ID: 905938881

View in Genome Browser
Species Human (GRCh38)
Location 1:41846967-41846989
Sequence CCGTTGCCTTGCCTGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 204}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905938881_905938892 24 Left 905938881 1:41846967-41846989 CCCTGTTCCAGGCAAGGCAACGG 0: 1
1: 0
2: 0
3: 13
4: 204
Right 905938892 1:41847014-41847036 TATATAAAGGCATCCAGGAAAGG 0: 1
1: 0
2: 1
3: 22
4: 247
905938881_905938885 0 Left 905938881 1:41846967-41846989 CCCTGTTCCAGGCAAGGCAACGG 0: 1
1: 0
2: 0
3: 13
4: 204
Right 905938885 1:41846990-41847012 AAGCCAGAGCCACCCAAGTGTGG 0: 1
1: 0
2: 0
3: 20
4: 213
905938881_905938893 25 Left 905938881 1:41846967-41846989 CCCTGTTCCAGGCAAGGCAACGG 0: 1
1: 0
2: 0
3: 13
4: 204
Right 905938893 1:41847015-41847037 ATATAAAGGCATCCAGGAAAGGG 0: 1
1: 0
2: 1
3: 32
4: 309
905938881_905938888 11 Left 905938881 1:41846967-41846989 CCCTGTTCCAGGCAAGGCAACGG 0: 1
1: 0
2: 0
3: 13
4: 204
Right 905938888 1:41847001-41847023 ACCCAAGTGTGGCTATATAAAGG 0: 1
1: 0
2: 0
3: 10
4: 94
905938881_905938891 19 Left 905938881 1:41846967-41846989 CCCTGTTCCAGGCAAGGCAACGG 0: 1
1: 0
2: 0
3: 13
4: 204
Right 905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG 0: 1
1: 1
2: 0
3: 11
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905938881 Original CRISPR CCGTTGCCTTGCCTGGAACA GGG (reversed) Intronic
900612194 1:3548899-3548921 CCTTAGCCTGGCCTGGCACAGGG + Intronic
902136263 1:14308670-14308692 CTGTTTCCTTGCCTGCAAAATGG + Intergenic
902199891 1:14825577-14825599 CAGTTTGCTTGCCTGGAAAATGG - Intronic
902756357 1:18551887-18551909 CGGTTGCCTTGTCTGTAAAATGG - Intergenic
903027830 1:20442259-20442281 CAGTTTCCTTACCTGGAAAATGG - Intergenic
903358278 1:22761570-22761592 CCGTTCCCTTGTCTGTAAAATGG + Intronic
903786804 1:25866613-25866635 CAGTTTCCTTACCTGGAAAATGG - Intronic
905312047 1:37056174-37056196 CTGTTTCCTTGCCTGTAAAATGG - Intergenic
905504629 1:38467444-38467466 GCGTTGCAATGCCTGGCACATGG + Intergenic
905931255 1:41789091-41789113 CCGCTGTCTTCCCTGGACCAAGG + Intronic
905938881 1:41846967-41846989 CCGTTGCCTTGCCTGGAACAGGG - Intronic
907134337 1:52124972-52124994 ACGTTTCCATGCTTGGAACATGG + Intergenic
907265242 1:53255379-53255401 CAGTTTCCTTGCCTGTAAAATGG - Intronic
908407899 1:63832580-63832602 CTGTTTCCTTTTCTGGAACATGG + Intronic
911430645 1:97782443-97782465 CAGTTGCCTTTCCTGGATCATGG + Intronic
913126195 1:115792678-115792700 CTTTTGCCATGCCTGGCACATGG + Intergenic
915353622 1:155242093-155242115 CCATTTCCTTGCCTGGAAAATGG + Intronic
916572587 1:166040460-166040482 CCTTTGAATTGCCTGAAACAAGG - Intergenic
920143564 1:203839030-203839052 CCATTACCTTGCCTGCAATATGG + Intronic
922061769 1:222099499-222099521 CTGTTGCCTTTCCTGTAAGAAGG + Intergenic
922132815 1:222796012-222796034 CCTTTTCTTTGCCTGCAACATGG - Intergenic
1064158553 10:12923748-12923770 CCGTCTCCATGCCTGGAACTGGG + Intronic
1064888876 10:20146025-20146047 CCGTTTCCTTTCCTATAACATGG - Intronic
1065172878 10:23049479-23049501 CAGTTTCTTTGCCTGGAAAACGG + Intergenic
1071957700 10:90777530-90777552 CTGTCTTCTTGCCTGGAACATGG - Intronic
1074542796 10:114379310-114379332 CTGCTGCATAGCCTGGAACAGGG - Intronic
1074702296 10:116103132-116103154 CAGTTTCCTTACCTGGAAAATGG + Intronic
1075325852 10:121531665-121531687 CAGTTTCCTTGCCTGTAAAATGG - Intronic
1075525984 10:123187137-123187159 CCAGGGCCTTCCCTGGAACAGGG - Intergenic
1075837835 10:125471069-125471091 CCTTTGCCTAGACTGCAACATGG - Intergenic
1077264750 11:1643020-1643042 CGGTTGCCCTGCCTGCAGCAAGG - Intergenic
1078103167 11:8341791-8341813 TTGTTTCCTTGCCTGGAAAATGG + Intergenic
1079803391 11:24897883-24897905 CTTTTGCCTTGCCTTTAACATGG + Intronic
1080443397 11:32315435-32315457 CAGTTTCCTTGCCTGCAATATGG - Intergenic
1080605580 11:33862235-33862257 CCGCAGCCTTGCCTGGAGCCAGG - Intronic
1081235417 11:40641666-40641688 CCCTTGCCTTGCATTAAACATGG + Intronic
1083292024 11:61695804-61695826 CAGTGGCCTTGCCTGGAAGGAGG + Intronic
1083439592 11:62666941-62666963 CGACTGCCCTGCCTGGAACAAGG + Exonic
1085259220 11:75194641-75194663 CCGCTGCAGTGCCTAGAACAAGG - Intronic
1085711066 11:78829688-78829710 CAGTTTCCTTGTCTGGAAAATGG + Intronic
1085876920 11:80418748-80418770 CCGTAGCCTTGTCTGTAAAATGG + Intergenic
1086206317 11:84262239-84262261 CCATTACCCTGCATGGAACAAGG + Intronic
1086410692 11:86541298-86541320 CCGTTCACTTGCCTGGAAAGGGG + Intronic
1089659446 11:119976361-119976383 CCGTTTCCTTATCTGGAAAATGG + Intergenic
1089662562 11:119994876-119994898 CAGTTTCCTTACCTGGAAAATGG + Intergenic
1094320272 12:29174973-29174995 GCGTTGGTTTGCCTGGAACCAGG - Intronic
1094605360 12:31944645-31944667 TGGCTGCCTTGCCTGGAACGGGG - Intergenic
1096742447 12:53703630-53703652 CCCTTGCATTTCATGGAACATGG - Intergenic
1098278886 12:68842305-68842327 GCGTTCCTTTGCCTGCAACAGGG - Exonic
1099202040 12:79689799-79689821 CCCTTGCCTTTCCTGGCACTGGG + Exonic
1099551059 12:84043745-84043767 CCGTTGACTTCCCTGGAAATGGG - Intergenic
1100867254 12:98870078-98870100 CAGTTGCTTTACCTGTAACAGGG + Intronic
1101043653 12:100782654-100782676 CAGTTTCCTTATCTGGAACATGG + Intronic
1101727780 12:107402532-107402554 CAGTAGCCGTGGCTGGAACATGG - Intronic
1101746784 12:107547855-107547877 CCAGTGCCATGCCTGGCACAAGG + Intronic
1102046663 12:109833607-109833629 CAGTTTCCTCGCCTGGAAAATGG + Intergenic
1103487058 12:121290144-121290166 CGCTTCCCTTGTCTGGAACATGG + Intronic
1103965708 12:124638047-124638069 CCGTGTCCTTGTCTGGACCATGG + Intergenic
1104643409 12:130481422-130481444 AGGTTGCCGTGCCTGAAACACGG - Intronic
1106637909 13:31550853-31550875 CTGTTGCCTAGCCTGGATCATGG + Intergenic
1112799581 13:103095905-103095927 CAGTTTCCTTGCCTGCAAAATGG - Intergenic
1114690513 14:24575682-24575704 AGCTGGCCTTGCCTGGAACAAGG - Intronic
1116304074 14:43227871-43227893 CCATTGCATTGCCTGGAGAAAGG + Intergenic
1117374054 14:55104719-55104741 CAGTTGCCTTGTCTGTAAAACGG - Intergenic
1118903232 14:70003750-70003772 CTGAGGCCCTGCCTGGAACAAGG - Intronic
1120929479 14:89834489-89834511 CCAGTGCCTTGCCTGGAGAAGGG - Intronic
1121263420 14:92583027-92583049 CAGTTGCCTTGCCTGTAAGATGG + Intronic
1121499937 14:94426990-94427012 CAGTTGCCTTGTCTGTAAAATGG - Intergenic
1121524854 14:94612762-94612784 CTGTCCCCTTGCCTGGAGCAGGG + Intronic
1122960463 14:105091705-105091727 CCCTTGCCTTGCAGGGACCAGGG + Intergenic
1123003157 14:105307397-105307419 CCTCTGCCTTGCCTGGAAAATGG + Exonic
1123005035 14:105316975-105316997 CCCTTACCTGTCCTGGAACAGGG + Intronic
1124948700 15:34295162-34295184 CCTTTGCCTTTCCTGTAAAATGG - Intronic
1127519235 15:59726974-59726996 CAGTTCCCTTGCCTGTAAAATGG + Intergenic
1128523265 15:68389570-68389592 CAGTTGCTTTGCCTGTAAAATGG + Intronic
1129321634 15:74778182-74778204 CTGTTGCATGGCCTGGACCAGGG - Intergenic
1130650200 15:85758136-85758158 CCGCTGCCTTGCATGGAAGACGG + Intergenic
1131072191 15:89472892-89472914 CCCTTGCCTGGACTGGGACAGGG - Intronic
1131385406 15:92002269-92002291 ACGTTGCCTGCCTTGGAACAGGG - Intronic
1132738500 16:1399107-1399129 CCGTCCCCTTGCCTGGCAGAGGG + Intronic
1132859397 16:2062613-2062635 CTGTAGCCTTGCCTGGCACCTGG + Intronic
1134257828 16:12626227-12626249 ACGGTGCCTAGCCTGGAAGAAGG - Intergenic
1135771738 16:25223069-25223091 CCGTTGGTGTGCCTGGCACAAGG - Intronic
1136087563 16:27896376-27896398 ACGTTACCTTGCATGGCACAAGG + Intronic
1136555403 16:31004794-31004816 CTGTTTCCTTGTCTGTAACATGG - Intronic
1138448409 16:57078793-57078815 TCATTCCCTTGCCTGGAAAAGGG - Intronic
1138559346 16:57791346-57791368 CCTTTGCCTTGGCTGGCAAATGG - Intronic
1138561665 16:57804361-57804383 CAGTTTCCTTTCCTGAAACACGG - Intronic
1138774393 16:59704071-59704093 CTGTTTCCATGCCTGGAAAATGG - Intergenic
1140493549 16:75362402-75362424 GGGATGCCTTGCCTGGAAGACGG - Intronic
1141038879 16:80654685-80654707 GCGTTGCCTTGCATGTAGCAGGG - Intronic
1141744426 16:85915954-85915976 CAGTTTCCTTACCTGGAAAATGG + Intronic
1142605088 17:1077071-1077093 CAGTTGCCTTGTCTGTAAAATGG - Intronic
1142846757 17:2684348-2684370 CCTGTGCCTTGCCTGGGATAAGG + Exonic
1146134911 17:30310766-30310788 CAGTTGCCTTCCCTGTAAAATGG + Intergenic
1146944209 17:36863074-36863096 CAGTTGTCTTGCCTGTAAAATGG - Intergenic
1147278149 17:39336076-39336098 CTGTTGCCTAGGCTGGAATACGG - Intronic
1148712947 17:49695106-49695128 CCGGTGCATAGCCTGGTACAGGG + Intergenic
1148848552 17:50542909-50542931 CGGTTTCCTTGCCTGAAAAATGG - Exonic
1151241109 17:72758611-72758633 TCCTTTTCTTGCCTGGAACACGG + Intronic
1152026133 17:77810551-77810573 CTCTTGCCTTTCCTGGATCAAGG + Intergenic
1152814468 17:82399286-82399308 CCGTAGCCTTTGCTGGAACACGG - Intronic
1153836679 18:8970005-8970027 CAATTTCCTTGGCTGGAACAAGG - Intergenic
1155022660 18:21910798-21910820 CGGTTGAATTGCATGGAACATGG + Intergenic
1156183002 18:34627662-34627684 CCTTTGCCTCTCTTGGAACATGG + Intronic
1157704834 18:49796806-49796828 CAGTTTCCTTGCCTGTAAAATGG + Intronic
1162504624 19:11075932-11075954 CCATTGCCCTGCCTGGAATTGGG - Intergenic
1163109258 19:15149153-15149175 CTGGTGCCTTACCAGGAACAGGG + Intergenic
1163141822 19:15354883-15354905 CCAACGCCTTCCCTGGAACAGGG + Exonic
1163492035 19:17622843-17622865 CTGTTTCCTTGTCTGGAAAATGG - Intronic
1163846579 19:19641717-19641739 ACGATGCCTTGCATGGAACAGGG + Intronic
1164752670 19:30668386-30668408 CTGTAGCCTGGCCTGGGACAGGG - Intronic
1165176820 19:33936408-33936430 GCGTGGCCCTGCCTGGAACAAGG - Intergenic
1166709956 19:44930521-44930543 CTGTTGCCTAGGCTGGAACACGG + Intergenic
925203693 2:1989267-1989289 CTGCTCCCTTGCCTGGCACAGGG - Intronic
927900081 2:26812741-26812763 CCATTGCCTTGTCTGTAACCTGG - Intergenic
928096160 2:28406460-28406482 CCGTTTCCTTGTCTGTAAAATGG - Intronic
932794318 2:74681456-74681478 GACTTGCCCTGCCTGGAACAGGG + Exonic
937038287 2:118800749-118800771 ACGTTGCATTGTCTGGGACAAGG - Intergenic
937934619 2:127232825-127232847 CCGTCTCCTTGCGTGGACCATGG + Intergenic
938969563 2:136419844-136419866 CCTTCTCCCTGCCTGGAACATGG + Intergenic
939270445 2:139931937-139931959 CCCTTCCCTTTCCTGAAACAGGG + Intergenic
942375057 2:175328217-175328239 CAGTTTCCTTGCCTGAAAAATGG - Intergenic
944216344 2:197260012-197260034 CAGTGGCCTTGCCTGAAAAACGG + Intronic
946518596 2:220441242-220441264 TCCTTCCCTTTCCTGGAACATGG + Intergenic
948581230 2:238988441-238988463 CTGTTTCCTTGTTTGGAACAAGG + Intergenic
948815740 2:240509576-240509598 CCATTACCTTGCCTGACACAAGG + Intronic
1172333242 20:34091234-34091256 CCTTTGCCTTGCTTTGTACATGG - Intronic
1172634456 20:36400781-36400803 CCAGTGACGTGCCTGGAACAGGG + Intronic
1174284890 20:49465495-49465517 CCATTTCCTTGGCTGGAAAACGG - Intronic
1174862686 20:54106251-54106273 CCGTTTCCTTGCCTGGCTAATGG - Intergenic
1175051971 20:56164092-56164114 CCTTTCCCTTTCCTGGAAGAAGG - Intergenic
1175347222 20:58288722-58288744 GCCTTGCCTTGCTTGGCACATGG - Intergenic
1175450528 20:59062075-59062097 CAGTTTCCTTGTCTGTAACATGG + Intergenic
1179167022 21:38943292-38943314 CCCATGCCTTGCATGGAGCATGG + Intergenic
1179314836 21:40234339-40234361 CAGTTGCTTTGCCTGTAAAATGG + Intronic
1181552336 22:23647705-23647727 CTGTTGCCTAGGCTGGAGCACGG + Intergenic
1182112660 22:27734389-27734411 CTGTTTCCTTCCCTGGAAAATGG + Intergenic
1183413902 22:37671843-37671865 CCGTTTCCAGGCCTGGAAGATGG - Intergenic
949226436 3:1700542-1700564 CCTTTTCCTTGCCAGCAACATGG - Intergenic
949232768 3:1771273-1771295 CCGTTGCCCAGGCTGGAATACGG + Intergenic
950125833 3:10509299-10509321 CCCTTGCCTTGCCTGGCTCGGGG + Intronic
950440761 3:13008920-13008942 CCATTGCCTTATCTGGAAAATGG - Intronic
951849145 3:27119182-27119204 CAGTTTCCTTGCCTGTAAAATGG - Intronic
955324745 3:58001274-58001296 CAGTTGCCTTACCTGTAAAATGG + Intergenic
955728694 3:61960400-61960422 CAGCTGCCCTGCCAGGAACATGG + Intronic
956797326 3:72728693-72728715 CCATTGCCTCACCTGGAAAAGGG + Intergenic
959629197 3:108489501-108489523 CCTTAGCTATGCCTGGAACAAGG + Intronic
962058807 3:131903670-131903692 CCATTTCCTTGCCTGTAAAATGG + Intronic
963043561 3:141086421-141086443 CAGTTTCCTTGCCTGTAAAATGG + Intronic
965643569 3:170856743-170856765 CTGTTGCCTAGGCTGGATCATGG - Intronic
968627205 4:1631328-1631350 ACCTGGCCTTGCCTGGGACATGG - Intronic
971846170 4:31921347-31921369 TCGTTGGGTTGGCTGGAACATGG - Intergenic
975456023 4:74590963-74590985 CTGTTGTCTGGCCTGGAGCAGGG - Intergenic
975709265 4:77143177-77143199 CCGTTTCCTTACCTGAAAAATGG - Intergenic
977240314 4:94560554-94560576 CAGTTTCCTTGCCTGTAAGATGG - Intronic
979654082 4:123171140-123171162 CAGTTTCCATGTCTGGAACACGG + Intronic
979945952 4:126830965-126830987 CTGTTGCTCTGCCTGGAACTGGG - Intergenic
980137431 4:128872079-128872101 CCCTTTCCTTGGCTGGAACTCGG - Exonic
980686596 4:136237729-136237751 CTGTTGCCTTTCCAGGCACATGG - Intergenic
982730440 4:158950500-158950522 CCTTTCCCTTGCATTGAACATGG - Intronic
983314768 4:166117298-166117320 CCGTTTCCTTGCCCCGACCAAGG + Intergenic
983524209 4:168744022-168744044 CCTTTGCCTTCCCTGGAAAAGGG + Intronic
983760756 4:171403398-171403420 CCCTTCCCTTGCCTGGATCTAGG + Intergenic
987101942 5:14598679-14598701 CCGTTGCCCAGGCTGGAGCATGG - Intronic
990334729 5:54761359-54761381 CCTTTGCTCTGCCTGGGACAGGG - Intergenic
992843727 5:80723055-80723077 CCGTCGCCTAGGCTGGACCAGGG - Intronic
994689485 5:102999405-102999427 CTGTTGCCTTTCCAGGCACATGG + Intronic
997579396 5:135007834-135007856 CTGTTGCCATGCCTGGCACAAGG - Intronic
997720206 5:136072107-136072129 CAGTTTCTTTGCCTGCAACAGGG + Intergenic
997725723 5:136118383-136118405 CCGTTGTGCTGCCTGGGACAAGG + Intergenic
998390605 5:141784922-141784944 CAGTTTCCTTGCCTGTAAAACGG - Intergenic
1000075544 5:157781754-157781776 CAGTTTCCTTGTCTGTAACAAGG + Intergenic
1000818109 5:165949167-165949189 CAGTTTCCTTGCCTGTAAGATGG + Intergenic
1000898739 5:166888288-166888310 CAGTTTCCTTGCCTGGAAACAGG - Intergenic
1007476956 6:42125322-42125344 CAGTTTCCCTGCCTGTAACATGG + Intronic
1007512181 6:42382041-42382063 CAGTTGCCTTGTCTGTAAAATGG - Intronic
1008662558 6:53683068-53683090 CCAGTGCCCTGCCTGGCACATGG - Intergenic
1009537532 6:64908296-64908318 GTGTTGCCTTGGCGGGAACATGG + Intronic
1009610091 6:65930554-65930576 CCTTCTCCTTGCCTGAAACATGG + Intergenic
1012417663 6:99027058-99027080 CCTGTGCCTTGCATGGGACATGG - Intergenic
1018100853 6:160438328-160438350 ACTTTGCCTTTCCTGGAAGAGGG - Intronic
1018626199 6:165781210-165781232 CCCTTGCCTTGCCAGAACCAAGG + Intronic
1022794377 7:33720187-33720209 CTGTTTCCTTGTCTGGAAAATGG + Intergenic
1022800863 7:33776033-33776055 CCCTTTGCTTGCCTAGAACATGG - Intergenic
1022834909 7:34104132-34104154 CCTTAGCCTGGGCTGGAACAGGG - Intronic
1026836249 7:73641355-73641377 CAGTTGCCCTCCCTGTAACATGG + Intergenic
1029272562 7:99385747-99385769 CAGCTGCCACGCCTGGAACAAGG + Exonic
1030082939 7:105792977-105792999 TAGTTGCCTTGCCTGGAAAGTGG - Intronic
1031286327 7:119873325-119873347 CAGTCGCCTTGCCTAGAAAATGG + Intergenic
1033119667 7:138656436-138656458 ACGTTGCCTTACCTGAGACAAGG + Exonic
1034194944 7:149239463-149239485 CCGTGGCTTTGCCTGAAACGCGG + Intergenic
1034450678 7:151135608-151135630 CAGGTGCCTTGCCTCCAACAAGG - Intronic
1036643550 8:10598766-10598788 CCGTTGCTTTGCCTGGAGACAGG + Intergenic
1039086139 8:33781906-33781928 CCCTTGTCTTGACTGTAACAAGG - Intergenic
1040893517 8:52341482-52341504 GCGTTGCCTTGCATGGCAAAGGG + Intronic
1041394431 8:57376619-57376641 CCCCTGCCTGGCCTGGCACATGG - Intergenic
1044996833 8:97845499-97845521 CCCTTGTCTGGCCTGGAACGGGG - Intronic
1047501603 8:125446007-125446029 CAGTTGCCTTACCTGTAAAATGG + Intergenic
1050065573 9:1755985-1756007 CTGTTTCCTTGCCTGTAAAACGG - Intergenic
1056569300 9:87802050-87802072 CTGTTGACTTGCCTGGCCCAGGG + Intergenic
1056698182 9:88878503-88878525 CAGTTGCCTTGTCTGGAAAATGG - Intergenic
1057562762 9:96140936-96140958 CGGGGGCCTTGCCCGGAACAGGG + Intergenic
1057822391 9:98342591-98342613 CCACTGCCCTGCCTGGACCATGG + Intronic
1058448939 9:105078369-105078391 GCCTTGCCTTGCCTGTATCATGG + Intergenic
1061211063 9:129193737-129193759 CGGTTTCCTTCCCTGGAAAATGG - Intergenic
1061212224 9:129200477-129200499 CCTTCCTCTTGCCTGGAACATGG - Intergenic
1061274908 9:129564409-129564431 CTGTTGCCTAGACTGGATCACGG - Intergenic
1061792257 9:133064898-133064920 CCGTTGCCCAGCCTGGGGCAGGG + Intronic
1061884664 9:133585482-133585504 CCACTGCCTTGCATGGTACAGGG + Intronic
1062386373 9:136313267-136313289 GCATGGCCTTGCCTGGGACAGGG - Intergenic
1186247167 X:7626458-7626480 CCTTTGCTATGCCTGGAACTTGG - Intergenic
1187276514 X:17820709-17820731 CAGTTTCCTTGCCTGCAAAATGG + Intronic
1187812165 X:23191199-23191221 CCTTTTTCTTGCCTGAAACATGG + Intergenic
1194835546 X:98677650-98677672 CAGTTGCCTTGCTTGTGACAAGG - Intergenic
1195325528 X:103755231-103755253 CAGTTGCCTTGCCTATAAAATGG + Intergenic
1196249172 X:113438436-113438458 CTGTTGCCTTTCCTGTAAAAAGG - Intergenic
1197992719 X:132335197-132335219 CCTTTTCCCTGCCTTGAACATGG + Intergenic