ID: 905938110

View in Genome Browser
Species Human (GRCh38)
Location 1:41840773-41840795
Sequence GGAAGCTTGGCACTGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 263}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905938097_905938110 30 Left 905938097 1:41840720-41840742 CCCATCAGATCCTGGCCGTGCCA 0: 1
1: 0
2: 0
3: 8
4: 83
Right 905938110 1:41840773-41840795 GGAAGCTTGGCACTGGAAGGAGG 0: 1
1: 0
2: 0
3: 21
4: 263
905938100_905938110 15 Left 905938100 1:41840735-41840757 CCGTGCCAGCCAGCCAGTCACTG 0: 1
1: 0
2: 6
3: 33
4: 382
Right 905938110 1:41840773-41840795 GGAAGCTTGGCACTGGAAGGAGG 0: 1
1: 0
2: 0
3: 21
4: 263
905938103_905938110 6 Left 905938103 1:41840744-41840766 CCAGCCAGTCACTGGACGACATA 0: 1
1: 0
2: 0
3: 4
4: 65
Right 905938110 1:41840773-41840795 GGAAGCTTGGCACTGGAAGGAGG 0: 1
1: 0
2: 0
3: 21
4: 263
905938104_905938110 2 Left 905938104 1:41840748-41840770 CCAGTCACTGGACGACATAACCA 0: 1
1: 0
2: 0
3: 1
4: 55
Right 905938110 1:41840773-41840795 GGAAGCTTGGCACTGGAAGGAGG 0: 1
1: 0
2: 0
3: 21
4: 263
905938098_905938110 29 Left 905938098 1:41840721-41840743 CCATCAGATCCTGGCCGTGCCAG 0: 1
1: 0
2: 0
3: 10
4: 172
Right 905938110 1:41840773-41840795 GGAAGCTTGGCACTGGAAGGAGG 0: 1
1: 0
2: 0
3: 21
4: 263
905938102_905938110 10 Left 905938102 1:41840740-41840762 CCAGCCAGCCAGTCACTGGACGA 0: 1
1: 0
2: 0
3: 9
4: 89
Right 905938110 1:41840773-41840795 GGAAGCTTGGCACTGGAAGGAGG 0: 1
1: 0
2: 0
3: 21
4: 263
905938099_905938110 20 Left 905938099 1:41840730-41840752 CCTGGCCGTGCCAGCCAGCCAGT 0: 1
1: 0
2: 0
3: 22
4: 304
Right 905938110 1:41840773-41840795 GGAAGCTTGGCACTGGAAGGAGG 0: 1
1: 0
2: 0
3: 21
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905938110 Original CRISPR GGAAGCTTGGCACTGGAAGG AGG Intronic
900005574 1:46856-46878 GGAAGTTTGGCAGAGGAAGAGGG - Intergenic
900151134 1:1179812-1179834 GGAAGCCTGGCCCTGGAGGGTGG + Intronic
901419070 1:9137996-9138018 GGAATCTTGGCTGGGGAAGGGGG - Intergenic
904474963 1:30758878-30758900 AGAAGCTTGGCATTGCAAAGGGG - Intergenic
905472901 1:38206791-38206813 GCCAGCTTGGCACAGGGAGGGGG + Intergenic
905734174 1:40314890-40314912 GGTCCTTTGGCACTGGAAGGAGG - Intronic
905938110 1:41840773-41840795 GGAAGCTTGGCACTGGAAGGAGG + Intronic
906144784 1:43553549-43553571 TGTAGCTTGGCACACGAAGGAGG - Exonic
907256678 1:53184527-53184549 GGGAGGAAGGCACTGGAAGGAGG + Intergenic
907341113 1:53737166-53737188 TGAAGCTGGCCACGGGAAGGTGG - Intergenic
907712820 1:56900087-56900109 GGAAGCTAGGCAGAAGAAGGAGG - Intronic
909128513 1:71706697-71706719 GGAAGCTAGGGCCTGGAATGGGG - Intronic
910771915 1:90839551-90839573 GGAATCTTGGCACTGAGAGTGGG + Intergenic
912276390 1:108262567-108262589 AGAAGCACGGGACTGGAAGGGGG - Intergenic
912291838 1:108431791-108431813 AGAAGCACGGGACTGGAAGGGGG + Intronic
915495097 1:156276820-156276842 GTAGGTCTGGCACTGGAAGGTGG - Intronic
915722701 1:157995874-157995896 GGAAGCTTGGCAAGGGACTGGGG + Intronic
916434526 1:164765394-164765416 GGAAACTTGGAACAGGAAGAGGG + Intronic
918435631 1:184509651-184509673 TGAAGCTTAACATTGGAAGGTGG + Intronic
918703887 1:187637785-187637807 GTAAACTTGGCATTGGAAGGTGG - Intergenic
918989982 1:191685450-191685472 GGGAGCTAGGTCCTGGAAGGGGG + Intergenic
919767673 1:201137878-201137900 GAAGGCATGGAACTGGAAGGAGG - Intronic
920648585 1:207820831-207820853 GGAACCATGGCACTGGCAGGGGG + Intergenic
922244011 1:223777236-223777258 AGAAGCTTGGCTCTGGAGGAAGG - Intergenic
924848518 1:247798905-247798927 GGAAGCTTTGCATAGGAAAGAGG - Intergenic
1063214217 10:3909488-3909510 GCCTGCTTGGCCCTGGAAGGTGG - Intergenic
1065322696 10:24523980-24524002 AGATGCTTGGCAGTGAAAGGAGG + Intronic
1066316636 10:34253926-34253948 GGAAGCGTGGGAGTGGGAGGGGG + Intronic
1070542551 10:77426838-77426860 GAAAGCGTGGCCCTGGAAGGAGG - Intronic
1070700868 10:78600766-78600788 GGAAGCTTGAAAATGGATGGAGG + Intergenic
1072319341 10:94233495-94233517 GGAAGCTGGGCACTGAATGTAGG - Intronic
1073077480 10:100833326-100833348 GGCAGCTTCCCAATGGAAGGAGG - Intergenic
1073681772 10:105712500-105712522 GGTAGCTTGGAACTGCATGGAGG - Intergenic
1074095143 10:110304917-110304939 GAACGCCGGGCACTGGAAGGAGG + Exonic
1074638150 10:115344930-115344952 GGAAGCTAAGACCTGGAAGGAGG + Intronic
1074766066 10:116700888-116700910 GGAAGCTTGGCACTCCATTGCGG + Intronic
1074816583 10:117146160-117146182 GGAGGCATCTCACTGGAAGGTGG + Intergenic
1075797285 10:125129722-125129744 GGAGGCCTGTCTCTGGAAGGAGG + Intronic
1077020163 11:413808-413830 GGAAGGTGGGCAGGGGAAGGTGG - Intronic
1077254417 11:1573910-1573932 GGAGGCTTGGCCCTGGGAGGGGG + Intergenic
1077887835 11:6399170-6399192 AGTAGCTTGGCCCTGGAAAGTGG - Intronic
1078924061 11:15858458-15858480 GGAAGCATGGTGTTGGAAGGAGG - Intergenic
1079315832 11:19407120-19407142 AGAATCTTTGCACTGGCAGGAGG - Intronic
1079374505 11:19880004-19880026 GCCAGCCTGGCACTGGGAGGGGG - Exonic
1082946555 11:58767560-58767582 GGGAGCTTGCCATTGGTAGGTGG - Intergenic
1082987890 11:59183674-59183696 AGAGGTTTGGCACTGGGAGGAGG + Intronic
1084325447 11:68397355-68397377 GGAAGAGTGGCACTGGAGCGTGG - Intronic
1084770066 11:71336836-71336858 GGAAGCTGGGCATGGGAATGTGG + Intergenic
1084771044 11:71343258-71343280 GGAAGCTTGGCTGGGAAAGGTGG - Intergenic
1085180816 11:74534492-74534514 GGAAGTTAGGCACTGGGAGAAGG + Intronic
1086999228 11:93396630-93396652 GGAAGATTGGCACTTGAATCAGG - Intronic
1088663738 11:112074105-112074127 GCAAGCCTGGCACCAGAAGGGGG - Exonic
1089498150 11:118918140-118918162 GGAAGCTGGGGACTGGGAGGAGG - Intronic
1089983916 11:122795226-122795248 GGAAGGTTGGAGATGGAAGGAGG + Intronic
1090351350 11:126110499-126110521 GGACCCTTGGCACTGGAAAGAGG + Intergenic
1090480924 11:127067406-127067428 GGAAGTTGGGAACTGGGAGGAGG + Intergenic
1090921986 11:131214930-131214952 GGAACCTTGGCCGTGGAAGAGGG - Intergenic
1091275892 11:134349915-134349937 GGAAGCTAGGGCCTGGAACGAGG + Intronic
1091301635 11:134511520-134511542 GGAAGCTGGGCACAGAGAGGTGG - Intergenic
1091935664 12:4432664-4432686 GGGAGGTTGGCAATCGAAGGGGG - Intronic
1092897542 12:13027592-13027614 GGAGGCTTGGGCCTGGGAGGTGG + Intergenic
1096538484 12:52290038-52290060 GGATGCTGGGCACAGGAATGGGG - Intronic
1096540295 12:52303326-52303348 GGATGCTGGGCACAGGAATGGGG + Intronic
1097490638 12:60265666-60265688 GGCAGCTTGCCATTAGAAGGGGG + Intergenic
1097641871 12:62191996-62192018 GGAAGCTCGGGACAGGAAGGAGG + Exonic
1098283462 12:68884662-68884684 GGAAACTTTGCACAGGAATGTGG - Intronic
1100226106 12:92557357-92557379 GGAAGCTTGTCAGTGGTCGGAGG + Intergenic
1101791335 12:107930364-107930386 AGAAGATTGGCTCTGGAAGTAGG + Intergenic
1101813042 12:108124033-108124055 GGGAGGTTGTTACTGGAAGGGGG - Intergenic
1103532252 12:121610593-121610615 GGAAGTTTGGCAATGGTAGGAGG + Intergenic
1103631797 12:122267513-122267535 GGAAGCTTTGCACTCAAAGAAGG - Intergenic
1105804505 13:23945332-23945354 AGAAGCTTGGAAGTGGGAGGTGG - Intergenic
1105972269 13:25440156-25440178 GGAAGCCTGGCTCTCGGAGGTGG + Intronic
1107415082 13:40192793-40192815 GGAAGAGTGGCCCGGGAAGGAGG + Intergenic
1107563793 13:41581588-41581610 GGATGTTTGGCAGTGGAGGGGGG - Intronic
1113533213 13:111044804-111044826 GGAATCCTGGCACTTGGAGGGGG + Intergenic
1116407027 14:44579057-44579079 GGAAGCTGGGACCTGGAACGGGG - Intergenic
1120297913 14:82667634-82667656 GGGAGCTTGTCAGTGAAAGGAGG - Intergenic
1121645174 14:95513590-95513612 GGAAGCTAGGAAGTGGACGGGGG - Intergenic
1121675317 14:95747649-95747671 GGAAGCTGAGAACTGGAAGGAGG + Intergenic
1123038670 14:105481598-105481620 GGAAGCCTGGGCCTGGCAGGAGG - Intergenic
1124844347 15:33275802-33275824 GGAAGCTAGGGCCTGGAATGGGG + Intergenic
1127287449 15:57543953-57543975 GGAAGCTTGGCAGCTGAGGGAGG + Intronic
1127355107 15:58190772-58190794 GGAATCTTGGCTCAGGATGGAGG - Intronic
1128300982 15:66566084-66566106 GGGAGCTTGGCGCTGGGTGGGGG + Intergenic
1129341829 15:74891345-74891367 GGAAACTTGGGAGGGGAAGGGGG - Intronic
1129358800 15:75011623-75011645 GGAAGGGTGGCTCTGGGAGGAGG + Intronic
1129542139 15:76359156-76359178 GGAAGCCTCACACTGGGAGGGGG - Intronic
1131470884 15:92695840-92695862 AGAAGCTTGGTGCTGGAAGAGGG - Intronic
1132216192 15:100063428-100063450 ACAAGCTTGGGACAGGAAGGAGG - Intronic
1132447942 15:101944066-101944088 GGAAGTTTGGCAGAGGAAGAGGG + Intergenic
1133309105 16:4831416-4831438 GGAAGCTTGTCCCTGGATCGTGG - Intronic
1135560003 16:23468953-23468975 GGAAGCTTGGAGCTGGATGCCGG + Exonic
1135954102 16:26941154-26941176 GGAAGCCTGACCCTGGAGGGAGG - Intergenic
1136413842 16:30091831-30091853 GGAGGCTTGGCTCGGGATGGAGG - Intronic
1138228978 16:55324197-55324219 GGAGGCTGAGCACTGGCAGGTGG - Exonic
1138339135 16:56277205-56277227 AGAAGCTGGGCACTAGCAGGGGG + Intronic
1138638337 16:58362071-58362093 GGAAGCTAGGCCCTGGAATTGGG + Intronic
1140155067 16:72416374-72416396 GGAAGGTTGGCACTGGTATTTGG - Intergenic
1140411176 16:74741256-74741278 GGAAGCTGGGCATTGGCCGGCGG + Intronic
1142150238 16:88509459-88509481 GGAGGCTGGCCCCTGGAAGGCGG + Intronic
1142409066 16:89907330-89907352 GGGAGGTGGGAACTGGAAGGAGG - Intronic
1142409078 16:89907365-89907387 GGGAGCTGGGAACTGGGAGGAGG - Intronic
1142409087 16:89907393-89907415 GGAAGGTTGGAGCTGGGAGGTGG - Intronic
1142409269 16:89907923-89907945 GGGAGCTGGGAACTGGGAGGAGG - Intronic
1142409301 16:89908014-89908036 GGGAGCTGGGAACTGGGAGGAGG - Intronic
1142409325 16:89908087-89908109 GGGAGCTGGGAACTGGGAGGAGG - Intronic
1143165537 17:4895566-4895588 GGAGGGCAGGCACTGGAAGGTGG + Intronic
1143273982 17:5696303-5696325 GGAAGCTTGGCTCAGTAAAGAGG + Intergenic
1143565819 17:7719922-7719944 GGATGCTTAGCAATGGAGGGTGG + Intronic
1146268129 17:31466620-31466642 CCACGGTTGGCACTGGAAGGCGG - Intronic
1148088627 17:45009421-45009443 GGAAGCTGGGCACTGGCCAGAGG - Intergenic
1148159000 17:45439433-45439455 GGAAGGGTGGGGCTGGAAGGCGG + Intronic
1148347010 17:46910064-46910086 GGAAGGGGGGCACTGGATGGGGG + Intergenic
1148818009 17:50344939-50344961 GGAAGCCAGGCACTGGGAGGAGG - Intergenic
1148836897 17:50470118-50470140 GGAAGCTTGGTGCAGGGAGGAGG + Intronic
1148865251 17:50624934-50624956 AGAATCTGGGCTCTGGAAGGTGG - Intronic
1149907624 17:60540787-60540809 GGAAGCTGGGCAGAGGTAGGAGG + Intergenic
1150417366 17:64998209-64998231 TGAAGCTTGGACCTGGGAGGCGG + Intergenic
1151207554 17:72519081-72519103 GGAAGCTTTGCAGGAGAAGGAGG + Intergenic
1151916343 17:77120966-77120988 GGGAGCTTGGCTCTGGAGGCAGG + Intronic
1152146425 17:78571503-78571525 GGGAGGTTGGCACTGGGAGGCGG + Intronic
1152323450 17:79622287-79622309 AGCAGGTTGGAACTGGAAGGAGG - Intergenic
1155591511 18:27433047-27433069 GGAAGCATGGCACTGGCATCTGG - Intergenic
1155918318 18:31577767-31577789 GGATGGGTGGCAATGGAAGGTGG + Intergenic
1158978535 18:62736051-62736073 GGAATCTTTGCACCGAAAGGGGG + Intronic
1159045531 18:63366507-63366529 GGCAGCTCGGAACTGGAAGATGG - Intronic
1160637329 19:88467-88489 GGAAGTTTGGCAGAGGAAGAGGG - Intergenic
1163281132 19:16318508-16318530 AGAGGCTTGGCACTGGGAGGGGG - Intergenic
1164725349 19:30462161-30462183 GGAAGCTTGGGGCTGGCACGAGG + Intronic
1164825369 19:31281342-31281364 GGAATCTTGGCACTCAAAGTAGG - Intronic
1164875338 19:31681325-31681347 GGAATCTTGGCTCAGGAAAGGGG - Intergenic
1165209316 19:34220817-34220839 GGAAGCTAGGAGATGGAAGGTGG - Intronic
1165406079 19:35632231-35632253 GGAAGCTGGGCAGGGGAAGTAGG - Intronic
1167004155 19:46764758-46764780 AGGAGCTTGGCCCAGGAAGGAGG - Intronic
1167172520 19:47842796-47842818 GGAAGCTCTGCACTGGAGGCCGG + Exonic
1167248037 19:48385603-48385625 GGGAGCTGGGGACTGAAAGGGGG - Intronic
929789442 2:45012662-45012684 GGAAGCTTGGAGGTGAAAGGAGG - Intergenic
930122900 2:47774282-47774304 TGAAGCTTGGAACTGAAATGAGG - Intronic
931628273 2:64276548-64276570 TGAAGGTAGGCTCTGGAAGGTGG + Intergenic
931644216 2:64406616-64406638 GGAAGCTTGGTGCTGGAGGGTGG + Intergenic
933623699 2:84574769-84574791 GGAATTTTGGCACAAGAAGGAGG + Intronic
934981916 2:98849886-98849908 TGAGGCCTGGCACTGGTAGGTGG - Intronic
935327827 2:101953993-101954015 GGCAGCTTGGCAGAGGAAAGAGG + Intergenic
940195298 2:151087856-151087878 GGAAGCTTTGCACAGCAGGGTGG - Intergenic
943169984 2:184385974-184385996 GGGAGCTAGGCCCTGGAAAGTGG - Intergenic
943820679 2:192315778-192315800 GGCAGCTTGGCACTGGCCTGCGG - Intergenic
944756187 2:202764349-202764371 GATAGCTTGGCCCTGGGAGGTGG - Intronic
945221570 2:207489421-207489443 GGAGGCATTGCACTGGAGGGAGG - Intergenic
945682718 2:212933413-212933435 GGAAGATGTGCAGTGGAAGGAGG - Intergenic
945807090 2:214502849-214502871 GGAAGCTTTTTACTGGAAGCAGG - Intronic
947933584 2:233984395-233984417 GGAAGTTTGGGTCTGGAAGTGGG - Intronic
948591440 2:239053307-239053329 GGGGCTTTGGCACTGGAAGGAGG + Intronic
1168994152 20:2120161-2120183 GGAAGGTTGTCATTGGAAGAGGG + Intronic
1169211112 20:3766853-3766875 TGAATCTTGGCACTGGAAAGTGG - Intronic
1171460937 20:25297570-25297592 GCAGGCCTGGCACTGGGAGGTGG + Exonic
1175243921 20:57569901-57569923 GGGAGCTTGGCAGAGGCAGGGGG + Intergenic
1175278671 20:57788335-57788357 GAGAGCTGGGCACTGGGAGGTGG - Intergenic
1177342185 21:19817725-19817747 GGAGGCTTGCCACTGGAAACAGG - Intergenic
1178216564 21:30605652-30605674 GCAAGCTAGGCCCTGGAAAGGGG - Intergenic
1179919981 21:44502810-44502832 GGAAGCAAGGCTCTGGGAGGAGG + Intronic
1179919997 21:44502856-44502878 GGAAGCAAGGCTCTGGGAGGAGG + Intronic
1179920076 21:44503129-44503151 GGAAGCAAGGCTCTGGGAGGAGG + Intronic
1179920101 21:44503204-44503226 GGAAGCAAGGCGCTGGGAGGAGG + Intronic
1179920130 21:44503296-44503318 GGAAGCAAGGCTCTGGGAGGAGG + Intronic
1179920159 21:44503388-44503410 GGAAGCAAGGCTCTGGGAGGAGG + Intronic
1179920226 21:44503601-44503623 GGAAGCAAGGCGCTGGGAGGAGG + Intronic
1179920264 21:44503722-44503744 GGAAGCAAGGCTCTGGGAGGAGG + Intronic
1179920293 21:44503814-44503836 GGAAGCAAGGCGCTGGGAGGAGG + Intronic
1179920331 21:44503935-44503957 GGAAGCAAGGCTCTGGGAGGAGG + Intronic
1179920488 21:44504501-44504523 GGAAGCAAGGCTCTGGGAGGAGG + Intronic
1179920550 21:44504736-44504758 GGAAGCAAGGCTCTGGGAGGAGG + Intronic
1181515477 22:23409133-23409155 GGAAGATGGGCAGTGGAAAGTGG - Intergenic
1181927578 22:26372314-26372336 GGAATCTTAGAACTGGGAGGAGG - Intronic
1182423532 22:30260117-30260139 GGGAGCTTGACTCTGGGAGGGGG - Intergenic
1183019792 22:35018105-35018127 GGAGGCTGGGCACTGGGAGTGGG - Intergenic
1183020764 22:35024177-35024199 GGAAGCTTGGCGTCGGATGGCGG - Intergenic
1185259106 22:49851880-49851902 GGGAGCTTGACACTGGCAGAGGG + Intergenic
1185332331 22:50257357-50257379 TGGAGCCTGGCACTGCAAGGTGG - Intronic
950733792 3:14988241-14988263 AGAGACTTGGCACTGGAAGCTGG - Intronic
952165102 3:30739323-30739345 GGAGGATGGGCACAGGAAGGAGG - Intronic
953838306 3:46366792-46366814 CAAAGCGTGGCACTGGATGGGGG + Intergenic
953881223 3:46692420-46692442 GGAACCTTTGAACTGGAGGGAGG - Intronic
955320755 3:57972642-57972664 GGTAGCTGGGCACAGGAAGATGG + Intergenic
960167770 3:114423160-114423182 GGAAGCTTGACAGTGAAAGAGGG - Intronic
961176086 3:124836049-124836071 GGAGGCATGGGACTGGAGGGAGG - Intronic
962193541 3:133336436-133336458 GGGAGCTAGGGACTGGAAAGAGG - Intronic
962920665 3:139947878-139947900 GGAAGATTGGCATGGAAAGGAGG - Intronic
965350011 3:167600034-167600056 GGGAGCTAGGGCCTGGAAGGGGG + Intronic
966836652 3:184054594-184054616 GGAGTCTTGGCATGGGAAGGAGG + Intronic
966839616 3:184077945-184077967 GGAGTCTTGGCCCAGGAAGGAGG + Intergenic
968996053 4:3946557-3946579 GGCAGCTCAGCACAGGAAGGAGG - Intergenic
969232460 4:5841257-5841279 GGCAGCTGGGGCCTGGAAGGGGG - Intronic
969280443 4:6167149-6167171 GGAGGCAGGGCCCTGGAAGGAGG - Intronic
970543609 4:17104682-17104704 GGAATCCTGGCAATGGAAGTTGG - Intergenic
970552510 4:17196941-17196963 AGAGGCCTGGCAGTGGAAGGAGG + Intergenic
972270046 4:37502319-37502341 GGCAGCATGGCTCAGGAAGGTGG + Intronic
972358349 4:38303541-38303563 AGAAGCTAGGCAGTGGAAGCAGG + Intergenic
972578378 4:40372876-40372898 GGAAACTTGGGAATGGAAAGAGG + Intergenic
972778655 4:42266246-42266268 GGAAGGTGGGGAGTGGAAGGTGG - Intergenic
972778660 4:42266260-42266282 GGAAGGTTGGGAGGGGAAGGTGG - Intergenic
973214586 4:47655023-47655045 GGAAGCTAGGGCCTGGAATGGGG - Intronic
976135102 4:81927156-81927178 GGAGTCTTGACACTGGAAGTGGG - Intronic
976616278 4:87080721-87080743 CCAAGCATGCCACTGGAAGGAGG - Intronic
977426822 4:96876875-96876897 GGAAGCTAGGCAGTGGATAGAGG + Intergenic
990609754 5:57445276-57445298 TGAGGCTTGGCTCTGCAAGGAGG + Intergenic
991050386 5:62266645-62266667 GGAGCCTTGGCAGAGGAAGGTGG + Intergenic
992568218 5:78023831-78023853 GGAAGATTGGCAATGGAAGAAGG + Intronic
994106571 5:95956185-95956207 GGAAGCTTGGCACCAGAATTGGG - Intronic
995659146 5:114461703-114461725 GGAAGCTTGGCATGGGATGAGGG + Intronic
995744828 5:115392671-115392693 TGGAGCTGGGCTCTGGAAGGAGG - Intergenic
998072949 5:139212763-139212785 GGTAGCCAGGCACTGGAAGGAGG - Intronic
998370361 5:141656690-141656712 GGATGCTGGGCAGAGGAAGGAGG + Intronic
999002576 5:147940050-147940072 GGGAGCTAGGGCCTGGAAGGGGG + Intergenic
999152366 5:149434605-149434627 TGAGGCATGGCACTGGCAGGGGG + Intergenic
999293327 5:150441842-150441864 GAAACCTTGGCATGGGAAGGCGG + Intergenic
1001155543 5:169269564-169269586 GGAAGCTTGGCTGAGGAATGGGG + Intronic
1001984671 5:176062616-176062638 GGAAACTTGGAAGTGGGAGGTGG + Intronic
1002084294 5:176762118-176762140 GGAAGATAGTGACTGGAAGGGGG + Intergenic
1002232842 5:177781581-177781603 GGAAACTTGGAAGTGGGAGGTGG - Intronic
1002263146 5:178008234-178008256 GGAAACTTGGAAGTGGGAGGTGG + Intronic
1004245873 6:13974644-13974666 GGAAGCTTGGTACAGAAAGTAGG + Intronic
1005993234 6:30916226-30916248 GGAGGTGTGGCAGTGGAAGGAGG + Exonic
1006118018 6:31785570-31785592 GGAAGTCTGGAAGTGGAAGGAGG - Exonic
1006295510 6:33168442-33168464 GGAGGCTGGGCAATGGCAGGTGG - Intronic
1006726174 6:36200658-36200680 GGAAGCTGGGCTGTGGGAGGTGG - Exonic
1011404811 6:87007845-87007867 GATCGCTTGACACTGGAAGGCGG + Intronic
1011829411 6:91353110-91353132 GTAAGCTTGGGGCTGGATGGAGG + Intergenic
1011851590 6:91636020-91636042 GGAAGCTTGGGACCAGAAGGTGG + Intergenic
1011854984 6:91678763-91678785 GGGAACTTGGCAATGGGAGGGGG + Intergenic
1012220676 6:96645367-96645389 GGCAGATAGCCACTGGAAGGTGG - Intergenic
1014302891 6:119705827-119705849 GGATACTAGGCACTGCAAGGAGG - Intergenic
1015388305 6:132651427-132651449 AGAAGCTAGGCACAGGAGGGAGG - Intergenic
1015877392 6:137836778-137836800 GGAAGATTGTCTCTGGAATGGGG + Intergenic
1016061630 6:139636716-139636738 GGGAGCTAGGGCCTGGAAGGAGG + Intergenic
1016153951 6:140780665-140780687 GGGAGCTAGGGACTGGAATGGGG - Intergenic
1016570119 6:145502484-145502506 GGAAGCTGCTCACTGGGAGGAGG + Intronic
1017905844 6:158757116-158757138 GGAAGTGGGGCCCTGGAAGGTGG + Intronic
1018454368 6:163939192-163939214 GGAAGCTTGACAATGGTGGGAGG + Intergenic
1019278474 7:188410-188432 GGAAGCTTCGTGCTGCAAGGTGG - Intergenic
1019594834 7:1853709-1853731 GGAAGGGTGGGACAGGAAGGAGG - Intronic
1020196086 7:6040404-6040426 GGCAGCGTGGCCATGGAAGGAGG + Intronic
1021312468 7:19111127-19111149 CAAAGGTTGGCACTGGGAGGGGG - Intronic
1022537435 7:31106794-31106816 GGAAGCTTGGCTCCTGAGGGGGG + Exonic
1026231800 7:68490269-68490291 GGAAGGTTGGGCCTGGGAGGTGG + Intergenic
1026489260 7:70848640-70848662 GTAAACTTGGCATTGGAAGGCGG - Intergenic
1026744137 7:72998128-72998150 GGAAACTTGGAGTTGGAAGGTGG - Intergenic
1027030244 7:74882805-74882827 GGAAACTTGGAGTTGGAAGGTGG - Intergenic
1027099600 7:75366964-75366986 GGAAACTTGGAGTTGGAAGGTGG + Intergenic
1028207598 7:88034335-88034357 GGGAGCTGGGCCCTGGAATGAGG + Intronic
1029378847 7:100199476-100199498 GGGAGCTTGGAGTTGGAAGGTGG + Intronic
1033420944 7:141204181-141204203 GGAAGCGTGAGACTGGAAAGAGG + Intronic
1034498149 7:151434006-151434028 GGAGTCTTGGCAGTGGGAGGTGG + Intronic
1037536491 8:19829008-19829030 GGAAGGTGGGCAGTGGAGGGAGG + Intronic
1037742117 8:21616308-21616330 GCAAGATGGGCACAGGAAGGTGG + Intergenic
1040077232 8:43247839-43247861 GGAAACTTGGAAGTGGGAGGTGG + Intergenic
1044121523 8:88402875-88402897 GAAGGCTGGGCACTGGAAGATGG - Intergenic
1044358143 8:91249566-91249588 TGGAGCTTGGCATTGAAAGGAGG + Exonic
1044718932 8:95127091-95127113 GGAGGCTTGAACCTGGAAGGTGG + Intergenic
1046459782 8:114518307-114518329 AGAAGCCAGGCACTGGAAGCAGG + Intergenic
1046963758 8:120139768-120139790 ATAATCTTGGCACTGGGAGGCGG + Intronic
1047635756 8:126760313-126760335 GGAAGGCTGTGACTGGAAGGGGG - Intergenic
1049167226 8:141133895-141133917 GGAAGCCTGGGACTGGAAAGAGG + Intronic
1051484213 9:17590846-17590868 GGAGGCTTGGGCCTGGGAGGAGG - Intronic
1052265779 9:26571447-26571469 GGAAGCATGGCACTGAAGGTAGG - Intergenic
1052834588 9:33241007-33241029 GGGTGATGGGCACTGGAAGGGGG + Intronic
1052896423 9:33751332-33751354 GGAAGCTAAGCACTGGATCGGGG - Intronic
1054870343 9:70043363-70043385 GGAGGCTTTACACTGGGAGGGGG - Intergenic
1055262476 9:74453874-74453896 GGAAGATTGTTAATGGAAGGTGG + Intergenic
1055943672 9:81673691-81673713 GGAAGGTTGACACGGGGAGGGGG + Intronic
1058376070 9:104322881-104322903 GGCAGCTTGGCAAAGGAAGTAGG + Intergenic
1059691983 9:116694189-116694211 GGAAGCTTTTCAATTGAAGGAGG + Intronic
1060095743 9:120787895-120787917 GGACGCTTTGCACTGGAAGAAGG - Exonic
1061061504 9:128252899-128252921 GGGTGCTGGGCACTGGGAGGTGG + Intronic
1062273927 9:135721854-135721876 GGAAGCAGGGTCCTGGAAGGTGG + Intronic
1062283157 9:135760835-135760857 GGACTCGTGGCACTGGACGGTGG - Intronic
1189093457 X:38112566-38112588 GGAAGCTGGGCAGAGGAAGATGG - Intronic
1189315624 X:40054152-40054174 GGATGGTGGGCACTGGAAGCAGG - Intronic
1192337826 X:70236723-70236745 GGAAGCTTGGCTCTAAAAGTCGG - Intronic
1193981610 X:88187721-88187743 GGAAGCTAGGTCCTGGAAAGTGG - Intergenic
1196984582 X:121254095-121254117 GGAAGCTAGGAGCTGGAATGGGG + Intergenic
1197462799 X:126763195-126763217 GGAAGCTTGGCAATGAAACTAGG - Intergenic
1197777790 X:130130811-130130833 GGAAGGGTGGCATAGGAAGGGGG + Intronic
1199138939 X:144287444-144287466 GGCAGCTTGGTCCTGGAATGGGG + Intergenic
1200242535 X:154505269-154505291 GGAAGCTGGGGGCTGGCAGGGGG + Intergenic