ID: 905938105

View in Genome Browser
Species Human (GRCh38)
Location 1:41840752-41840774
Sequence TCACTGGACGACATAACCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 46}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905938098_905938105 8 Left 905938098 1:41840721-41840743 CCATCAGATCCTGGCCGTGCCAG 0: 1
1: 0
2: 0
3: 10
4: 172
Right 905938105 1:41840752-41840774 TCACTGGACGACATAACCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 46
905938100_905938105 -6 Left 905938100 1:41840735-41840757 CCGTGCCAGCCAGCCAGTCACTG 0: 1
1: 0
2: 6
3: 33
4: 382
Right 905938105 1:41840752-41840774 TCACTGGACGACATAACCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 46
905938095_905938105 17 Left 905938095 1:41840712-41840734 CCACGGAGCCCATCAGATCCTGG 0: 1
1: 0
2: 0
3: 12
4: 182
Right 905938105 1:41840752-41840774 TCACTGGACGACATAACCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 46
905938094_905938105 18 Left 905938094 1:41840711-41840733 CCCACGGAGCCCATCAGATCCTG 0: 1
1: 0
2: 1
3: 6
4: 80
Right 905938105 1:41840752-41840774 TCACTGGACGACATAACCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 46
905938093_905938105 27 Left 905938093 1:41840702-41840724 CCAGTGACACCCACGGAGCCCAT 0: 1
1: 0
2: 0
3: 6
4: 119
Right 905938105 1:41840752-41840774 TCACTGGACGACATAACCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 46
905938097_905938105 9 Left 905938097 1:41840720-41840742 CCCATCAGATCCTGGCCGTGCCA 0: 1
1: 0
2: 0
3: 8
4: 83
Right 905938105 1:41840752-41840774 TCACTGGACGACATAACCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 46
905938099_905938105 -1 Left 905938099 1:41840730-41840752 CCTGGCCGTGCCAGCCAGCCAGT 0: 1
1: 0
2: 0
3: 22
4: 304
Right 905938105 1:41840752-41840774 TCACTGGACGACATAACCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905938105 Original CRISPR TCACTGGACGACATAACCAG AGG Intronic
904403484 1:30272088-30272110 CTGCTGGACGTCATAACCAGGGG - Intergenic
905938105 1:41840752-41840774 TCACTGGACGACATAACCAGAGG + Intronic
906805945 1:48778892-48778914 TGGCTGTACCACATAACCAGTGG - Intronic
907652891 1:56312570-56312592 TCAGTGGAAGACACAAGCAGAGG + Intergenic
917955276 1:180090189-180090211 TCACTAGATGACAAAAACAGAGG - Intronic
923719099 1:236452065-236452087 CCACTGGAAGACCTAACCTGTGG - Intronic
1067361015 10:45578550-45578572 TCACTGGACGCTAAAACTAGTGG + Intronic
1074709372 10:116164241-116164263 TAACTGCAAGACATAACCTGCGG + Intronic
1076771664 10:132669445-132669467 TCACGGGACCACAGAACGAGAGG + Intronic
1078392189 11:10944833-10944855 TTCCTGGAGGAAATAACCAGTGG - Intergenic
1084578406 11:70006187-70006209 TCACTGGACAACATGCCCAGTGG - Intergenic
1087966745 11:104424045-104424067 CCACTGGAGGACATAGACAGAGG + Intergenic
1089036306 11:115396626-115396648 TCACTGCAGGACAGAAGCAGTGG - Intronic
1095684107 12:45012678-45012700 TCACTGGATCCCATCACCAGCGG + Intergenic
1098157595 12:67615704-67615726 TCAGTAAACAACATAACCAGAGG + Intergenic
1107773309 13:43811385-43811407 TCACTAGAGGACAGAACCTGAGG + Intergenic
1108272022 13:48771053-48771075 TCACTGGCAGACATCTCCAGGGG + Intergenic
1111022572 13:82472371-82472393 TCACTGGAAGCCATATCCATAGG + Intergenic
1112601999 13:100865617-100865639 TCATTAGAGGACATAACCATTGG - Intergenic
1113190737 13:107742701-107742723 TCATTGAAGGAAATAACCAGGGG - Intronic
1127334348 15:57968826-57968848 TCACTGGCCGACATTTCTAGTGG - Intronic
1129404121 15:75302944-75302966 TCACTTGAAGACATGGCCAGAGG + Intergenic
1132831256 16:1929556-1929578 TCACCGGAGGACAGAGCCAGGGG - Intergenic
1134454645 16:14386065-14386087 TCAGTTGACAACATGACCAGAGG + Intergenic
1138065234 16:53934070-53934092 TCACTGCACGCCAGAACCTGAGG + Exonic
1138875325 16:60941936-60941958 TCACAGGACCACAGGACCAGTGG - Intergenic
1146592599 17:34140883-34140905 TCAATGGATGATAAAACCAGAGG + Intronic
1155994714 18:32318633-32318655 TCACTGTTCGCCATCACCAGTGG + Intronic
933862138 2:86480317-86480339 TGGCTGGCCGACCTAACCAGCGG + Exonic
937450666 2:121999935-121999957 CCACTGGATGACATAATCAGAGG - Intergenic
941883121 2:170501646-170501668 TCACTGAACAAAATAAGCAGAGG - Intronic
945031076 2:205664189-205664211 TCTCTGGAAGACATGCCCAGTGG + Intergenic
1175257398 20:57655602-57655624 TGACTGGCAGACATAGCCAGAGG - Intronic
1175798871 20:61789508-61789530 TCCCTGGAGGACAAAACCAGTGG + Intronic
949650700 3:6155673-6155695 TCACTGGAGGAAGTACCCAGGGG + Intergenic
955841719 3:63119816-63119838 TCAGTGGCTGAAATAACCAGAGG + Intergenic
955951071 3:64242607-64242629 TCAGTGGACGACTTGGCCAGGGG + Intronic
981211197 4:142107994-142108016 TCAGTGGACTACAGAAGCAGGGG - Intronic
998313175 5:141155256-141155278 TCTCTGGTCTACATAACCATTGG - Intergenic
1005335423 6:24791595-24791617 TCACTGGAAGCCAGAAGCAGAGG - Intergenic
1007892731 6:45310698-45310720 TCACAGGAAGCCATAACCACAGG + Intronic
1011383199 6:86765394-86765416 TCAGTAAATGACATAACCAGTGG - Intergenic
1025760085 7:64381603-64381625 TCACTGGACCACAGGACCTGGGG - Intergenic
1026034985 7:66824393-66824415 CCACTGAACGACAGAGCCAGGGG + Intergenic
1027353572 7:77335555-77335577 TCACTGAACAAAAGAACCAGTGG + Intronic
1031248371 7:119347652-119347674 TTACTGGACGACTTAGCCAGAGG - Intergenic
1042879569 8:73471933-73471955 GCATTGTACGACAGAACCAGTGG + Intronic
1049122698 8:140753493-140753515 TGACTGGACGAAATCACCAAGGG + Intronic
1058432047 9:104928262-104928284 TGACTGAACTACATAAACAGAGG - Intergenic
1060485922 9:124045941-124045963 TCCCTGCAAGACATAACCAGGGG + Intergenic
1192990542 X:76450298-76450320 ACACTGGAAGTCATAGCCAGAGG - Intergenic
1200227816 X:154428828-154428850 TCACTCGACCACAGCACCAGCGG - Exonic