ID: 905938883

View in Genome Browser
Species Human (GRCh38)
Location 1:41846968-41846990
Sequence TCCGTTGCCTTGCCTGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 144}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905938883_905938891 18 Left 905938883 1:41846968-41846990 CCTGTTCCAGGCAAGGCAACGGA 0: 1
1: 0
2: 0
3: 8
4: 144
Right 905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG 0: 1
1: 1
2: 0
3: 11
4: 92
905938883_905938888 10 Left 905938883 1:41846968-41846990 CCTGTTCCAGGCAAGGCAACGGA 0: 1
1: 0
2: 0
3: 8
4: 144
Right 905938888 1:41847001-41847023 ACCCAAGTGTGGCTATATAAAGG 0: 1
1: 0
2: 0
3: 10
4: 94
905938883_905938892 23 Left 905938883 1:41846968-41846990 CCTGTTCCAGGCAAGGCAACGGA 0: 1
1: 0
2: 0
3: 8
4: 144
Right 905938892 1:41847014-41847036 TATATAAAGGCATCCAGGAAAGG 0: 1
1: 0
2: 1
3: 22
4: 247
905938883_905938893 24 Left 905938883 1:41846968-41846990 CCTGTTCCAGGCAAGGCAACGGA 0: 1
1: 0
2: 0
3: 8
4: 144
Right 905938893 1:41847015-41847037 ATATAAAGGCATCCAGGAAAGGG 0: 1
1: 0
2: 1
3: 32
4: 309
905938883_905938885 -1 Left 905938883 1:41846968-41846990 CCTGTTCCAGGCAAGGCAACGGA 0: 1
1: 0
2: 0
3: 8
4: 144
Right 905938885 1:41846990-41847012 AAGCCAGAGCCACCCAAGTGTGG 0: 1
1: 0
2: 0
3: 20
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905938883 Original CRISPR TCCGTTGCCTTGCCTGGAAC AGG (reversed) Intronic
902973417 1:20071591-20071613 TCCATCGCCCTGCCCGGAACTGG - Intronic
905293328 1:36938296-36938318 TCCATTGCCTGACCTGGAACGGG - Intronic
905938883 1:41846968-41846990 TCCGTTGCCTTGCCTGGAACAGG - Intronic
907286880 1:53386292-53386314 TCCTTTGACTTGGCTGGAAGGGG + Intergenic
907643666 1:56218749-56218771 TCCTTTGACTTGCCTGAAGCAGG - Intergenic
908405355 1:63809108-63809130 TGCCATGCCTTGCCTGGAATTGG - Intronic
909111280 1:71481101-71481123 TCCATTTCCTTGCCTGGTAAAGG - Intronic
910647330 1:89527427-89527449 TGCATTGCCTTGCATGGAGCAGG + Intronic
918301395 1:183207385-183207407 TCCTTTGCCTTGACGGGCACCGG + Intronic
918511453 1:185317588-185317610 TGCGTTGCCTGTCCCGGAACTGG + Intergenic
920493870 1:206440271-206440293 GCTGTTTCCTTCCCTGGAACAGG - Intronic
921129525 1:212207943-212207965 TCCCTTGCCTTGGCTGGCATTGG + Intergenic
922880428 1:228976314-228976336 TTCGTTGCTTTGCCTGGTTCTGG + Intergenic
923034319 1:230273558-230273580 GCTGTGGCCCTGCCTGGAACAGG + Intronic
1063651591 10:7943190-7943212 GCCGTTGCCTTGAATGAAACAGG + Intronic
1064158551 10:12923747-12923769 CCCGTCTCCATGCCTGGAACTGG + Intronic
1066002864 10:31120506-31120528 TGCATTGCCTTGTTTGGAACTGG + Intergenic
1074542797 10:114379311-114379333 TCTGCTGCATAGCCTGGAACAGG - Intronic
1077060132 11:614285-614307 TCTGTTGCACTGCCTGGAGCAGG + Exonic
1079009758 11:16818241-16818263 TCCGTTTCCTTACTTGTAACAGG + Intronic
1079461702 11:20685991-20686013 TCAGTTTCCTTGTCTGGAAATGG + Intronic
1080200946 11:29669133-29669155 TCTGGTGCACTGCCTGGAACTGG - Intergenic
1080798327 11:35586663-35586685 GCCATTGCATTGCCTGAAACTGG - Intergenic
1081727293 11:45339449-45339471 TCCCTTGCCATCCCTGGAATAGG - Intergenic
1085198059 11:74684033-74684055 TGCGTTGCCTTCTCTGGAGCTGG + Intergenic
1085291030 11:75399662-75399684 TCCGTGGCCTGCCCTGGAAGCGG + Intronic
1086410690 11:86541297-86541319 ACCGTTCACTTGCCTGGAAAGGG + Intronic
1090550744 11:127817231-127817253 GCCTTTGCCTTGCCTTGAAGTGG - Intergenic
1092120981 12:6043713-6043735 TCCGGTGCTGTGCCTGAAACAGG - Intronic
1094532303 12:31288320-31288342 TCCGTGGGTTTGGCTGGAACAGG - Intronic
1094605361 12:31944646-31944668 ATGGCTGCCTTGCCTGGAACGGG - Intergenic
1096121453 12:49091825-49091847 TTCATTGCCTTCCCTGGCACCGG + Intronic
1097172459 12:57124809-57124831 AGAGTTGCCTTTCCTGGAACAGG - Intronic
1097696620 12:62781109-62781131 TCCATTCCCTTGTCTGGAATGGG - Intronic
1098278887 12:68842306-68842328 TGCGTTCCTTTGCCTGCAACAGG - Exonic
1099202038 12:79689798-79689820 CCCCTTGCCTTTCCTGGCACTGG + Exonic
1099551061 12:84043746-84043768 ACCGTTGACTTCCCTGGAAATGG - Intergenic
1100867253 12:98870077-98870099 TCAGTTGCTTTACCTGTAACAGG + Intronic
1102551932 12:113697678-113697700 TCTGTTCCCTTGCCTTGAAGTGG + Intergenic
1104139757 12:125975961-125975983 TCCATTTCCTTGTCTGCAACGGG - Intergenic
1108041341 13:46341881-46341903 TCAGTTTCCTTGCCTGTAAATGG + Intergenic
1108557751 13:51612106-51612128 TCAGTTTCCTTGCCTGTAAAAGG - Intronic
1113162901 13:107402744-107402766 TCAGTTTCCTTGCCTAGAAACGG + Intronic
1113682220 13:112252425-112252447 TCCGTTGCAGTGCCTGTCACTGG - Intergenic
1113682231 13:112252472-112252494 TCCGTTGCAGTGCCTGTCACTGG - Intergenic
1113858055 13:113460240-113460262 TCCGCTTCCTTGCCTGGGAATGG - Intronic
1116543181 14:46125985-46126007 TCAGTTACCTTGTCTGGGACTGG + Intergenic
1118607385 14:67514351-67514373 TCCCTGCCCTTGCCAGGAACCGG + Intronic
1119430806 14:74567081-74567103 TCCGTCTCCCTGCCTGAAACAGG - Intronic
1121125372 14:91403402-91403424 TCCGGCGCCTTGTCTGGAAAGGG - Intronic
1124644738 15:31430064-31430086 TCTGTTGCCTTGGTTGGAAGGGG + Intronic
1126100423 15:45115334-45115356 TGTGTTGCTTTCCCTGGAACTGG + Intronic
1126727837 15:51651030-51651052 CCCTTTGCCATGCCTAGAACAGG + Intergenic
1128295336 15:66513896-66513918 TCCATTGACTTGCATAGAACTGG + Intronic
1129239133 15:74241324-74241346 TCCCTTGGCTTGCCTGGTGCAGG - Intronic
1130018714 15:80209088-80209110 TCCACTGTCTTGTCTGGAACTGG + Intergenic
1130109312 15:80951672-80951694 TCCTTTGCATTGCTTGGAAGGGG + Exonic
1130387419 15:83423833-83423855 TCAGTTGCCTTTTCTGGAACAGG - Intergenic
1130889051 15:88117882-88117904 TCTGCTTCCTTCCCTGGAACAGG + Intronic
1132738498 16:1399106-1399128 TCCGTCCCCTTGCCTGGCAGAGG + Intronic
1134502717 16:14781664-14781686 TCCATTCCCTTGCCAGCAACTGG - Intronic
1134577846 16:15347231-15347253 TCCATTCCCTTGCCAGCAACTGG + Intergenic
1134683273 16:16141441-16141463 TCCGGTCCCCTGCCTGGAACTGG + Exonic
1134724742 16:16410315-16410337 TCCATTCCCTTGCCAGCAACTGG - Intergenic
1134942689 16:18301544-18301566 TCCATTCCCTTGCCAGCAACTGG + Intergenic
1135394770 16:22122879-22122901 GTCATTGCCTTGTCTGGAACTGG - Intronic
1138448410 16:57078794-57078816 TTCATTCCCTTGCCTGGAAAAGG - Intronic
1141434116 16:83989504-83989526 TTCCTTGCCTTGCCAGGGACTGG + Intronic
1141824290 16:86468221-86468243 TCCATTACCTTGTCTGCAACTGG - Intergenic
1142178861 16:88657560-88657582 TCCGCTGCCTGGCCCGGAAGCGG - Exonic
1143515867 17:7418924-7418946 TCCCCTGCCCTGCCTGGGACTGG - Exonic
1147159344 17:38561469-38561491 TCCGTGTCCTTGGCTGGCACTGG + Exonic
1148388236 17:47252176-47252198 TCCTTTGCCTTCCCTGGGGCTGG + Intergenic
1148712945 17:49695105-49695127 TCCGGTGCATAGCCTGGTACAGG + Intergenic
1149364035 17:55922774-55922796 TCCATTTCCTTGCCTGTTACAGG - Intergenic
1150292165 17:63988248-63988270 TCGGTTGCCCTGCCTGACACAGG + Intergenic
1152423882 17:80208637-80208659 TCCCATGCCTTCCCTAGAACCGG + Exonic
1153983682 18:10334171-10334193 ACTGCTGCCTTGCCAGGAACTGG + Intergenic
1159396640 18:67866387-67866409 TCCTCTGCCTGGCCTGCAACAGG + Intergenic
1159829613 18:73258856-73258878 TCTGTTCCCTTCCCTCGAACCGG - Intronic
1162197725 19:8998579-8998601 TCTGTTGCCCAGTCTGGAACTGG - Intergenic
1162504626 19:11075933-11075955 CCCATTGCCCTGCCTGGAATTGG - Intergenic
1162936786 19:13985498-13985520 TCTGTTGCCTTGTCTGAAAATGG - Intronic
1163846578 19:19641716-19641738 AACGATGCCTTGCATGGAACAGG + Intronic
1165961585 19:39539684-39539706 TCCGTTCCCGTGTCTGGACCTGG + Exonic
928790386 2:34944067-34944089 ACAGTTACCTTGCTTGGAACAGG + Intergenic
929596686 2:43180495-43180517 TCCGTTTCCTTGTCTGTAGCAGG + Intergenic
930292556 2:49513483-49513505 TCCTTTGCCTTTCCAGGGACTGG - Intergenic
932888937 2:75573687-75573709 TCTGATGACTTGCCTGGAACTGG + Intergenic
933837117 2:86255082-86255104 CCCGTGGCCCTGCCTGGCACAGG + Intronic
935759902 2:106310943-106310965 TCCGGTGCCTTGCGTGGGAGAGG - Intergenic
938418506 2:131124297-131124319 TATGTTGCCGTGCCTGCAACTGG - Intronic
939270443 2:139931936-139931958 TCCCTTCCCTTTCCTGAAACAGG + Intergenic
944539622 2:200743213-200743235 TCTATTGCCTTGGCTGGAGCCGG - Intergenic
945767209 2:213995856-213995878 TCTATTGCATTGCCTGGAAAAGG - Intronic
945989205 2:216379653-216379675 CTCGTTGCCTTGCCTCCAACTGG - Intergenic
947718398 2:232352952-232352974 TCCGTTGCTCTCCCTGGATCAGG - Intergenic
947724599 2:232388878-232388900 TCCGTTGCTCTCCCTGGATCAGG - Intergenic
948943474 2:241207818-241207840 TTTGTTCTCTTGCCTGGAACTGG + Intronic
1171157401 20:22889053-22889075 TCCATGGCCTTGCCAGGCACTGG - Intergenic
1173637841 20:44576626-44576648 TCCCTTGCCTTCTCTGGATCTGG + Intronic
1180615974 22:17127572-17127594 TCTGTTGCCTAGGCTGGAAGTGG - Intronic
1180906753 22:19418590-19418612 TCTGTTGCCCAGGCTGGAACAGG - Intronic
1181868333 22:25877106-25877128 TCCCTTGCTTTGCCTGAGACTGG - Intronic
1184727187 22:46354004-46354026 TCCCCTGCCTTTCCTGGGACTGG + Intronic
949303555 3:2613312-2613334 TCCTTTTCCTTGCCAGGAATTGG - Intronic
950125831 3:10509298-10509320 GCCCTTGCCTTGCCTGGCTCGGG + Intronic
954204092 3:49044851-49044873 TCAGTTTCCTTGCCTGTAAATGG + Intronic
955461564 3:59189392-59189414 CCCGCTGCCTCCCCTGGAACAGG - Intergenic
956797324 3:72728692-72728714 TCCATTGCCTCACCTGGAAAAGG + Intergenic
957835027 3:85576237-85576259 GCAGTTGCCTTGCCTGAAAGAGG + Intronic
969184447 4:5465028-5465050 TCCCTTCCCCTGCCTGGCACTGG - Intronic
974022560 4:56704894-56704916 TCCTTTGCCATCCCTTGAACAGG + Intergenic
979840510 4:125434247-125434269 TCCCCTGCCTTGACTGGAACTGG + Exonic
979945953 4:126830966-126830988 TCTGTTGCTCTGCCTGGAACTGG - Intergenic
979956248 4:126956564-126956586 GCCGCAGCCTTGCATGGAACCGG + Intergenic
981527738 4:145723133-145723155 TCCATTGTCTTCCCTGAAACTGG + Intronic
983524207 4:168744021-168744043 GCCTTTGCCTTCCCTGGAAAAGG + Intronic
984716085 4:182926574-182926596 ACTGTTGCCTTGGCTGGCACAGG - Intergenic
989432779 5:41375035-41375057 GCCGTTTCCTTGCCTGTACCCGG - Intronic
992843729 5:80723056-80723078 TCCGTCGCCTAGGCTGGACCAGG - Intronic
993360928 5:86975432-86975454 TCCATTTCCTTGCCTGAAACCGG + Intergenic
999726212 5:154440382-154440404 TCCGTTGCCAAGGCTGGAATGGG - Intergenic
1004560679 6:16746987-16747009 TCTGTTGCCTGCCCTGCAACAGG - Intronic
1005012255 6:21347306-21347328 CCCCTGCCCTTGCCTGGAACAGG + Intergenic
1005639029 6:27777072-27777094 TCCTATGCCTGACCTGGAACTGG + Intergenic
1007223898 6:40299605-40299627 TCTGTTGCATAGCCTGGCACAGG + Intergenic
1007225277 6:40309349-40309371 TCTGTGGCCTTGCCAGGAGCTGG - Intergenic
1008587293 6:52961345-52961367 AGCGTTGGTTTGCCTGGAACCGG - Intergenic
1011552936 6:88546557-88546579 TCCATTGCCAGGCCTGGAGCAGG + Intergenic
1018091837 6:160352280-160352302 TCCACTGCCTTGCCTTGAGCAGG - Intronic
1020152688 7:5695786-5695808 TCCCTTGCTTTGCCTGTAAACGG + Intronic
1022834911 7:34104133-34104155 TCCTTAGCCTGGGCTGGAACAGG - Intronic
1024618451 7:51136162-51136184 TCCGATGCCTTGTCTTGCACAGG + Exonic
1028998387 7:97126785-97126807 ACCGTTCACTTGCCTGGAAAGGG - Intronic
1033171055 7:139084677-139084699 TCCGTTTCCTTTGCTGTAACAGG + Intronic
1040893516 8:52341481-52341503 TGCGTTGCCTTGCATGGCAAAGG + Intronic
1044996835 8:97845500-97845522 CCCCTTGTCTGGCCTGGAACGGG - Intronic
1049534857 8:143174469-143174491 TGCCTCGTCTTGCCTGGAACTGG + Intergenic
1051085723 9:13346799-13346821 TCTGTGGTCTTGCCTGGAGCTGG - Intergenic
1051996065 9:23219605-23219627 GCCATGGCCCTGCCTGGAACTGG - Intergenic
1053570440 9:39299467-39299489 TCCAATTCCTTCCCTGGAACTGG + Intergenic
1053836390 9:42140394-42140416 TCCAGTTCCTTCCCTGGAACTGG + Intergenic
1054092061 9:60858476-60858498 TCCAATTCCTTCCCTGGAACTGG + Intergenic
1054113474 9:61134066-61134088 TCCAATTCCTTCCCTGGAACTGG + Intergenic
1054126709 9:61319544-61319566 TCCAATTCCTTCCCTGGAACTGG - Intergenic
1054594224 9:67048106-67048128 TCCAATTCCTTCCCTGGAACTGG - Intergenic
1058445905 9:105054596-105054618 TACATTGCCTTGGCTGGAATGGG + Intergenic
1060930327 9:127485826-127485848 TTCCTTACCTTACCTGGAACAGG - Exonic
1185669889 X:1799523-1799545 TCCTTTGCTCTGCCTGGAACTGG - Intergenic
1185939217 X:4295968-4295990 TCAGTTCTCTTGCCTAGAACAGG + Intergenic
1195023146 X:100849351-100849373 CCTGTTGACTTCCCTGGAACAGG - Exonic
1197615096 X:128681984-128682006 TCTGCTGCCTCGCCAGGAACTGG + Intergenic