ID: 905938109

View in Genome Browser
Species Human (GRCh38)
Location 1:41840770-41840792
Sequence AGAGGAAGCTTGGCACTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 234}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905938104_905938109 -1 Left 905938104 1:41840748-41840770 CCAGTCACTGGACGACATAACCA 0: 1
1: 0
2: 0
3: 1
4: 55
Right 905938109 1:41840770-41840792 AGAGGAAGCTTGGCACTGGAAGG 0: 1
1: 0
2: 1
3: 26
4: 234
905938103_905938109 3 Left 905938103 1:41840744-41840766 CCAGCCAGTCACTGGACGACATA 0: 1
1: 0
2: 0
3: 4
4: 65
Right 905938109 1:41840770-41840792 AGAGGAAGCTTGGCACTGGAAGG 0: 1
1: 0
2: 1
3: 26
4: 234
905938102_905938109 7 Left 905938102 1:41840740-41840762 CCAGCCAGCCAGTCACTGGACGA 0: 1
1: 0
2: 0
3: 9
4: 89
Right 905938109 1:41840770-41840792 AGAGGAAGCTTGGCACTGGAAGG 0: 1
1: 0
2: 1
3: 26
4: 234
905938097_905938109 27 Left 905938097 1:41840720-41840742 CCCATCAGATCCTGGCCGTGCCA 0: 1
1: 0
2: 0
3: 8
4: 83
Right 905938109 1:41840770-41840792 AGAGGAAGCTTGGCACTGGAAGG 0: 1
1: 0
2: 1
3: 26
4: 234
905938099_905938109 17 Left 905938099 1:41840730-41840752 CCTGGCCGTGCCAGCCAGCCAGT 0: 1
1: 0
2: 0
3: 22
4: 304
Right 905938109 1:41840770-41840792 AGAGGAAGCTTGGCACTGGAAGG 0: 1
1: 0
2: 1
3: 26
4: 234
905938100_905938109 12 Left 905938100 1:41840735-41840757 CCGTGCCAGCCAGCCAGTCACTG 0: 1
1: 0
2: 6
3: 33
4: 382
Right 905938109 1:41840770-41840792 AGAGGAAGCTTGGCACTGGAAGG 0: 1
1: 0
2: 1
3: 26
4: 234
905938098_905938109 26 Left 905938098 1:41840721-41840743 CCATCAGATCCTGGCCGTGCCAG 0: 1
1: 0
2: 0
3: 10
4: 172
Right 905938109 1:41840770-41840792 AGAGGAAGCTTGGCACTGGAAGG 0: 1
1: 0
2: 1
3: 26
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905938109 Original CRISPR AGAGGAAGCTTGGCACTGGA AGG Intronic
900151133 1:1179809-1179831 GCAGGAAGCCTGGCCCTGGAGGG + Intronic
900353523 1:2248537-2248559 AAAGGAAGCCTGGCAGTGGCGGG + Intronic
900665343 1:3811325-3811347 AGAGGAACCTTGGCACTCTCTGG - Intergenic
901145917 1:7064590-7064612 AGAGGAAGGTGGCCAGTGGAGGG + Intronic
901168092 1:7234202-7234224 AGAGGAAGCTTGGCAGAGGCTGG - Intronic
902284814 1:15400724-15400746 AGACAAAGCGTGGCAGTGGAAGG - Intergenic
902982779 1:20137878-20137900 AGAGGCAGCTGGGCAGAGGAAGG + Intergenic
904419110 1:30380019-30380041 AGCAGGAGCTGGGCACTGGAGGG + Intergenic
904466095 1:30708287-30708309 GGAGGAAGCTGGCCACAGGATGG - Intergenic
904771708 1:32884708-32884730 GGAGGGAGCTTGCCACTGGAGGG + Intergenic
905093408 1:35448154-35448176 AGAGGTAGCTGGGCAATGAATGG - Exonic
905308018 1:37032641-37032663 AGAGGAGGCCAGGCACGGGAGGG - Intronic
905938109 1:41840770-41840792 AGAGGAAGCTTGGCACTGGAAGG + Intronic
908155454 1:61348170-61348192 AGAGAAAGCTTCACACTTGAGGG - Intronic
908956104 1:69630031-69630053 ATAGGAAGCAGGACACTGGAGGG - Intronic
910063279 1:83119594-83119616 AGAGGAAGAGTGGCAACGGATGG + Intergenic
910551723 1:88482880-88482902 AGAGCAGGCTTGGCAGGGGAAGG - Intergenic
911207953 1:95111664-95111686 GGAGGAAACTTAGCACTTGATGG + Intergenic
913073811 1:115324367-115324389 TGAGGAAGCTATGAACTGGAAGG - Intronic
913269292 1:117077152-117077174 AGTGGATGCTTGAAACTGGATGG - Intronic
914995710 1:152541740-152541762 AGAGGAAGTTGGGTGCTGGATGG + Intronic
915269917 1:154746706-154746728 AGAGGAAGCTCTGCCCTAGAGGG + Intronic
915495098 1:156276823-156276845 AGAGTAGGTCTGGCACTGGAAGG - Intronic
915497732 1:156293463-156293485 AGGGGAAGCTTGGCAGGGCAGGG + Exonic
915936485 1:160092898-160092920 AGAGGGGGCTGGGCCCTGGACGG - Intronic
917325159 1:173824557-173824579 AGAGAAAGCTTCGCACCGGTAGG - Exonic
918239536 1:182609571-182609593 GGAGGAAGCTGGGCGCTGGCAGG - Intergenic
919774704 1:201186830-201186852 AGTGTAGACTTGGCACTGGATGG + Intergenic
921029168 1:211322273-211322295 AGAAGAAGTATGGAACTGGAAGG + Intergenic
921955476 1:220979265-220979287 ATAGGAACCTTAGGACTGGAAGG - Intergenic
922136402 1:222831732-222831754 AGAGGAAGCCTGAGACAGGATGG + Intergenic
922188179 1:223294542-223294564 ACAGGAGGCATGGCACTGGCAGG + Intronic
923112850 1:230906077-230906099 AGAGCAAGCTTGCTAATGGATGG + Intergenic
923447926 1:234089728-234089750 AGAGGCAGTTCGCCACTGGAGGG + Intronic
923494796 1:234514523-234514545 AGAGGGAGGGTAGCACTGGAGGG + Intergenic
1063158899 10:3404910-3404932 TGAGGGAGCTTGGAAATGGAAGG + Intergenic
1063208501 10:3857280-3857302 AGAGGAAGCTTGGCAAGAGCTGG - Intergenic
1064342463 10:14499564-14499586 AGAGGGAGCTGGGCACTGGCAGG - Intergenic
1064772549 10:18738434-18738456 AGAGGAGCCTTGGAACTGCAGGG - Intergenic
1066286516 10:33971697-33971719 TTAGGTAGCTTGGCTCTGGAAGG - Intergenic
1067385081 10:45811568-45811590 AGAGGAAGGTAGAGACTGGATGG - Intergenic
1069617970 10:69818227-69818249 AGAAGGAACTGGGCACTGGATGG - Intronic
1070662599 10:78318152-78318174 AGGGGAGGCTGGGCATTGGAGGG + Intergenic
1071481430 10:86067864-86067886 GGAGGAAGCTTGGCACAGCGGGG - Intronic
1071570392 10:86693431-86693453 ACAGAAAGCTTGGCCCAGGATGG - Intronic
1071749467 10:88458282-88458304 AGTGGAATCTTGGCACTGGTAGG - Intronic
1071837002 10:89428110-89428132 AGGGGAGGCTTGGTACTTGAAGG + Intergenic
1073425102 10:103451434-103451456 AGAGGAAGCCAGGGAGTGGAGGG + Intronic
1074391719 10:113063587-113063609 AAAGGAAACTTGACACCGGATGG + Intronic
1075355948 10:121775906-121775928 AGAGTATTCTTGTCACTGGAAGG - Intronic
1075680360 10:124326827-124326849 AGTGGAGTGTTGGCACTGGAAGG - Intergenic
1077456843 11:2686431-2686453 TGTGGAAACTTGGCAGTGGAGGG - Intronic
1078144195 11:8711905-8711927 AGAGCAAGCTGGGCAGGGGAGGG + Intronic
1078924062 11:15858461-15858483 AGAGGAAGCATGGTGTTGGAAGG - Intergenic
1083970092 11:66069696-66069718 AGAGGAAGGTTGGCTCCAGATGG + Intergenic
1084419352 11:69052653-69052675 ATAGGCAGCTGGGCCCTGGACGG - Intronic
1085755822 11:79200476-79200498 AGAGCAAACTTGGCCCAGGAAGG + Intronic
1086407401 11:86510094-86510116 TTAGGAAGTTTGGCAATGGAAGG - Intronic
1088773424 11:113058407-113058429 AGAGGAAGATTGATAGTGGAAGG + Intronic
1089282734 11:117385751-117385773 AGAGGAAGCCAGGCTTTGGAAGG + Intronic
1089416372 11:118295552-118295574 GGAGTAAGGATGGCACTGGATGG - Intergenic
1089498151 11:118918143-118918165 GGAGGAAGCTGGGGACTGGGAGG - Intronic
1089668138 11:120033189-120033211 AGAGCAAGCCTGGCACTGATGGG + Intergenic
1091056680 11:132425718-132425740 AAAGCAAGCTTGGCTCTGGCTGG + Intronic
1091821030 12:3475266-3475288 AGAGGAAGTTTGGGAGGGGAAGG + Intronic
1095317950 12:40789203-40789225 AGAAGAAGCTTGGCAAGGAAAGG + Intronic
1097229198 12:57498874-57498896 AGAGGAAGGGAGGCACTAGAGGG - Intronic
1098179051 12:67826356-67826378 AGAGGAATCTTGGCCCCAGACGG - Intergenic
1099788891 12:87304593-87304615 AGAAGAGGCTTAGCTCTGGAAGG - Intergenic
1102797479 12:115701149-115701171 AGAGAAAGTCTGGCTCTGGAAGG + Intergenic
1103741293 12:123093593-123093615 AGTGGGAGGTTGGCTCTGGAGGG - Intronic
1105438861 13:20399656-20399678 GGAAGAAGCTTGGCCCTGCATGG - Intergenic
1105892387 13:24690825-24690847 AGAGGAAGCATGGAACTGAAGGG + Intronic
1112039165 13:95528552-95528574 AGAGGAAGCAAAGAACTGGATGG + Intronic
1112279780 13:98052569-98052591 AGAGGAAGCTATGAACTGGTAGG - Intergenic
1112992589 13:105532189-105532211 TGAGGATGCTGGGCACTGCATGG - Intergenic
1114661336 14:24347109-24347131 ACAGGAGGCTGGGCACTGGCTGG - Intergenic
1118361617 14:65062063-65062085 TGAGGCAGGTGGGCACTGGAGGG - Exonic
1119076678 14:71647186-71647208 AGAGGAAACTTGACATTGTAAGG + Intronic
1119185143 14:72635355-72635377 ACAGCAGCCTTGGCACTGGAAGG + Intronic
1119372072 14:74155117-74155139 AGGGGCTGCTTGGCACTAGAAGG - Intronic
1119958127 14:78822971-78822993 TGAGGGAGCTTGACTCTGGAAGG - Intronic
1121065478 14:90960018-90960040 AGAGGGAGTGTGGCACTGGTGGG - Intronic
1122859625 14:104576718-104576740 AGAGGGAGCTGGGCTCAGGACGG + Intronic
1202849984 14_GL000225v1_random:10103-10125 AGAGGAGGCAAGGCGCTGGAGGG - Intergenic
1202856506 14_GL000225v1_random:54542-54564 AGAGGAGGCGAGCCACTGGAGGG - Intergenic
1123456800 15:20433632-20433654 AGTGGCAGCTGAGCACTGGACGG - Intergenic
1123661262 15:22566724-22566746 AGTGGCAGCTGAGCACTGGACGG + Intergenic
1124262950 15:28208785-28208807 AGTGGCAGCTGAGCACTGGACGG - Intronic
1124315062 15:28660960-28660982 AGTGGCAGCTGAGCACTGGACGG + Intergenic
1124355999 15:28995172-28995194 AGAGGAAGCTCTGCACAGGAAGG - Intronic
1126697823 15:51341075-51341097 AGGAGACACTTGGCACTGGAAGG - Intergenic
1128202088 15:65817445-65817467 AGAGGAAGCTCTTCACTGGAGGG - Intronic
1128268193 15:66285598-66285620 AGAGGAAGCCAGGCACTTTATGG - Intergenic
1128565495 15:68698199-68698221 TGAGGAAGCTTGGCAGAGCATGG - Intronic
1128906328 15:71471157-71471179 AGGGGTAGCCTGGGACTGGATGG - Intronic
1129052977 15:72797549-72797571 AGAGCAGGCTTGGCACTGGGAGG + Intergenic
1129608442 15:77035998-77036020 TGAGGACGCAAGGCACTGGATGG - Intronic
1129933579 15:79431792-79431814 AGCGGAAGCTGCGCGCTGGAGGG - Intergenic
1129994094 15:79989983-79990005 AGAGGAAGATGCACACTGGAAGG - Intergenic
1130832539 15:87616325-87616347 ATTGAAAGCTTGGCTCTGGATGG - Intergenic
1131636938 15:94245923-94245945 AGATGAAGCTTGACACTCCAGGG - Intronic
1131854847 15:96582708-96582730 AGAGGAAGTCTGCCACTGGCAGG - Intergenic
1132446354 15:101923788-101923810 GGAGGGAGCTTGGAATTGGAAGG + Intergenic
1133645946 16:7764728-7764750 AAAGGATGCTTGGAATTGGAAGG - Intergenic
1135435450 16:22424187-22424209 AGGGGAATCTTGGCACTGTTGGG - Intronic
1136064440 16:27749399-27749421 AGAGGCCTCTTGGCACTGGATGG - Intronic
1137886041 16:52104654-52104676 ATGGGAAGCTTGGCGCTGCAGGG + Intergenic
1141832869 16:86519499-86519521 AGAGGAAGCCTGGCAGAGCAGGG + Intergenic
1142808913 17:2386204-2386226 ACAGGAAGCTTGGCAGTGGCTGG + Exonic
1143565818 17:7719919-7719941 AGAGGATGCTTAGCAATGGAGGG + Intronic
1143646203 17:8231945-8231967 AGAGGAAGGAGGGTACTGGATGG - Exonic
1144495479 17:15742521-15742543 TGAGGAAGCTGGGCACTGCAGGG - Intronic
1144760870 17:17706560-17706582 AGAGGGAGCCGGGGACTGGATGG + Intronic
1146552708 17:33795544-33795566 AGGGGAAGGTTGACACTGGAGGG - Intronic
1147468053 17:40627227-40627249 GGAGGAAGCTTGATACTGGGTGG - Exonic
1149914204 17:60593589-60593611 AGAGGAAGCTTGGTCCAGGTTGG - Intergenic
1150507149 17:65710785-65710807 AGAGTAAGCTGGGACCTGGATGG - Intronic
1151591717 17:75048663-75048685 AGAGGAAGCTCGGTACTGCCAGG - Intronic
1155227442 18:23741213-23741235 AGAGTATGCTTGGCTCTGGGAGG - Intronic
1156461352 18:37323039-37323061 GGAGGAAGCTTGTGACTGGCTGG - Intronic
1157530178 18:48413758-48413780 AGGGGAAGCTGGCCCCTGGAAGG - Intergenic
1158486464 18:57870783-57870805 AGCGGAAGCTGGTCACTGGAAGG - Intergenic
1160144723 18:76354262-76354284 AGAGGAAGTCTGTGACTGGAAGG - Intergenic
1160836276 19:1126218-1126240 AGTGGAAGCGTGGCACAGGAAGG + Intronic
1161157157 19:2738473-2738495 CGAGCAAGCTTGGCACAGAAAGG - Intronic
1162602611 19:11680468-11680490 ACAGGAAGCATGGTACTGGAAGG + Intergenic
1163188164 19:15654099-15654121 AGAGGAAGCATTGGAGTGGACGG + Intronic
1163216726 19:15884749-15884771 AGAGGAAGCATTGGAATGGACGG - Intronic
1163281135 19:16318511-16318533 AGGAGAGGCTTGGCACTGGGAGG - Intergenic
1163323393 19:16587554-16587576 AGAGGAAGAATGACACTGGGAGG + Intronic
1167904079 19:52643961-52643983 GGAGGAAGCTGGACACTGGCAGG + Intronic
1168652526 19:58100783-58100805 TGAGGCAGCTTGAAACTGGAAGG + Intronic
925370973 2:3345225-3345247 AGAGGCAGCTCCCCACTGGAAGG - Intronic
925701855 2:6646871-6646893 GGAGGATGCTAGACACTGGAGGG - Intergenic
926588762 2:14717812-14717834 GGAGGGAGCTTGGCATTGGGGGG - Intergenic
927874297 2:26644450-26644472 AGTGGCAGCTTGGCACTGGCTGG + Intergenic
927982820 2:27385191-27385213 AGAGGAACCTTGGGAGTGGGAGG - Intronic
928898388 2:36291771-36291793 AGTGGAAGATTGGGACAGGAAGG + Intergenic
929983843 2:46706236-46706258 AGAGCAAGTTTGACACGGGAAGG + Intronic
930274604 2:49296882-49296904 GGAGGGGGCTTGGCCCTGGAAGG + Intergenic
931116166 2:59169147-59169169 GGAGGAAGCTTGGAAATGGAAGG - Intergenic
931501376 2:62871667-62871689 ACAGGAAGTTTGGTAATGGAAGG - Intronic
933214780 2:79617793-79617815 AGAGGAGGCTGGGCACCTGATGG - Intronic
934528805 2:95072173-95072195 AGAGTAAGCCTGGGACTGAATGG - Intergenic
935172376 2:100620506-100620528 ATGGGAAGCTGGGCACTGGGGGG + Intergenic
936787614 2:116112633-116112655 AGAAGAAGCTTAGCATTTGAAGG - Intergenic
938305176 2:130248371-130248393 AGAGGAAGCATGAAACTGAAGGG + Intergenic
938448839 2:131398836-131398858 AGAGGAAGCATGAAACTGAAGGG - Intergenic
940195299 2:151087859-151087881 CGAGGAAGCTTTGCACAGCAGGG - Intergenic
941092926 2:161198866-161198888 AGATAAATCTTGGTACTGGAGGG + Intronic
941266961 2:163374465-163374487 AGAGGAAGTGTGGCAGAGGAAGG + Intergenic
941683805 2:168427412-168427434 AGAAGAAGGTTGCTACTGGAAGG + Intergenic
943535718 2:189147492-189147514 AGAGGAATCATGGTACTGGGAGG + Intronic
945673594 2:212831247-212831269 AGAAGGTGGTTGGCACTGGAAGG + Intergenic
946024905 2:216665793-216665815 AGAGGGCTCTGGGCACTGGATGG + Intergenic
946721960 2:222618432-222618454 AGGGGAATCTTAGAACTGGAAGG - Intronic
948180266 2:235973814-235973836 AGAGGAACCTGGGCTCTAGAAGG + Intronic
948423938 2:237876379-237876401 GGAAGGAGCTTGGCACTGGGAGG - Intronic
1170221428 20:13946600-13946622 AGTGGAAGCTGGGAACAGGAGGG + Intronic
1172870865 20:38134790-38134812 ACAGGAAGCCAGGCCCTGGATGG - Intronic
1182444162 22:30380520-30380542 AGAGGAAGCTGGGGACTGCAGGG - Intronic
1184420904 22:44382393-44382415 AGAGGGAGCTGGGCACAGCATGG - Intergenic
1184692893 22:46125369-46125391 AGAGAGAGCTTTGCACTGGTGGG - Intergenic
1184826429 22:46955388-46955410 AAAGGCAGCTTCACACTGGAAGG + Intronic
949455307 3:4231757-4231779 AGAAGAATCTTGGCAATGGGAGG + Intronic
950116675 3:10455258-10455280 AGGGGAAACTGGGCAGTGGAGGG - Intronic
953151112 3:40325881-40325903 ACAGGAATCATGGCACTTGAAGG + Intergenic
953381986 3:42478889-42478911 AAAGGAGGGTTGGGACTGGAAGG - Intergenic
956536405 3:70281751-70281773 AGAGAAAGCTTTGCAGAGGATGG - Intergenic
956886815 3:73568667-73568689 AGAGGCAGCTTGGGACTTGCTGG + Intronic
957165940 3:76674169-76674191 AGGGGAAGGATGGAACTGGAGGG + Intronic
958616648 3:96501817-96501839 AGAGGAAGCATTCCACTGGATGG - Intergenic
961448762 3:126993023-126993045 AGAGGAACCTGGTCACTGGCTGG - Intronic
962255432 3:133867084-133867106 AGAGGCACCTTGGCATTAGAAGG - Intronic
962701409 3:138003225-138003247 AGAGGACATTTGGCAATGGAAGG - Intronic
964035026 3:152185042-152185064 TGAGGAAGTTTGGCAGTGGATGG - Intergenic
964485843 3:157184613-157184635 AGAGGAAGCAAGGTAGTGGATGG - Intergenic
968582546 4:1401791-1401813 AGAGGGAGCTTGGCTCTGCCTGG - Intergenic
969494773 4:7520244-7520266 AAAGGAACTCTGGCACTGGAGGG + Intronic
969514787 4:7641025-7641047 AGAGGCAGCATGGACCTGGAAGG + Intronic
969588765 4:8109503-8109525 AGGGGCAGGTTGGAACTGGATGG - Intronic
970399381 4:15703108-15703130 GGAGGAAGCACGGGACTGGAGGG + Exonic
972270045 4:37502316-37502338 AGAGGCAGCATGGCTCAGGAAGG + Intronic
976571482 4:86616754-86616776 ATAGAAAGCATGGCATTGGAAGG - Intronic
976820216 4:89197904-89197926 AGAGGAAGCATGGCTGGGGAGGG - Intergenic
977996954 4:103505715-103505737 AGAGAAACCTAGACACTGGAAGG + Intergenic
978112053 4:104975748-104975770 AGAAGCAGCTTAGCTCTGGAGGG - Intergenic
980718410 4:136659451-136659473 AGAGGAAATTGGTCACTGGAGGG + Intergenic
981089629 4:140719455-140719477 GAAGGAAGCTGGGCACTGGAAGG + Intronic
982938101 4:161511840-161511862 AGAAGAAGATGGGTACTGGAGGG + Intronic
984638573 4:182140729-182140751 AGAGCCAGCTTGGAACTGAAGGG - Intergenic
985020877 4:185688946-185688968 GGAGTAAGCTTGACTCTGGATGG - Intronic
985347707 4:189023980-189024002 AGAGGATGCTTGAAACGGGATGG - Intergenic
994122745 5:96135029-96135051 GGAGAAAGCTTGGCACTTGCAGG + Intergenic
997259407 5:132454498-132454520 GGAGGAAGCTAGGCTCTGAAGGG - Intronic
998072950 5:139212766-139212788 AGTGGTAGCCAGGCACTGGAAGG - Intronic
1000094183 5:157956357-157956379 AGGGTAAGCTTCACACTGGAAGG + Intergenic
1001306514 5:170578339-170578361 AGAGGATGGTTGGCTCTGGAGGG + Intronic
1001928518 5:175657090-175657112 TGTGGAAGCTTGGCAAAGGATGG - Intergenic
1002376719 5:178794470-178794492 GCAGGAATCTTGGCCCTGGAGGG + Intergenic
1002397788 5:178971482-178971504 AGAGGAGGCCTGGCTCTGGCTGG + Intergenic
1002972201 6:2035263-2035285 AGAGAAAACTTGGCACATGAGGG - Intronic
1003371739 6:5534448-5534470 AGAGGTTACTAGGCACTGGAGGG - Intronic
1004924213 6:20402936-20402958 AGAGGAAGCTTCGAGTTGGAGGG - Intronic
1005064083 6:21801422-21801444 AGAGCATCCTTGGCACTGCATGG + Intergenic
1010363959 6:75028299-75028321 AAGGGAAGCTTAGCAGTGGAGGG + Intergenic
1011851589 6:91636017-91636039 ACAGGAAGCTTGGGACCAGAAGG + Intergenic
1012559162 6:100557684-100557706 AGAGGAAGATTGCCAGAGGATGG + Intronic
1012810327 6:103948707-103948729 AGAGCAAGCTTGGGACAGTAGGG + Intergenic
1013990823 6:116252576-116252598 AGAGGAAGAATGGCACAGGCAGG + Exonic
1014904664 6:127011665-127011687 TGAGGAAGCTAAGCACTGCAAGG + Intergenic
1015388306 6:132651430-132651452 AGGAGAAGCTAGGCACAGGAGGG - Intergenic
1016278066 6:142378665-142378687 AGAGGAAGCTTGGCTGTGAAAGG - Intronic
1016540273 6:145156833-145156855 ACAGGAAGTTTGACTCTGGAGGG + Intergenic
1017580161 6:155855908-155855930 ACTGGAAGTTTGGCTCTGGATGG - Intergenic
1018689696 6:166334627-166334649 TGTGGAATCTCGGCACTGGAGGG + Intronic
1019357685 7:589421-589443 GGAGGAATCTTGGCAGTGGTGGG - Intronic
1020433888 7:8141276-8141298 AGGGGTTGCTTGGCACTGGCAGG + Intronic
1020705387 7:11537606-11537628 ACAGGAAGCATGGCACTGTTAGG - Intronic
1022348746 7:29545817-29545839 AGAGGAAGATTGCCAGAGGATGG + Intergenic
1022523535 7:31022907-31022929 AGAGGAGGCGTGGCAGTGGGTGG + Intergenic
1023110387 7:36805162-36805184 AGAAGAACCATGGCACTTGATGG - Intergenic
1024003896 7:45211427-45211449 GGAGAAAGCTTGGCACTGCCCGG + Intergenic
1024283150 7:47735998-47736020 AGAGACATCTTGGCAGTGGAAGG - Intronic
1024712539 7:52033298-52033320 AGAAAAAGAATGGCACTGGATGG + Intergenic
1031858957 7:126957142-126957164 AGAGGGAGCTTGTGCCTGGAAGG + Intronic
1032738467 7:134714148-134714170 ACAGGAAGCATGGCACTTGGAGG - Intergenic
1034539162 7:151745074-151745096 AGAGGCAGCCTGGCTCTTGATGG - Intronic
1035998605 8:4576591-4576613 AGAGTAAGCTAGATACTGGATGG - Intronic
1036485142 8:9172728-9172750 AAAGGAAGCTCGTCTCTGGATGG - Intergenic
1037309001 8:17535415-17535437 AGGGGAAGCAGGGCACTGCAAGG - Intronic
1037390393 8:18386721-18386743 AGAGGAACCTTGGTACGGGTGGG - Intergenic
1037536490 8:19829005-19829027 AAAGGAAGGTGGGCAGTGGAGGG + Intronic
1039084175 8:33763389-33763411 AGGGGATGCTTGGTGCTGGAAGG + Intergenic
1040412311 8:47167012-47167034 AGGGGAAGCCTGGCCCAGGATGG - Intergenic
1041707238 8:60859553-60859575 AAAGGAAGCCTGGGAGTGGAGGG + Intronic
1043589143 8:81807809-81807831 TGAGGAAGCTTTTCACTGGAAGG + Intronic
1044899209 8:96926182-96926204 AGAGGTATCTTGGAATTGGAAGG - Intronic
1046715353 8:117560994-117561016 AGAGGAGGCTATGCACTGGTGGG + Intergenic
1047791883 8:128211589-128211611 AGAGGTTGCTTGGCAGTGGTAGG + Intergenic
1047805218 8:128352294-128352316 AGAGGAAGCCTAGGACAGGATGG - Intergenic
1049395042 8:142396148-142396170 ATGGGAAGCTGGGCATTGGAGGG - Intronic
1049601262 8:143508796-143508818 AGGGGAAGCTGGGCACTGACTGG - Intronic
1050314358 9:4386036-4386058 AGAGGTAGTTTGTCACTGGTTGG - Intergenic
1054787658 9:69224245-69224267 ATATGAAGCTTGGCATTGAAAGG - Intronic
1055078143 9:72238108-72238130 AGATGAGGCTGGGCAGTGGATGG - Intronic
1055312540 9:74997973-74997995 AGAGGGAGATTGGCACTAAAAGG - Intronic
1056544937 9:87605810-87605832 GCAGGAAGCTGGGGACTGGAGGG - Intronic
1056737272 9:89220403-89220425 ACAGGAAGATTGGCTCTTGAGGG + Intergenic
1059499472 9:114738780-114738802 AGAAGGACCTTGGCCCTGGATGG + Intergenic
1060197894 9:121635080-121635102 AGGGGAAGCTTGGCAGAGGGTGG + Intronic
1062547746 9:137071189-137071211 AGAGGGAGCTGGTCACTAGATGG - Intergenic
1186256664 X:7729278-7729300 GGAGGAAGGGTGGCACAGGAAGG - Intergenic
1188529945 X:31128730-31128752 AGAGTTAGCTTGGCTCTGGGAGG - Intronic
1192052861 X:67743182-67743204 AGAGGAAGATTGTTATTGGAGGG - Intergenic
1192227337 X:69238409-69238431 AGAGGGAGCTGGGCACTGGAGGG - Intergenic
1192496133 X:71617724-71617746 AGAGGGCTCTGGGCACTGGAGGG - Intronic
1193951251 X:87802053-87802075 GGAGGAAGAGTGGCACAGGAAGG + Intergenic
1197773477 X:130105533-130105555 GGAGGAAGCTTGGCCCTGGTTGG - Intronic
1197872055 X:131070056-131070078 AGAGGACCCTAGGCACTGCAGGG + Intronic
1201903315 Y:19065150-19065172 AGAGATAGCTTCGCACTGGGGGG - Intergenic