ID: 905938107

View in Genome Browser
Species Human (GRCh38)
Location 1:41840766-41840788
Sequence AACCAGAGGAAGCTTGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 133}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905938097_905938107 23 Left 905938097 1:41840720-41840742 CCCATCAGATCCTGGCCGTGCCA 0: 1
1: 0
2: 0
3: 8
4: 83
Right 905938107 1:41840766-41840788 AACCAGAGGAAGCTTGGCACTGG 0: 1
1: 0
2: 0
3: 17
4: 133
905938100_905938107 8 Left 905938100 1:41840735-41840757 CCGTGCCAGCCAGCCAGTCACTG 0: 1
1: 0
2: 6
3: 33
4: 382
Right 905938107 1:41840766-41840788 AACCAGAGGAAGCTTGGCACTGG 0: 1
1: 0
2: 0
3: 17
4: 133
905938099_905938107 13 Left 905938099 1:41840730-41840752 CCTGGCCGTGCCAGCCAGCCAGT 0: 1
1: 0
2: 0
3: 22
4: 304
Right 905938107 1:41840766-41840788 AACCAGAGGAAGCTTGGCACTGG 0: 1
1: 0
2: 0
3: 17
4: 133
905938102_905938107 3 Left 905938102 1:41840740-41840762 CCAGCCAGCCAGTCACTGGACGA 0: 1
1: 0
2: 0
3: 9
4: 89
Right 905938107 1:41840766-41840788 AACCAGAGGAAGCTTGGCACTGG 0: 1
1: 0
2: 0
3: 17
4: 133
905938104_905938107 -5 Left 905938104 1:41840748-41840770 CCAGTCACTGGACGACATAACCA 0: 1
1: 0
2: 0
3: 1
4: 55
Right 905938107 1:41840766-41840788 AACCAGAGGAAGCTTGGCACTGG 0: 1
1: 0
2: 0
3: 17
4: 133
905938098_905938107 22 Left 905938098 1:41840721-41840743 CCATCAGATCCTGGCCGTGCCAG 0: 1
1: 0
2: 0
3: 10
4: 172
Right 905938107 1:41840766-41840788 AACCAGAGGAAGCTTGGCACTGG 0: 1
1: 0
2: 0
3: 17
4: 133
905938103_905938107 -1 Left 905938103 1:41840744-41840766 CCAGCCAGTCACTGGACGACATA 0: 1
1: 0
2: 0
3: 4
4: 65
Right 905938107 1:41840766-41840788 AACCAGAGGAAGCTTGGCACTGG 0: 1
1: 0
2: 0
3: 17
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905938107 Original CRISPR AACCAGAGGAAGCTTGGCAC TGG Intronic
905938107 1:41840766-41840788 AACCAGAGGAAGCTTGGCACTGG + Intronic
906104203 1:43282273-43282295 AAAAAAAGGAAGCTTGGCACTGG + Exonic
906292650 1:44629746-44629768 AATCAGAGTAAGCTTCACACAGG + Intronic
906706127 1:47896240-47896262 AGCCAGCGGAGGCTTGGCCCAGG + Intronic
908774497 1:67627088-67627110 AACCAGAGGAAGCTAGAAACTGG - Intergenic
915088656 1:153406107-153406129 AACCAGGGGAAGCTTTGTAGGGG - Intergenic
915096239 1:153464725-153464747 AACCAGGGGAAGCTTTGTAGGGG + Intergenic
916061180 1:161099465-161099487 AACCAGAAGTAGCTGGGCATTGG + Exonic
916232134 1:162550914-162550936 AAACAGAGGGAGCTTGGAATTGG - Intergenic
916986996 1:170202322-170202344 AGGCAGAGGGAGCTTGGCAGAGG - Intergenic
917365066 1:174222327-174222349 AACCAAATGAACCTTGGTACAGG + Intronic
919846686 1:201647383-201647405 ATCAAGAGGAGGCTTTGCACTGG - Intronic
922471697 1:225881178-225881200 AACCAGAGGCAGTGTGGCTCAGG + Intronic
923113984 1:230917117-230917139 AGCCAGAGGATGAGTGGCACAGG + Intronic
923166768 1:231371941-231371963 AACCTGAGGAAGGTTGGCAAGGG - Intronic
1063392403 10:5659145-5659167 CACCACAGGGAGCCTGGCACAGG - Intronic
1064173460 10:13054169-13054191 AAAAAGAGGAAACTTGGCAAGGG + Intronic
1069726749 10:70585227-70585249 TAACAGAGCAAGCTGGGCACAGG - Intergenic
1073796994 10:106999637-106999659 CACCAGCAGAAGCTTGGCTCTGG + Intronic
1074704812 10:116121262-116121284 AACCAGAGGAAACCTGGCAGGGG + Intronic
1076991702 11:279198-279220 ATCCAGACGATGCTTGGCCCGGG + Intronic
1078144192 11:8711901-8711923 TACCAGAGCAAGCTGGGCAGGGG + Intronic
1078581408 11:12542253-12542275 AACCAGAGGTAGCAGGGCACAGG + Intergenic
1081531539 11:43963348-43963370 AACTGGAGAAAGCTTGTCACTGG - Intergenic
1081597543 11:44469479-44469501 CTCCAGAGGAAGCAAGGCACTGG - Intergenic
1081635859 11:44721558-44721580 ATTCAGAGGAAGCTTGACCCTGG + Intergenic
1082224237 11:49683568-49683590 AACAAAAGGCAGCTTGGCACAGG - Intergenic
1083952375 11:65964047-65964069 AACAAGAAGAAGCATGGCTCAGG - Intronic
1084060933 11:66673876-66673898 GACAAGAGCAAGCTTAGCACTGG - Intronic
1084105834 11:66979760-66979782 AACCACAGGAAGCTAGGAAGAGG - Intergenic
1085887731 11:80540117-80540139 AGCCAGAAGAAGGTTTGCACAGG - Intergenic
1086624809 11:88935626-88935648 AACAAAAGGCAGCTTGGCACAGG + Intronic
1087453536 11:98353951-98353973 AGCCAGAGGCAGCTGGGAACAGG - Intergenic
1089781236 11:120874637-120874659 CACCAGAGGAAGCATGGCTGGGG - Intronic
1098038757 12:66333702-66333724 AAACAGAGGAAGGTTGGCTAAGG + Intronic
1101509281 12:105378327-105378349 AGCCAGAGGAAGACTGGGACAGG + Intronic
1103795878 12:123502854-123502876 GTCCAGAGGAAGCATGGCCCTGG - Intronic
1109156782 13:58921312-58921334 AACCAGAGCACTCTGGGCACAGG - Intergenic
1113432477 13:110262619-110262641 AAGAAGAGGAAGCATGGCCCAGG + Intronic
1116427706 14:44810532-44810554 AAGCAGAGGAAGCTTTGAAGTGG - Intergenic
1117218029 14:53572009-53572031 TACAAGAGGAACCTTGGCAGAGG - Intergenic
1120754443 14:88229175-88229197 AACAAGTGGAGGCTTGGAACTGG + Intronic
1121461918 14:94086624-94086646 AACCAGGGGAAGTATGGCAGAGG + Intronic
1122343503 14:101044085-101044107 AGCCAGATGAGGCTTGTCACCGG + Intergenic
1122404385 14:101491282-101491304 AACCAGAGGAAGATGGGCTGTGG + Intergenic
1122694814 14:103547388-103547410 ACCCAGGGGAAGCCTGGGACTGG + Intergenic
1125404917 15:39342088-39342110 AACCAGACTTAGCTTGGCAAGGG + Intergenic
1125893892 15:43286214-43286236 GGCCATAGGAAGCTTGGCAGGGG + Intronic
1127480213 15:59371686-59371708 ATCCAGGGGACGCTTCGCACGGG - Intronic
1128391679 15:67186836-67186858 CCCCACAGGAAGCTTGGCAGAGG - Intronic
1129052974 15:72797545-72797567 ACCAAGAGCAGGCTTGGCACTGG + Intergenic
1132905095 16:2278429-2278451 AACAAGCGGAAGCTGAGCACCGG - Exonic
1133295903 16:4752201-4752223 CCGCAGAGGAAGCTGGGCACTGG - Exonic
1134194398 16:12147910-12147932 AACAACAGGAAGCTGGGCAGAGG + Intronic
1141348277 16:83268778-83268800 AACCACTTGAAGCTGGGCACAGG + Intronic
1145059015 17:19720731-19720753 AGCAAGAGGAAGCTTGACCCAGG + Intergenic
1147664541 17:42138305-42138327 TAACAGGGGAAGCTTGGCCCTGG + Intronic
1149914205 17:60593593-60593615 AAAGAGAGGAAGCTTGGTCCAGG - Intergenic
1150208271 17:63426048-63426070 ATCAAGAGGAGGCTGGGCACAGG - Exonic
1152553746 17:81042797-81042819 ACCCAGACCAAGCTTGGCTCTGG - Intronic
1154355982 18:13623598-13623620 GACCAGAGGCAGCTCGGCCCAGG + Intronic
1157293717 18:46427246-46427268 AGCCAGAGGAAGGTGGGCACAGG - Intronic
1157711036 18:49849936-49849958 AACCGGAGGAGGCTTGGCTTGGG - Intronic
1161202763 19:3025095-3025117 AATGAGAGGAAGCTTGGAGCGGG + Intronic
1163677233 19:18661176-18661198 AACCAGAGCTGGCTTGGCCCAGG + Intronic
1164875341 19:31681332-31681354 AGGCAGAGGAATCTTGGCTCAGG - Intergenic
1166067078 19:40366269-40366291 AAAAAGAGGAAGCTGGTCACTGG - Intronic
1166210420 19:41303330-41303352 AATGAGAGGAAGCTAAGCACTGG - Intronic
1166348118 19:42179378-42179400 GACCAGGGGAAGGTGGGCACAGG + Intronic
927151147 2:20196899-20196921 AACCAGAGGAAGCTAGGGCCTGG + Intergenic
927336390 2:21929575-21929597 AACCAGAGCAAGCTTGGAAGTGG + Intergenic
929128338 2:38541205-38541227 AGCCAGAGGAAGCCTGTCAAGGG + Intergenic
930739402 2:54814521-54814543 AGACAGAGGAAGGGTGGCACAGG - Intronic
931428013 2:62188794-62188816 AAAGTGTGGAAGCTTGGCACTGG - Intergenic
932630828 2:73341821-73341843 AACCTGTGGGAGCTTGGCAGTGG + Intergenic
933586212 2:84182085-84182107 AACCCGAGGCAGCTTGGAAGGGG + Intergenic
933746806 2:85577691-85577713 AGCCAGAGGGGGCTTGGGACTGG + Intronic
935329512 2:101966282-101966304 CCCCAGAGGAAACTGGGCACAGG - Intergenic
935839843 2:107097493-107097515 AACCAGGTGCAGCTTGGCAGAGG + Intergenic
936015998 2:108959517-108959539 AACCTGAGTCATCTTGGCACAGG - Intronic
938105350 2:128526306-128526328 AACCAGAGGGAGGGTGGCAGGGG - Intergenic
938950967 2:136254074-136254096 AATCAGAGGAAGCTTTTGACTGG - Intergenic
939228390 2:139393427-139393449 GACAAAAGGCAGCTTGGCACAGG + Intergenic
939511451 2:143110808-143110830 AACCACAGGAAGCATGACTCAGG + Intronic
944874583 2:203949293-203949315 AACCACAGGAAGCTAGACAGTGG - Intronic
945212967 2:207402597-207402619 TACTATAGGAAGCATGGCACCGG - Intergenic
1170221425 20:13946596-13946618 AGCCAGTGGAAGCTGGGAACAGG + Intronic
1170704711 20:18734939-18734961 AACCAGAGGATGCTGTGCAGAGG - Intronic
1170899517 20:20447534-20447556 AACCAGAGGAATCTGTGCACAGG - Intronic
1172038929 20:32030239-32030261 AATGAGATGATGCTTGGCACAGG - Intronic
1173023713 20:39288619-39288641 GACAAGAGGAAGCTTGGACCTGG + Intergenic
1173134021 20:40423421-40423443 AACCAAAGGAAGCTAGACCCTGG + Intergenic
1174393897 20:50234201-50234223 GAGCAGAGGAAGCTTGGGAGGGG + Intergenic
1175228342 20:57458433-57458455 AACCAGAGGGAGCTTGAAAGTGG - Intergenic
1175533579 20:59691227-59691249 AATCAGAGGAAGCTTCTGACAGG - Intronic
1182101294 22:27659351-27659373 AAGCAGAGGAAGTTGGGCACTGG + Intergenic
950311444 3:11961988-11962010 AACCAGGGGCAGGTTGGCATTGG - Intergenic
951897716 3:27626187-27626209 AACCCGAGGGAGCTTGGAAGTGG + Intergenic
954156500 3:48687728-48687750 AACCACATGACGCTTGACACAGG - Intergenic
954711547 3:52507484-52507506 AACCACAGGAAGCCCAGCACTGG - Intronic
956536406 3:70281755-70281777 AATCAGAGAAAGCTTTGCAGAGG - Intergenic
962293822 3:134161994-134162016 AACCACAGGAAGCTGGGAATAGG - Intronic
962875308 3:139531516-139531538 AATCACAGGAAACTAGGCACAGG + Intronic
964433976 3:156633251-156633273 AAGGAGAGGAAGCTGGGCACTGG + Intergenic
964778123 3:160303036-160303058 AACCAGAAGAAGAATGGTACTGG - Intronic
967216483 3:187215013-187215035 AACCAGCAGAAGCTAGGAACAGG - Intergenic
969748002 4:9089037-9089059 AACCACAGGAAGCTAGGAAGAGG - Intergenic
971063926 4:23005702-23005724 AACCTGAGGGAGCTTGGAAATGG - Intergenic
977421135 4:96801242-96801264 AAGCAGAGGAGACTTGGGACAGG - Intergenic
980339682 4:131528858-131528880 AACCAGAGCAAGCTTAGTAGTGG - Intergenic
982208225 4:153013387-153013409 AACCAGGGGAGACTTGGCGCTGG + Intergenic
983323684 4:166227060-166227082 AACCAGTGGGAGCTGGGAACAGG + Intergenic
983971703 4:173883217-173883239 AACAACTGGATGCTTGGCACAGG - Intergenic
986719453 5:10550620-10550642 AACCAAGGGCAGCTTGGCAAGGG - Intergenic
987185670 5:15415893-15415915 ACCCAGAGGACTTTTGGCACTGG - Intergenic
994388613 5:99162855-99162877 CACAGAAGGAAGCTTGGCACTGG - Intergenic
994593791 5:101806458-101806480 AACCAGAGGGAGCCAGGAACTGG + Intergenic
995105477 5:108372721-108372743 AAACTGAGGAAGTTTGTCACTGG + Intronic
995903831 5:117099965-117099987 AAACTGAGGAAGCTTGGGAGTGG + Intergenic
996331819 5:122337827-122337849 AACCAGAGGAGGCAGGGCGCAGG - Intronic
996664681 5:126045269-126045291 GACTAGAGTAATCTTGGCACAGG - Intergenic
1003414587 6:5896645-5896667 AACCAGAGAAAGCTGTGCATAGG - Intergenic
1004507505 6:16258971-16258993 AACCAGGAGAAACTGGGCACAGG - Intronic
1005447288 6:25937703-25937725 AACCTGAGGGAGCTTGGAAGTGG + Intergenic
1007177705 6:39908122-39908144 AAGCAAAGGTAGCTTGCCACTGG - Intronic
1008544836 6:52575855-52575877 AACTGGAGGAAGCTTGGCATGGG - Intronic
1009469547 6:64015758-64015780 AACCAGAGGAAGCATAGCCAGGG + Intronic
1013035975 6:106383399-106383421 AACTAGAGAAAGCTTGGTTCTGG - Intergenic
1013990820 6:116252572-116252594 GCCCAGAGGAAGAATGGCACAGG + Exonic
1020583204 7:10031736-10031758 AACCATAGGAAATTTGGCATTGG + Intergenic
1022372013 7:29780993-29781015 AACCAGAGAAATTTTAGCACTGG + Intergenic
1023682031 7:42696974-42696996 AACCAGAGGGAGCATGGCATGGG + Intergenic
1024384237 7:48733286-48733308 AACCTGAGGAAGCTTAGAAGGGG - Intergenic
1030270916 7:107667380-107667402 AACCTGAGAAAGCCTGGCGCAGG + Intronic
1035360461 7:158310124-158310146 AACAAGAGAAAAATTGGCACCGG + Intronic
1035973423 8:4279162-4279184 AGACAGACGAAGCTTGGCATGGG - Intronic
1038365042 8:26922995-26923017 AACCAGAGGAAGATGGGCATAGG + Intergenic
1040706379 8:50133616-50133638 CACCAGAGGAAGCTGGGAAGGGG - Intronic
1047716191 8:127597377-127597399 AACCAGCAGAAGCTAGGCAGAGG + Intergenic
1048887407 8:138919409-138919431 AACCTAAGGAAGTTTGGCAATGG - Intergenic
1051901812 9:22051123-22051145 AACCAGAGGAAGGCCTGCACAGG - Intergenic
1055038515 9:71844136-71844158 AACCACTGGTAGCTTGGAACTGG + Intergenic
1186243531 X:7595255-7595277 AACCAGAGGAAGCAATGCAGGGG + Intergenic
1186569300 X:10697395-10697417 AACCAAAAGAAGCTTGGAACAGG + Intronic
1186934202 X:14429236-14429258 AACCAGGAGAAGCTTTGCAAAGG + Intergenic
1187571921 X:20512984-20513006 AACCAAAGGAAGTATGGTACTGG + Intergenic
1189093458 X:38112573-38112595 GAACAGAGGAAGCTGGGCAGAGG - Intronic
1192498066 X:71629481-71629503 AAGCAGTGGAAGCTTGGAGCAGG - Intergenic
1194563731 X:95455238-95455260 ACCCACAGGAAGCCAGGCACGGG + Intergenic
1200864707 Y:8030974-8030996 TACCATAGGGAGCTGGGCACAGG - Intergenic
1200896759 Y:8384020-8384042 TACCAAAGGAAGCATGGTACAGG + Intergenic