ID: 905938112

View in Genome Browser
Species Human (GRCh38)
Location 1:41840786-41840808
Sequence TGGAAGGAGGCCAGGCATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2183
Summary {0: 1, 1: 1, 2: 24, 3: 216, 4: 1941}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905938108_905938112 -5 Left 905938108 1:41840768-41840790 CCAGAGGAAGCTTGGCACTGGAA 0: 1
1: 0
2: 0
3: 9
4: 153
Right 905938112 1:41840786-41840808 TGGAAGGAGGCCAGGCATGCTGG 0: 1
1: 1
2: 24
3: 216
4: 1941
905938103_905938112 19 Left 905938103 1:41840744-41840766 CCAGCCAGTCACTGGACGACATA 0: 1
1: 0
2: 0
3: 4
4: 65
Right 905938112 1:41840786-41840808 TGGAAGGAGGCCAGGCATGCTGG 0: 1
1: 1
2: 24
3: 216
4: 1941
905938102_905938112 23 Left 905938102 1:41840740-41840762 CCAGCCAGCCAGTCACTGGACGA 0: 1
1: 0
2: 0
3: 9
4: 89
Right 905938112 1:41840786-41840808 TGGAAGGAGGCCAGGCATGCTGG 0: 1
1: 1
2: 24
3: 216
4: 1941
905938100_905938112 28 Left 905938100 1:41840735-41840757 CCGTGCCAGCCAGCCAGTCACTG 0: 1
1: 0
2: 6
3: 33
4: 382
Right 905938112 1:41840786-41840808 TGGAAGGAGGCCAGGCATGCTGG 0: 1
1: 1
2: 24
3: 216
4: 1941
905938104_905938112 15 Left 905938104 1:41840748-41840770 CCAGTCACTGGACGACATAACCA 0: 1
1: 0
2: 0
3: 1
4: 55
Right 905938112 1:41840786-41840808 TGGAAGGAGGCCAGGCATGCTGG 0: 1
1: 1
2: 24
3: 216
4: 1941

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905938112 Original CRISPR TGGAAGGAGGCCAGGCATGC TGG Intronic
Too many off-targets to display for this crispr