ID: 905938106

View in Genome Browser
Species Human (GRCh38)
Location 1:41840760-41840782
Sequence CGACATAACCAGAGGAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 74}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905938102_905938106 -3 Left 905938102 1:41840740-41840762 CCAGCCAGCCAGTCACTGGACGA 0: 1
1: 0
2: 0
3: 9
4: 89
Right 905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 74
905938100_905938106 2 Left 905938100 1:41840735-41840757 CCGTGCCAGCCAGCCAGTCACTG 0: 1
1: 0
2: 6
3: 33
4: 382
Right 905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 74
905938094_905938106 26 Left 905938094 1:41840711-41840733 CCCACGGAGCCCATCAGATCCTG 0: 1
1: 0
2: 1
3: 6
4: 80
Right 905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 74
905938095_905938106 25 Left 905938095 1:41840712-41840734 CCACGGAGCCCATCAGATCCTGG 0: 1
1: 0
2: 0
3: 12
4: 182
Right 905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 74
905938103_905938106 -7 Left 905938103 1:41840744-41840766 CCAGCCAGTCACTGGACGACATA 0: 1
1: 0
2: 0
3: 4
4: 65
Right 905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 74
905938098_905938106 16 Left 905938098 1:41840721-41840743 CCATCAGATCCTGGCCGTGCCAG 0: 1
1: 0
2: 0
3: 10
4: 172
Right 905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 74
905938097_905938106 17 Left 905938097 1:41840720-41840742 CCCATCAGATCCTGGCCGTGCCA 0: 1
1: 0
2: 0
3: 8
4: 83
Right 905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 74
905938099_905938106 7 Left 905938099 1:41840730-41840752 CCTGGCCGTGCCAGCCAGCCAGT 0: 1
1: 0
2: 0
3: 22
4: 304
Right 905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905938106 Original CRISPR CGACATAACCAGAGGAAGCT TGG Intronic
902584807 1:17432240-17432262 GCAGATAACCAGGGGAAGCTAGG - Intronic
904970072 1:34412610-34412632 CAACATAAAGAGAGGAGGCTGGG - Intergenic
905414505 1:37794794-37794816 TGACAGGACCAGAGGGAGCTGGG - Intronic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
906025184 1:42667379-42667401 CGAGATCACCACAGGTAGCTTGG - Exonic
907621900 1:55990032-55990054 CTACATAACCAGAGAAAGTGAGG + Intergenic
909666906 1:78144314-78144336 CACCTTAACCAGAAGAAGCTTGG - Intergenic
913182160 1:116332812-116332834 GCACATCACCAAAGGAAGCTTGG - Intergenic
920680630 1:208069744-208069766 AGATATAACCAGAGGAAGATAGG - Intronic
922800347 1:228362148-228362170 GGTGAGAACCAGAGGAAGCTTGG - Intronic
1063775961 10:9264439-9264461 CTACATCACTAGAGGAAGGTCGG + Intergenic
1076771668 10:132669453-132669475 CCACAGAACGAGAGGGAGCTGGG + Intronic
1098506688 12:71260658-71260680 AGAAGTAACCAGAAGAAGCTTGG + Intronic
1099595020 12:84650743-84650765 CAACATAAGCAGAGGGAGCAGGG - Intergenic
1103053155 12:117798335-117798357 CTAAAGAAACAGAGGAAGCTGGG + Intronic
1108490304 13:50975066-50975088 CCACATAGCCAGAGTAAGCATGG - Intergenic
1111287157 13:86109865-86109887 AGCCATTACCATAGGAAGCTAGG - Intergenic
1116562389 14:46397260-46397282 TGAGATAAGCAGAGGAAGGTAGG - Intergenic
1117346760 14:54840448-54840470 AGACAGAACCAGACCAAGCTAGG + Intergenic
1118086933 14:62428570-62428592 CGACAAAACCACATGAAGCCTGG + Intergenic
1122451303 14:101810157-101810179 AGACTTAACCAGAGGAGGTTGGG + Intronic
1128740290 15:70079039-70079061 CCTCATAACCAGAGTGAGCTGGG - Intronic
1135208487 16:20503326-20503348 CAACAGAAACAAAGGAAGCTAGG + Intergenic
1135230831 16:20706377-20706399 CTACAGAAACAAAGGAAGCTAGG + Intronic
1144991953 17:19238885-19238907 TTACATAATGAGAGGAAGCTTGG - Intronic
1156859952 18:41824315-41824337 AGGGATAACAAGAGGAAGCTAGG + Intergenic
1156962036 18:43043977-43043999 AGACATGCCCAGAGGAAGCATGG + Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1160278792 18:77466722-77466744 GGACATAACCTGTGGAAACTAGG - Intergenic
1164712896 19:30371281-30371303 TGACATAAACAAAGGCAGCTGGG + Intronic
1167796945 19:51715656-51715678 TGAAATACCCAGAGGAAACTTGG - Intronic
927718733 2:25369570-25369592 CGTCAGTACCAGAGGATGCTTGG + Intergenic
929055654 2:37874147-37874169 TGACATAACCAGTGGCAGCTGGG + Intergenic
932088342 2:68782273-68782295 CCACAAACCCAGAAGAAGCTGGG + Exonic
933582965 2:84148007-84148029 CACCATAATCAGAGGCAGCTTGG + Intergenic
933824444 2:86145821-86145843 CGACATAGCCAAAGGATACTGGG + Intronic
935661586 2:105471255-105471277 CTAGAGAACCAGAGAAAGCTTGG - Intergenic
947131737 2:226933787-226933809 CTACATCCCAAGAGGAAGCTAGG + Intronic
947876008 2:233468728-233468750 CACCACAACCAGAGGAAGCCAGG + Intronic
1173756766 20:45523306-45523328 AGACACAACCAGAGGAAGATGGG - Intergenic
1176123668 20:63465537-63465559 CGAAATCAACAGAGAAAGCTCGG + Intronic
949862484 3:8518834-8518856 TGGCGTAACCAGAGGAGGCTAGG + Intronic
954379696 3:50213028-50213050 CCTCATAACCAGAGGTGGCTGGG - Intronic
957383554 3:79466889-79466911 GAATATATCCAGAGGAAGCTTGG + Intronic
958617754 3:96517162-96517184 CATCTTAACCAGAGGAAGCTGGG + Intergenic
968206508 3:196806964-196806986 TGAGATAAACAGAGAAAGCTTGG - Intronic
969043134 4:4316749-4316771 GCATATAACCAGAGGAAACTCGG + Intronic
973122589 4:46541103-46541125 TAACATAACCAAAGGAACCTAGG - Intergenic
973685425 4:53365349-53365371 CGACCGGACAAGAGGAAGCTGGG - Exonic
973810269 4:54562576-54562598 GGAAATAATCAGAGGGAGCTGGG + Intergenic
976359017 4:84155611-84155633 GGACAAAAGCAGAGGAAGCAGGG - Intergenic
977669324 4:99677668-99677690 AGAAATAAGCAGAGGAAGTTGGG - Intergenic
978941155 4:114437276-114437298 TGACAAAAACAGAGGAAGGTTGG + Intergenic
981114473 4:140973940-140973962 TGACACCATCAGAGGAAGCTGGG - Intronic
981203194 4:142007751-142007773 AGTCATAACCAGAGTAATCTAGG - Intergenic
985994111 5:3587121-3587143 CGACACAACAAGAGGCTGCTGGG + Intergenic
986231916 5:5872856-5872878 CGATATAAATAGAGAAAGCTTGG - Intergenic
997232822 5:132256742-132256764 CGAGAGAACCAGAGGGAGGTTGG + Intronic
1005030043 6:21500051-21500073 AGACATAAGCAGAGGATTCTGGG - Intergenic
1008429165 6:51394555-51394577 CAACTTTACCAGATGAAGCTTGG + Intergenic
1011627029 6:89291132-89291154 CCACAGAATCAGAGGAACCTAGG - Intronic
1011880867 6:92024357-92024379 CATCATAAACAGAGGAATCTTGG + Intergenic
1014820811 6:125986696-125986718 CTGCATAGCCCGAGGAAGCTGGG + Intronic
1016977118 6:149820149-149820171 CCACAGAACAAGGGGAAGCTGGG + Exonic
1017738630 6:157384874-157384896 CCACATAACTAGAGGAAGGCAGG - Intronic
1020482400 7:8678488-8678510 AGCAACAACCAGAGGAAGCTAGG - Intronic
1024115190 7:46186216-46186238 AAATATAACCAGAGAAAGCTAGG - Intergenic
1024894557 7:54242987-54243009 GGAAATAACCTGATGAAGCTTGG + Intergenic
1027808550 7:82861805-82861827 AGAAATAACCAGAGGAATTTTGG + Intronic
1030204508 7:106939878-106939900 CCAGAAAAGCAGAGGAAGCTTGG + Intergenic
1033606412 7:142931306-142931328 CTAAATAACCTGAGGATGCTGGG - Intronic
1047413690 8:124645831-124645853 CCACTTAAGCCGAGGAAGCTGGG - Intronic
1058164087 9:101601236-101601258 AGACAGAACCAGATGAAGCAGGG + Intronic
1059780554 9:117521873-117521895 AGCCATAAACAGAGGAAGCTGGG - Intergenic
1187429652 X:19210547-19210569 CAAAATGACCAGAGCAAGCTTGG + Intergenic
1188884623 X:35534068-35534090 CGACATTACAAGAGGTAGATTGG - Intergenic
1189116720 X:38350527-38350549 TGACATAATCAGCAGAAGCTGGG + Intronic
1192362337 X:70447667-70447689 CAACATAGCCAGAGAAAGGTGGG + Intronic
1199628018 X:149758289-149758311 CGAGGGAAACAGAGGAAGCTGGG + Intergenic
1199655517 X:149991212-149991234 CCACCTAACTATAGGAAGCTTGG - Intergenic