ID: 905938103

View in Genome Browser
Species Human (GRCh38)
Location 1:41840744-41840766
Sequence TATGTCGTCCAGTGACTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 65}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905938103_905938116 29 Left 905938103 1:41840744-41840766 CCAGCCAGTCACTGGACGACATA 0: 1
1: 0
2: 0
3: 4
4: 65
Right 905938116 1:41840796-41840818 CCAGGCATGCTGGGCTGGTGAGG 0: 1
1: 0
2: 2
3: 56
4: 422
905938103_905938113 20 Left 905938103 1:41840744-41840766 CCAGCCAGTCACTGGACGACATA 0: 1
1: 0
2: 0
3: 4
4: 65
Right 905938113 1:41840787-41840809 GGAAGGAGGCCAGGCATGCTGGG 0: 1
1: 0
2: 3
3: 61
4: 430
905938103_905938111 11 Left 905938103 1:41840744-41840766 CCAGCCAGTCACTGGACGACATA 0: 1
1: 0
2: 0
3: 4
4: 65
Right 905938111 1:41840778-41840800 CTTGGCACTGGAAGGAGGCCAGG 0: 1
1: 1
2: 1
3: 20
4: 320
905938103_905938114 24 Left 905938103 1:41840744-41840766 CCAGCCAGTCACTGGACGACATA 0: 1
1: 0
2: 0
3: 4
4: 65
Right 905938114 1:41840791-41840813 GGAGGCCAGGCATGCTGGGCTGG 0: 1
1: 0
2: 8
3: 69
4: 578
905938103_905938112 19 Left 905938103 1:41840744-41840766 CCAGCCAGTCACTGGACGACATA 0: 1
1: 0
2: 0
3: 4
4: 65
Right 905938112 1:41840786-41840808 TGGAAGGAGGCCAGGCATGCTGG 0: 1
1: 1
2: 24
3: 216
4: 1941
905938103_905938106 -7 Left 905938103 1:41840744-41840766 CCAGCCAGTCACTGGACGACATA 0: 1
1: 0
2: 0
3: 4
4: 65
Right 905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 74
905938103_905938107 -1 Left 905938103 1:41840744-41840766 CCAGCCAGTCACTGGACGACATA 0: 1
1: 0
2: 0
3: 4
4: 65
Right 905938107 1:41840766-41840788 AACCAGAGGAAGCTTGGCACTGG 0: 1
1: 0
2: 0
3: 17
4: 133
905938103_905938109 3 Left 905938103 1:41840744-41840766 CCAGCCAGTCACTGGACGACATA 0: 1
1: 0
2: 0
3: 4
4: 65
Right 905938109 1:41840770-41840792 AGAGGAAGCTTGGCACTGGAAGG 0: 1
1: 0
2: 1
3: 26
4: 234
905938103_905938110 6 Left 905938103 1:41840744-41840766 CCAGCCAGTCACTGGACGACATA 0: 1
1: 0
2: 0
3: 4
4: 65
Right 905938110 1:41840773-41840795 GGAAGCTTGGCACTGGAAGGAGG 0: 1
1: 0
2: 0
3: 21
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905938103 Original CRISPR TATGTCGTCCAGTGACTGGC TGG (reversed) Intronic
904644473 1:31955466-31955488 TAGCTCTTCCAGTGACTGGCTGG + Intergenic
905065556 1:35178435-35178457 TATGTCTTCCATTGTCAGGCAGG + Intronic
905938103 1:41840744-41840766 TATGTCGTCCAGTGACTGGCTGG - Intronic
907151600 1:52293543-52293565 TAGGTCTTGCAGTGACTGGTAGG - Exonic
908272669 1:62436469-62436491 TATGTCGAACAATGATTGGCTGG + Intronic
908681056 1:66661397-66661419 TATGTGGTGCAGTGGCTGCCAGG - Intronic
908780352 1:67685191-67685213 TTTGTCCTCCAGTGGCTGGTAGG + Exonic
910062712 1:83112924-83112946 AATGGCTGCCAGTGACTGGCTGG - Intergenic
912797830 1:112703579-112703601 TAGGTCATTCAGTGACTGGGGGG + Intronic
918937518 1:190942983-190943005 TATGACTTCCAGGGACTGGGCGG - Intergenic
920177893 1:204114538-204114560 GCTGTTGTCCAGTGACTGGAAGG + Exonic
920813595 1:209309755-209309777 TGTGACATCCAGTGACTTGCTGG + Intergenic
924257962 1:242201333-242201355 TATGTCTTACAATGACTTGCAGG - Intronic
1062999321 10:1899870-1899892 TATGTGGTCCACTGACATGCAGG + Intergenic
1078488893 11:11751045-11751067 TGTGTCCTCCCATGACTGGCTGG - Intergenic
1086700751 11:89898157-89898179 GATGAGGACCAGTGACTGGCTGG - Intergenic
1086705418 11:89946370-89946392 GATGAGGACCAGTGACTGGCTGG + Intergenic
1087446481 11:98260810-98260832 TATGTCCTTCTATGACTGGCTGG + Intergenic
1105405797 13:20131564-20131586 TATGTTGTCCAGTAATGGGCTGG - Intergenic
1107449480 13:40495685-40495707 TGTGTCCTCCAGTGGGTGGCTGG - Intergenic
1113356392 13:109584736-109584758 TATGTCGCCAAGTGATTAGCAGG - Intergenic
1115421630 14:33201592-33201614 TATAGCGTCCTGTGACAGGCAGG + Intronic
1120800786 14:88686172-88686194 TATGTTGTCAAGTAACTGGAGGG + Intronic
1121601462 14:95207764-95207786 TATGTGGTGCAGGGACAGGCAGG + Intronic
1122316886 14:100830956-100830978 TTTGTCTTCCAGAGACTGGCAGG + Intergenic
1127275396 15:57439010-57439032 TATCCCGTCCAGTTCCTGGCAGG - Exonic
1139956549 16:70695981-70696003 TCTGTCACCCAGAGACTGGCAGG - Intronic
1141368158 16:83463351-83463373 TCTATCCTCCAGGGACTGGCTGG + Intronic
1151269953 17:72986468-72986490 TCTGTGGGCCAGTGCCTGGCAGG - Intronic
1159881567 18:73863063-73863085 TGTGTGGTCCTGGGACTGGCTGG - Intergenic
1167262624 19:48467628-48467650 AATGTGGTCAAGGGACTGGCTGG - Intronic
925309352 2:2871295-2871317 TATTACACCCAGTGACTGGCGGG + Intergenic
925337940 2:3112247-3112269 TGTCTCCTCTAGTGACTGGCTGG - Intergenic
925992447 2:9264325-9264347 CATGTCTTCCAGAGACTGGGGGG + Intronic
926924068 2:17968989-17969011 AAATTCCTCCAGTGACTGGCTGG - Intronic
938965372 2:136383491-136383513 ACTCTCGTCCAGTGACTGGTGGG - Intergenic
1169057237 20:2633682-2633704 TACCTCCTCCAGTGACTGCCAGG + Intronic
1169508137 20:6234994-6235016 AATGACTTCCAGTGTCTGGCAGG + Intergenic
1176978750 21:15354599-15354621 TCTTTTGTCCAGTTACTGGCAGG + Intergenic
950565000 3:13764063-13764085 TATGTCGACCAGTGGTTGGCAGG - Intergenic
954645906 3:52131420-52131442 TATGACATCCAGTGAGAGGCAGG + Intronic
957538224 3:81533457-81533479 TATGTGGAACAGTGATTGGCTGG + Intronic
959027656 3:101259175-101259197 GATGTCCTGCAGAGACTGGCTGG - Intronic
964373563 3:156027461-156027483 TCTGTCTTCCAGGTACTGGCTGG + Intergenic
966588124 3:181650348-181650370 TATGTCCTCTAGTGACTTTCTGG + Intergenic
974687220 4:65245717-65245739 AATGTTGTCCAGTGAGTGTCTGG + Intergenic
981178519 4:141711387-141711409 TATTTATTACAGTGACTGGCTGG + Intronic
983015100 4:162603692-162603714 TATGTCATTCAGTGAATGGAAGG - Intergenic
986762499 5:10893087-10893109 TATGTCATCCAGTGCTTGGCTGG + Intergenic
988518467 5:31925083-31925105 TATGTCCTGCAATGACCGGCAGG + Intronic
997264866 5:132489702-132489724 TGTCTCCTCCAGAGACTGGCTGG - Intronic
998045247 5:138981693-138981715 TATGTGGGCCAGTGATGGGCAGG + Intronic
999768808 5:154759224-154759246 TATTTAGCCCAGTGCCTGGCAGG + Intronic
1000374328 5:160565396-160565418 TATGTGGACCAGTGACTAGGTGG + Exonic
1002094034 5:176820516-176820538 TATGTTATCCGGTGCCTGGCTGG + Intronic
1003602309 6:7528840-7528862 TTTGTCATCCAGGGCCTGGCAGG + Intergenic
1005507683 6:26484023-26484045 TATTCCCTCCAGTGACTGTCAGG - Intergenic
1007041688 6:38727845-38727867 AATGTTTTCCAGTGACTGGGTGG + Intronic
1010055476 6:71559033-71559055 TCTGTGGTGCTGTGACTGGCAGG - Intergenic
1019208719 6:170386162-170386184 TGTGTCCTCCAGGGATTGGCGGG + Intronic
1022388645 7:29924669-29924691 TCTATCCTCCAGTGACTGGGAGG + Intronic
1034411085 7:150942528-150942550 TGGCTGGTCCAGTGACTGGCTGG - Intergenic
1034526529 7:151667063-151667085 GCTGTCGTCTACTGACTGGCTGG + Intronic
1052881465 9:33603198-33603220 AATGTGGTCCTGAGACTGGCTGG + Intergenic
1056997476 9:91477078-91477100 TCTGTTGTCCAGAGTCTGGCCGG + Intergenic
1060020910 9:120130357-120130379 TGTGACTTCCACTGACTGGCAGG + Intergenic
1189215988 X:39324413-39324435 TATGGTGTCCAGTTACTGACAGG - Intergenic
1196417835 X:115491619-115491641 GATTTCGTCCAATGACTGTCAGG + Intergenic
1196483084 X:116173510-116173532 TTTATCGTCCAGTGACTTTCAGG + Exonic
1198543060 X:137661123-137661145 TAGGTCTTGCAGTGACTGGTAGG - Intergenic