 Left 905938102 1:41840740-41840762 CCAGCCAGCCAGTCACTGGACGA 0: 1
1: 0
2: 0
3: 9
4: 89
Right 905938112 1:41840786-41840808 TGGAAGGAGGCCAGGCATGCTGG 0: 1
1: 1
2: 24
3: 216
4: 1941
905938102_905938110 10 Left 905938102 1:41840740-41840762 CCAGCCAGCCAGTCACTGGACGA 0: 1
1: 0
2: 0
3: 9
4: 89
Right 905938110 1:41840773-41840795 GGAAGCTTGGCACTGGAAGGAGG 0: 1
1: 0
2: 0
3: 21
4: 263
905938102_905938106 -3 Left 905938102 1:41840740-41840762 CCAGCCAGCCAGTCACTGGACGA 0: 1
1: 0
2: 0
3: 9
4: 89
Right 905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 74
905938102_905938114 28 Left 905938102 1:41840740-41840762 CCAGCCAGCCAGTCACTGGACGA 0: 1
1: 0
2: 0
3: 9
4: 89
Right 905938114 1:41840791-41840813 GGAGGCCAGGCATGCTGGGCTGG 0: 1
1: 0
2: 8
3: 69
4: 578
905938102_905938107 3 Left 905938102 1:41840740-41840762 CCAGCCAGCCAGTCACTGGACGA 0: 1
1: 0
2: 0
3: 9
4: 89
Right 905938107 1:41840766-41840788 AACCAGAGGAAGCTTGGCACTGG 0: 1
1: 0
2: 0
3: 17
4: 133
905938102_905938113 24 Left 905938102 1:41840740-41840762 CCAGCCAGCCAGTCACTGGACGA 0: 1
1: 0
2: 0
3: 9
4: 89
Right 905938113 1:41840787-41840809 GGAAGGAGGCCAGGCATGCTGGG 0: 1
1: 0
2: 3
3: 61
4: 430
905938102_905938111 15 Left 905938102 1:41840740-41840762 CCAGCCAGCCAGTCACTGGACGA 0: 1
1: 0
2: 0
3: 9
4: 89
Right 905938111 1:41840778-41840800 CTTGGCACTGGAAGGAGGCCAGG 0: 1
1: 1
2: 1
3: 20
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905938102 Original CRISPR TCGTCCAGTGACTGGCTGGC TGG (reversed) Intronic
900344098 1:2202998-2203020 TTGTCCAGTCACCAGCTGGCTGG - Intronic
901058369 1:6460203-6460225 TCCACCAGGGCCTGGCTGGCTGG - Exonic
901177951 1:7318320-7318342 TTGGTCAGTGACTGGTTGGCTGG + Intronic
904642085 1:31938440-31938462 GCGTTCGCTGACTGGCTGGCTGG + Intronic
905489277 1:38331017-38331039 TCCTCCAGTGACTGACATGCAGG + Intergenic
905938102 1:41840740-41840762 TCGTCCAGTGACTGGCTGGCTGG - Intronic
907389946 1:54151646-54151668 TCTGCCAGTGACTGGGTGACTGG + Intronic
912797832 1:112703583-112703605 TCATTCAGTGACTGGGGGGCGGG + Intronic
913488436 1:119355650-119355672 TCCTCCAGTGACTGCCTTGCTGG + Intergenic
914332314 1:146683590-146683612 TCTACCAGAGACTTGCTGGCTGG - Intergenic
916608377 1:166365303-166365325 TCTTCCTGTGACCAGCTGGCTGG + Intergenic
921825597 1:219668605-219668627 TTGTTGAGTGATTGGCTGGCTGG - Intergenic
1063034960 10:2277337-2277359 TGGTACAGTCACTGGATGGCAGG + Intergenic
1073627142 10:105110905-105110927 TAGCCCTGTGACTGGCTGGTGGG - Intronic
1077315999 11:1919625-1919647 TTGGCCAGTGACTGGGTGGCCGG - Exonic
1078084287 11:8224534-8224556 TGGTAGAGTGGCTGGCTGGCCGG + Exonic
1084597102 11:70123459-70123481 TCCTCCAGTGCCTGGAGGGCAGG - Intronic
1084667680 11:70585208-70585230 TGGTCCATCCACTGGCTGGCAGG + Intronic
1085608305 11:77922842-77922864 TTTTCCAGTGACTGGTTTGCTGG + Intronic
1086486071 11:87303351-87303373 TTTTCCACTGACTGGGTGGCTGG - Intronic
1087702301 11:101449073-101449095 TCGTTAGGGGACTGGCTGGCAGG + Intergenic
1088526723 11:110763743-110763765 TTGGCCAGTGACTGGCTGCCAGG - Intergenic
1096230056 12:49891805-49891827 ACGTCCAGTGGGAGGCTGGCAGG + Intronic
1102419401 12:112791963-112791985 TTGTCCACTGACTCACTGGCTGG + Exonic
1104074351 12:125376526-125376548 TCCTCCAGTGGCTAGCTGCCTGG + Intronic
1104715002 12:131010822-131010844 TCTTCCAGGGCCTGCCTGGCTGG - Intronic
1104941970 12:132399474-132399496 TCATCCAATGAGTGGCAGGCTGG + Intergenic
1107560348 13:41552206-41552228 CTGTGCAGTGAATGGCTGGCTGG + Intergenic
1118192612 14:63594311-63594333 TCGTCCAGTCTATGGCTGCCAGG - Intergenic
1118287315 14:64487647-64487669 TCCTCCAGGGCCTGGGTGGCAGG + Exonic
1118887739 14:69880313-69880335 TCTTCCAGTGCCTGCCCGGCAGG - Intronic
1119728889 14:76938631-76938653 TCCTCCAGGGACTGGCAGGAGGG + Intergenic
1121346137 14:93137076-93137098 TGGTGCAGTGCCTGGCTGGCAGG + Intergenic
1121858069 14:97288745-97288767 TTGTCCAGTGCCTGGCATGCAGG + Intergenic
1135065428 16:19305583-19305605 TCTGCCACTTACTGGCTGGCAGG + Intronic
1140001239 16:71027329-71027351 TCTACCAGAGACTTGCTGGCTGG + Intronic
1140704496 16:77614015-77614037 TTATCCACTGACTGGCTGACTGG - Intergenic
1141680596 16:85541555-85541577 TTGTCCACGGAGTGGCTGGCAGG - Intergenic
1141827191 16:86488863-86488885 TCGTGAAGTGACCGGCTGACGGG + Intergenic
1146608740 17:34286029-34286051 TCTTCCAGTGACTGGATGTGAGG - Intronic
1148044527 17:44734726-44734748 TCGTCCTGTGCCTGGATGCCAGG - Intronic
1151459257 17:74245080-74245102 TCGTCCAGTGACTTGGGGGCTGG + Intronic
1151668012 17:75556622-75556644 TCATTCAGTGAGTGGCTGGCTGG + Intronic
1152740533 17:82016561-82016583 AGGTCCAGGGACAGGCTGGCTGG - Intronic
1153973903 18:10249884-10249906 TCTTCCAGTGACTGGCTCAGGGG + Intergenic
1159006900 18:63021419-63021441 TGGTTGACTGACTGGCTGGCTGG - Intergenic
1159754781 18:72351001-72351023 TGGTCCAGGGGCAGGCTGGCTGG - Intergenic
1161320565 19:3638915-3638937 TCGTCCGAGGCCTGGCTGGCAGG + Exonic
1164859250 19:31549780-31549802 TGGTCCAGCACCTGGCTGGCTGG - Intergenic
1167116458 19:47491882-47491904 TCATCCAAAGGCTGGCTGGCAGG + Intronic
1168681297 19:58317958-58317980 TGGTAAAGTGACTGGCAGGCGGG - Intergenic
928298926 2:30108819-30108841 TCATTCTGTGACTGGCTGGAGGG + Intergenic
931665427 2:64606934-64606956 TCTCCCATTGACTGGCTGGTGGG + Intergenic
934732811 2:96670008-96670030 TTGTCCAGTCACTGCCTGCCCGG - Intergenic
940307688 2:152244202-152244224 TCCTGCAGTGAGTTGCTGGCTGG - Intergenic
940770817 2:157837847-157837869 ACGTTCAATGACTGGCTTGCGGG - Intronic
945033707 2:205686565-205686587 GCGTCCAGCGGCTGGGTGGCGGG + Intronic
946415367 2:219537441-219537463 GGGTCCCCTGACTGGCTGGCAGG + Intronic
948328932 2:237150140-237150162 GAGTCCTGTGACTGGCTGGGAGG + Intergenic
1174668785 20:52285930-52285952 TTCTCCAGTGACTGGCTTGGAGG - Intergenic
1176076361 20:63250123-63250145 TGGCCCAGTACCTGGCTGGCGGG - Intronic
1182828266 22:33284129-33284151 TCCTTCTGTGCCTGGCTGGCAGG - Intronic
1185062951 22:48616556-48616578 TCGTGCTGTGACTTGCAGGCAGG - Intronic
952010992 3:28901245-28901267 TCTGCCAGTAAGTGGCTGGCTGG + Intergenic
952334279 3:32391728-32391750 CCCTCCGGTGACTGGCCGGCCGG - Exonic
968938879 4:3627759-3627781 TGGTCATGTGGCTGGCTGGCTGG + Intergenic
969060452 4:4429824-4429846 ACTCCCAGTGGCTGGCTGGCAGG - Intronic
972741393 4:41890106-41890128 TCATCCAGAGCCTGGCTTGCTGG + Intergenic
981015415 4:139969070-139969092 TCTCCCATTCACTGGCTGGCTGG - Intronic
987964647 5:24855748-24855770 TAGGCCAGTGAGTGGGTGGCGGG - Intergenic
994701711 5:103142292-103142314 TTGTCCAGGGCCAGGCTGGCCGG + Intronic
997264864 5:132489698-132489720 TCCTCCAGAGACTGGCTGGGAGG - Intronic
997842127 5:137251422-137251444 TCGGCCAGTAACTAGCTGGGGGG + Intronic
1003371430 6:5531203-5531225 TTTTCCAGTGACTGGCTGAGGGG - Intronic
1003679383 6:8236979-8237001 CTGTCCAGAAACTGGCTGGCTGG - Intergenic
1005634260 6:27738500-27738522 ACAGCCATTGACTGGCTGGCTGG - Intergenic
1006716231 6:36122486-36122508 TCGGCCAGTCACCGGCTGCCAGG + Intergenic
1007041689 6:38727849-38727871 TTTTCCAGTGACTGGGTGGCAGG + Intronic
1012466348 6:99520958-99520980 TCGGCCGGTGCCTGGCTGGAGGG + Intronic
1013033630 6:106360384-106360406 TTGGCCTGTGACAGGCTGGCAGG - Intergenic
1015863554 6:137705214-137705236 TCTTTCAGTGGCTGGCTGGCAGG - Intergenic
1016803064 6:148185852-148185874 TGGTCCTCTGACTGGCTTGCTGG + Intergenic
1017245057 6:152215814-152215836 TCTTCCATTTACTAGCTGGCTGG - Intronic
1022539808 7:31125137-31125159 TTTTCCAGGGACTGGGTGGCAGG + Intergenic
1024903951 7:54354593-54354615 TAGCCGTGTGACTGGCTGGCTGG + Intergenic
1025844594 7:65184997-65185019 TTTTCCAGTGACTGGTTTGCTGG - Intergenic
1025894922 7:65691335-65691357 TTTTCCAGTGACTGGTTTGCTGG - Intergenic
1028875919 7:95823323-95823345 CAGTCCAATGCCTGGCTGGCTGG + Intronic
1030063019 7:105638294-105638316 TGGTCAAGTGACTAGCTTGCTGG - Intronic
1031029264 7:116716831-116716853 TCAGCCCGTGGCTGGCTGGCCGG + Intronic
1031237408 7:119194849-119194871 TTGTCCAGTAACTTTCTGGCTGG - Intergenic
1034734239 7:153413657-153413679 TCGTCCGGTTACTTGCTGCCAGG - Intergenic
1037277818 8:17200319-17200341 TCAACCAGTGACAGCCTGGCCGG + Intronic
1041694736 8:60723981-60724003 TCTGCCACTGACTGGCTGGGTGG + Intronic
1048736737 8:137510373-137510395 TCTTCCAGTGATGGGCTGCCAGG + Intergenic
1048865903 8:138761272-138761294 TCGTGCAGTGCCTGGTTGCCAGG - Intronic
1054451863 9:65407561-65407583 TGGTCATGTGGCTGGCTGGCTGG - Intergenic
1061729621 9:132603743-132603765 TCGTCCCGGGAGAGGCTGGCTGG + Intronic
1062649741 9:137569438-137569460 TGGGTGAGTGACTGGCTGGCTGG - Intronic