ID: 905938884

View in Genome Browser
Species Human (GRCh38)
Location 1:41846974-41846996
Sequence CTGGCTTCCGTTGCCTTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 266}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905938884_905938892 17 Left 905938884 1:41846974-41846996 CCAGGCAAGGCAACGGAAGCCAG 0: 1
1: 0
2: 3
3: 20
4: 266
Right 905938892 1:41847014-41847036 TATATAAAGGCATCCAGGAAAGG 0: 1
1: 0
2: 1
3: 22
4: 247
905938884_905938894 27 Left 905938884 1:41846974-41846996 CCAGGCAAGGCAACGGAAGCCAG 0: 1
1: 0
2: 3
3: 20
4: 266
Right 905938894 1:41847024-41847046 CATCCAGGAAAGGGCATATGTGG 0: 1
1: 0
2: 5
3: 39
4: 283
905938884_905938893 18 Left 905938884 1:41846974-41846996 CCAGGCAAGGCAACGGAAGCCAG 0: 1
1: 0
2: 3
3: 20
4: 266
Right 905938893 1:41847015-41847037 ATATAAAGGCATCCAGGAAAGGG 0: 1
1: 0
2: 1
3: 32
4: 309
905938884_905938888 4 Left 905938884 1:41846974-41846996 CCAGGCAAGGCAACGGAAGCCAG 0: 1
1: 0
2: 3
3: 20
4: 266
Right 905938888 1:41847001-41847023 ACCCAAGTGTGGCTATATAAAGG 0: 1
1: 0
2: 0
3: 10
4: 94
905938884_905938891 12 Left 905938884 1:41846974-41846996 CCAGGCAAGGCAACGGAAGCCAG 0: 1
1: 0
2: 3
3: 20
4: 266
Right 905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG 0: 1
1: 1
2: 0
3: 11
4: 92
905938884_905938885 -7 Left 905938884 1:41846974-41846996 CCAGGCAAGGCAACGGAAGCCAG 0: 1
1: 0
2: 3
3: 20
4: 266
Right 905938885 1:41846990-41847012 AAGCCAGAGCCACCCAAGTGTGG 0: 1
1: 0
2: 0
3: 20
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905938884 Original CRISPR CTGGCTTCCGTTGCCTTGCC TGG (reversed) Intronic
900700740 1:4047325-4047347 CTGGCTTCTCTTTCCTTGCATGG + Intergenic
901661632 1:10801721-10801743 CTGGCTCACTGTGCCTTGCCTGG + Intergenic
905358906 1:37404733-37404755 CTGGCTTCCCTTTTCTTGGCTGG - Intergenic
905938884 1:41846974-41846996 CTGGCTTCCGTTGCCTTGCCTGG - Intronic
906117582 1:43366711-43366733 CTGGCTTCCCTGCCCTTCCCAGG - Intronic
910799512 1:91131414-91131436 CTGGCTTCAGCCGCCTTTCCAGG - Intergenic
912076747 1:105884666-105884688 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
912150500 1:106853413-106853435 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
912625233 1:111200654-111200676 CTGGCTTCTGCTGCCTTCCTGGG - Exonic
914867657 1:151445490-151445512 CTGGCTTCTGTTGCCCAGGCTGG - Intronic
914967145 1:152270127-152270149 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
914969222 1:152291990-152292012 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
915466668 1:156102382-156102404 CTGGGTGCCCTTGCCCTGCCTGG - Intronic
915876504 1:159616537-159616559 CTGGCTTCAGCTCCCTTTCCAGG - Intergenic
915925830 1:160018848-160018870 CTCACTTCCCTTGCCTTTCCTGG + Intergenic
917274615 1:173319006-173319028 CTGGCTTCAGCTGCCTTTCCAGG - Intergenic
917293605 1:173495452-173495474 CTGGCTTCCCTTTCCTTGAGCGG - Intergenic
917768598 1:178250551-178250573 CTGGCTTTAGCTGCCTTTCCAGG + Intronic
918684380 1:187396977-187396999 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
919997229 1:202764102-202764124 CTGGCTTCCGTTGTCTCCTCGGG + Exonic
921626163 1:217379829-217379851 CTGGCTTCAGCTCCCTTTCCAGG - Intergenic
921990080 1:221356512-221356534 CAGGCTTCCGCCGCCATGCCCGG + Intergenic
922406238 1:225316329-225316351 CTGGCTTCAGCTCCCTTTCCAGG + Intronic
923010103 1:230081892-230081914 TTGGCTTGCGTTTCCTTGTCTGG + Intronic
923934707 1:238747810-238747832 CAGGCTTTCTTTGCCTTGCAAGG + Intergenic
924295999 1:242587111-242587133 CTGGCTTCAGCCGCCTTTCCAGG - Intergenic
1064107585 10:12513112-12513134 CTGGCTGCAGCTGCCTAGCCAGG + Intronic
1067329470 10:45301525-45301547 CTGGCTTCAGTTCCCTTTCCAGG + Intergenic
1070503195 10:77090572-77090594 CTGGCTTCTGCTGTCTTGCCAGG - Intronic
1072404386 10:95136345-95136367 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1072438694 10:95435732-95435754 CTCCCTTCTGTTGCCTTGACAGG - Intronic
1073443863 10:103569523-103569545 CTGGCTACAGGTGCCCTGCCTGG - Intronic
1076052957 10:127349751-127349773 CTGGCTTCCGGTGGCTGCCCCGG + Intronic
1077013011 11:387689-387711 CAGGCTTTCTTTGCCTTGCAGGG + Intergenic
1077149058 11:1060569-1060591 CTGGGTGCCGTGGCCTGGCCTGG - Intergenic
1077403134 11:2368802-2368824 TGGGCTTCCGTGGCCCTGCCTGG + Intergenic
1077463606 11:2723039-2723061 CTGGCCTCCATTCCCGTGCCAGG + Intronic
1078660574 11:13282416-13282438 CTGCTCTTCGTTGCCTTGCCGGG + Intronic
1079316507 11:19412086-19412108 CTGGCTTCAGCTCCCTTTCCAGG - Intronic
1080334520 11:31180877-31180899 CTGGCTTCAGTTCCCTTTCCAGG - Intronic
1082903621 11:58283264-58283286 CTGGCTTCAGTCGCCTTTCCAGG + Intergenic
1085433837 11:76481408-76481430 CTGGCTTCAGCTCCCTTTCCAGG - Intronic
1086907338 11:92433211-92433233 CTGGCTTCAGCTGCCTTTCCAGG + Intronic
1088572693 11:111238888-111238910 CTGCTTTCAGTTGCCTTGTCTGG - Intergenic
1088702527 11:112426220-112426242 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1088909755 11:114181898-114181920 CTTGCTCCTCTTGCCTTGCCTGG + Intronic
1089053697 11:115567044-115567066 CTGGGTTCTGTTGCCTTGGGTGG + Intergenic
1092209285 12:6635939-6635961 CTGGCTTCCGCTGCCTGCTCTGG + Exonic
1092638869 12:10481835-10481857 CTGGCTTCAGCCGCCTTTCCAGG - Intergenic
1093402284 12:18761116-18761138 CTGGCTTCAGCTCCCTTTCCAGG - Intergenic
1093714478 12:22366100-22366122 CTGGCTTCAGCTCCCTTTCCAGG - Intronic
1094082486 12:26552637-26552659 CAGGCTTCACTTTCCTTGCCAGG - Intronic
1094503079 12:31037479-31037501 GTGGCTTCCCTGGCCCTGCCTGG + Intergenic
1094757836 12:33492732-33492754 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1095356403 12:41280377-41280399 CTGGCTTCAGCTCCCTTTCCAGG - Intronic
1099486269 12:83232788-83232810 CTGGCTTCAGCTGCCTTTCCAGG + Intergenic
1099693658 12:85992801-85992823 CTGGCCTTCTTTGCCTTGCAGGG + Intronic
1099798032 12:87422634-87422656 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1101472745 12:105013741-105013763 CTGGCTTCCCTTGGCTTCCCTGG + Intronic
1102961546 12:117096736-117096758 CTGGCTTCAGGGGCCTTGCCAGG - Intronic
1102987839 12:117293013-117293035 CTTGCTTCCTCTTCCTTGCCTGG - Intronic
1103028482 12:117593198-117593220 CTGGCTTCCCCTGCCTGGCTCGG + Intronic
1104272678 12:127296060-127296082 CTGGGTTCCATTGCCATGTCTGG - Intergenic
1104445744 12:128831978-128832000 CAGGCTTGCGTTACCATGCCAGG - Intergenic
1107183620 13:37491666-37491688 GTGCCTACCTTTGCCTTGCCAGG + Intergenic
1107310584 13:39073321-39073343 CTGGCTTCCCTTCCCTTCCTTGG - Intergenic
1109187920 13:59292113-59292135 CTGGCTACAGTGGCTTTGCCAGG - Intergenic
1110337257 13:74346747-74346769 CTGGCTTCAGCTGTCTTTCCAGG - Intergenic
1111006548 13:82257646-82257668 CTTGCTTCTTTTTCCTTGCCTGG + Intergenic
1114744961 14:25136884-25136906 CTGGCTTCAGTTCCCTTTCCAGG - Intergenic
1115744830 14:36425821-36425843 CTTGCTTCCATTGTCTTGCACGG - Intergenic
1116967380 14:51028929-51028951 CTGGCTCCCCTTGCCTCCCCAGG + Intronic
1118732464 14:68677977-68677999 CTGGCTCCCTTTCCCGTGCCAGG + Intronic
1120226970 14:81801611-81801633 TTGGCTTCCTTTGACTTGCATGG + Intergenic
1120640618 14:87007342-87007364 GTGGCTTCATTTGCCTTTCCCGG + Intergenic
1123003154 14:105307390-105307412 CTTGCCTCCTCTGCCTTGCCTGG + Exonic
1125137287 15:36358248-36358270 GTGGTTTCTGTGGCCTTGCCGGG + Intergenic
1126105057 15:45141953-45141975 CTGGCTTCCTCTGCCTTCCCAGG + Exonic
1126414766 15:48406286-48406308 CTGGCTTCCGTGTCCTCTCCTGG + Intergenic
1127551159 15:60039689-60039711 CTGGGTTCCTTTGCCTGGCTTGG + Intronic
1127757246 15:62104600-62104622 CTGGCTTCAGTTGCTGAGCCAGG + Intergenic
1128225735 15:66000062-66000084 CTGGCTTCCGTGCCCTTGACTGG - Intronic
1128545782 15:68566684-68566706 CTGACTTCCCTTCCCTGGCCTGG + Intergenic
1129260741 15:74365872-74365894 CTGGCTTCGCTGGCCCTGCCAGG - Intronic
1129723998 15:77892365-77892387 CTGGCCTCCTTGGCCTTGCAAGG + Intergenic
1132252027 15:100341519-100341541 CTGCCTTCCCTTCCCTCGCCCGG + Intronic
1138448412 16:57078800-57078822 CTGGCCTTCATTCCCTTGCCTGG - Intronic
1138583242 16:57955172-57955194 CTGGCTCCCCTTGTCCTGCCTGG + Intronic
1139570884 16:67811369-67811391 CTTGCTTACCTTGCCTTTCCTGG + Intronic
1140225179 16:73071191-73071213 CTGGACTCCGCAGCCTTGCCTGG - Intergenic
1140903401 16:79391009-79391031 CTGGCTTCCGTCACACTGCCAGG + Intergenic
1141223982 16:82098022-82098044 CTGACTTCCTTGGCCTTCCCAGG + Intronic
1141434114 16:83989498-83989520 CTGTTTTTCCTTGCCTTGCCAGG + Intronic
1141596043 16:85097545-85097567 CTGGCTTCCGTGGCCAGGCACGG - Intergenic
1142135263 16:88449106-88449128 CTTCCCTCCGTTGCCTGGCCTGG - Intergenic
1142931056 17:3284358-3284380 GTGGCTTCCGTGCCCTTGCCAGG - Intergenic
1142944357 17:3412149-3412171 GTGGCTTCCGTGCCCTTGCCAGG + Intergenic
1143084487 17:4405670-4405692 CTGGCTTCAGTTCCCTTCCTGGG + Intergenic
1144742535 17:17591967-17591989 CTGGCGTCCCTGCCCTTGCCTGG + Intergenic
1144749357 17:17637803-17637825 CTGGCTTCCATGGCTTTGCTGGG - Intergenic
1145160396 17:20569878-20569900 CTTGCTTGCTTTGCCTTGGCTGG - Intergenic
1146791458 17:35753006-35753028 CTGGCTTCAGCTGCCAGGCCTGG + Intronic
1147154784 17:38538767-38538789 CTGGATTCTGTTGCCCTGCCAGG - Intronic
1147359999 17:39924463-39924485 CTGTCCTCCGATGCCCTGCCAGG - Intronic
1147994277 17:44352698-44352720 CTGGCTTCCGCTGCGCAGCCAGG + Exonic
1148116506 17:45178389-45178411 CTGGCTTCCCTGGCCTCCCCAGG + Intergenic
1149281299 17:55108385-55108407 CTGGCTTCAGCTCCCTTTCCAGG + Intronic
1157071726 18:44416384-44416406 CTGGCTTCAGCTCCCTTTCCAGG - Intergenic
1157517950 18:48324284-48324306 ATGGCTTCCCTTGCCTTCTCCGG - Intronic
1157684668 18:49632443-49632465 GTGGCTTCAATTTCCTTGCCTGG - Intergenic
1159254702 18:65931098-65931120 CTGGCTTCAGTTGCCTTTCCAGG - Intergenic
1159825046 18:73197584-73197606 CTGGCATCCACTGCCATGCCCGG + Intronic
1160276491 18:77442504-77442526 CTGGGTTCCCTCGCCCTGCCAGG - Intergenic
1165254611 19:34568193-34568215 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1166908530 19:46133384-46133406 CTGGCTTCCGTTGGCTGGAATGG + Intergenic
1167034673 19:46988078-46988100 CTGGCCTCGGATGCCTGGCCAGG - Intronic
1168301747 19:55408641-55408663 CTGGGATCCGTTGTATTGCCAGG + Intergenic
924967597 2:92469-92491 CTGGCTTCAGCTCCCTTTCCAGG - Intergenic
926269043 2:11351213-11351235 CAGGCATGCGTTGCCATGCCTGG - Intergenic
927651950 2:24918653-24918675 CTGGCTTCCCTCGCCGTGGCTGG - Exonic
930292558 2:49513489-49513511 ATGTCTTCCTTTGCCTTTCCAGG - Intergenic
931212110 2:60207308-60207330 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
935469014 2:103434333-103434355 CTGGCTTCCGTTCTCTTCCATGG - Intergenic
937143110 2:119618749-119618771 CTGGCTTCAGTCCCCTTTCCAGG - Intronic
937487643 2:122332395-122332417 CTGGCTTTTCTTGCCTTGCATGG + Intergenic
937562703 2:123244924-123244946 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
938982323 2:136538582-136538604 GTGACTTCCGTAGCTTTGCCAGG - Intergenic
940945192 2:159608229-159608251 CAGGCTTACGCTGCCATGCCTGG - Intronic
941518743 2:166511556-166511578 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
943129947 2:183842037-183842059 CTGGCTTCCGCCCCCTTCCCAGG - Intergenic
943441552 2:187933106-187933128 CTGACTTTCTTTGCCTTGCAGGG - Intergenic
943660461 2:190554318-190554340 CTGGCTTCAGTCTCCTTTCCAGG - Intergenic
943836799 2:192524636-192524658 CTGGCTTCAGCCGCCTTTCCAGG - Intergenic
944267884 2:197748397-197748419 CTGGCTTCAGCTCCCTTTCCAGG - Intronic
944426245 2:199586324-199586346 ATGGCTTCTGTTGCCTTGTGGGG + Intergenic
944675379 2:202031260-202031282 CTGGCTTTCCAAGCCTTGCCTGG - Intergenic
946052711 2:216877464-216877486 CTGTGTTCCGTTGCCTCCCCAGG + Intergenic
947397272 2:229698505-229698527 CTTGCTTCCCTTGCTTTCCCCGG - Intronic
948193533 2:236078435-236078457 CTGGCCGCCGTGGCCTGGCCAGG + Intronic
1170454580 20:16520191-16520213 CTGGCTTCAGCTTCCTTTCCAGG - Intronic
1172460591 20:35115525-35115547 CAGGCTTCCTCTCCCTTGCCTGG + Exonic
1175118245 20:56699076-56699098 CTGGCCTCTGCTGGCTTGCCTGG - Intergenic
1175658704 20:60793786-60793808 CTGCCTTAGGTTGCCTTCCCAGG - Intergenic
1180167098 21:46035936-46035958 CTGGATTCCGTTGTCTGGCAAGG - Intergenic
1182282272 22:29224512-29224534 CTGGCTCCCCTTGCCCTCCCAGG + Intronic
1183021513 22:35030922-35030944 CTGGCTTCAGCTCCCTTTCCAGG + Intergenic
1183110544 22:35645543-35645565 GTGGCCTCCATTGCTTTGCCTGG - Intergenic
1183858245 22:40650999-40651021 CTGCCTTCAGTTGCATTGCTTGG + Intergenic
1184814133 22:46857753-46857775 CTGGCTCCCGTTCCCTCGCATGG + Intronic
1185266384 22:49906445-49906467 CCGGCTGCCGTGGCCGTGCCTGG - Intronic
1185315089 22:50175517-50175539 GTGGATTCCTTTGCCTTGTCCGG + Intronic
949594614 3:5530952-5530974 CTGGCTTCAGCTGCTTTTCCAGG + Intergenic
951337886 3:21446391-21446413 CTAGCTTCCCCTGGCTTGCCTGG - Intronic
954394071 3:50283482-50283504 CAGGCGTCCGCTGCCATGCCCGG - Intronic
954508215 3:51097583-51097605 CTGGCTTCAGTCCCCTTTCCAGG + Intronic
954510516 3:51120943-51120965 CTGGCTTCAGCTTCCTTTCCAGG + Intronic
954762698 3:52888271-52888293 CTGGCTACCCTTCACTTGCCAGG - Intronic
955175130 3:56606253-56606275 CTGGCTTCCGCCCCCTTTCCAGG + Intronic
955304895 3:57820592-57820614 CAGGCTTTCTTTGCCTTGCAGGG + Intronic
956220063 3:66893189-66893211 CTGGCTTCAGCTCCCTTTCCAGG - Intergenic
956424205 3:69116338-69116360 CTGCCTTCAGTTGCCTGGCTTGG - Intronic
956557829 3:70541627-70541649 CAGGCTTTCTTTGCCTTGCAGGG - Intergenic
957474825 3:80709593-80709615 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
959842844 3:110998785-110998807 CTGGCTTCAGCTTCCTTTCCAGG - Intergenic
962765691 3:138560535-138560557 CTGGCTTCAGTCCCCTTTCCAGG - Intronic
963273602 3:143308826-143308848 CTGGCTTCCCCTGGCTTGCTTGG + Intronic
963643064 3:147881706-147881728 CAGGCTTTCTTTGCCTTGCAGGG - Intergenic
964010347 3:151885305-151885327 CTGGCTTCAGCCGCCTTTCCAGG - Intergenic
964049499 3:152373271-152373293 CTGGCTTCAGTTCCCTTTCCAGG + Intronic
964053279 3:152421326-152421348 CTGGCTTCAGCCGCCTTTCCAGG - Intronic
964794517 3:160482621-160482643 CTGGCTTATGTTGCCTAGGCTGG + Intronic
965477402 3:169174040-169174062 CTGTCTACCCTTGACTTGCCAGG + Intronic
966439177 3:179924567-179924589 CTTGCTTCCTTTGCCTTTCTAGG - Intronic
967018201 3:185499767-185499789 CTGGATTCTGGTGCCTTACCTGG - Intergenic
967343560 3:188427889-188427911 CTGGCTTCAGTCCCCTTTCCAGG + Intronic
969592679 4:8130849-8130871 CAGGCTGTCCTTGCCTTGCCTGG + Intronic
970434721 4:16022255-16022277 TGGGCCTCCGTTTCCTTGCCTGG + Intronic
971231151 4:24800705-24800727 CTGGCTTCCGTTGCACGGGCTGG - Exonic
971673625 4:29595653-29595675 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
971826619 4:31631517-31631539 CTGCCTTTAGTTGCTTTGCCTGG - Intergenic
976363041 4:84202774-84202796 CTGGCTTCAGTCTCCTTTCCAGG - Intergenic
977438988 4:97038073-97038095 CTGGCTTCAGCTCCCTTTCCAGG + Intergenic
977723504 4:100267750-100267772 CTGGCTTCAGCTCCCTTTCCAGG + Intergenic
977897839 4:102384301-102384323 CTGGCTTCAGCTTCCTTTCCAGG + Intronic
978186082 4:105858387-105858409 CTGGCTTCTGTCCCCTTTCCAGG + Intronic
979421372 4:120509271-120509293 CTGGCTTCAGCTCCCTTTCCAGG - Intergenic
979819404 4:125151831-125151853 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
980151685 4:129055750-129055772 CTGGCTTCAGCTCCCTTTCCAGG + Intronic
982298982 4:153859709-153859731 CTGGCTTCAGCTCCCTTTCCAGG + Intergenic
983167718 4:164497694-164497716 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
984754725 4:183314488-183314510 ACGGCTACCGTTGCCTGGCCTGG + Intronic
985248846 4:188002887-188002909 TTGGCTTGACTTGCCTTGCCTGG - Exonic
988113725 5:26855753-26855775 CTGGCTTCAGGTGCCAGGCCTGG - Intergenic
988517307 5:31916232-31916254 GTGGCTTTGGTTGCCCTGCCCGG + Intronic
990135024 5:52634682-52634704 CTGGCTTCTGATGACTTGCTGGG + Intergenic
992506099 5:77389049-77389071 CTGGCTTCAGTCTCCTTTCCAGG + Intronic
992927580 5:81605746-81605768 CTGGCTTTCAGTGCTTTGCCTGG - Intronic
993455262 5:88120395-88120417 CTGGCTTCAGTTACCTTTCCAGG - Intergenic
994378049 5:99037771-99037793 CTGGCTTCGGCTCCCTTTCCAGG - Intergenic
994662517 5:102670798-102670820 CTTGCTTCCGTGGCCTTCCAAGG - Intergenic
994918063 5:106004849-106004871 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
995480340 5:112586499-112586521 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
997427985 5:133817348-133817370 ATGGCTTCTGTTTCCTTGACCGG - Intergenic
997809554 5:136954021-136954043 CTGGCTTCAGCTCCCTTTCCAGG + Intergenic
999602572 5:153283062-153283084 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
999688299 5:154122318-154122340 CTGGCTTCAGTCCCCTTTCCAGG - Intronic
1000506656 5:162128402-162128424 CTGGCATCCCTTCCCTTGTCTGG + Intronic
1000732603 5:164855126-164855148 CTGTCTTCCTATGCCTTCCCTGG - Intergenic
1001690019 5:173625965-173625987 CTGTCTTCTGTTCCCTTTCCAGG + Intergenic
1003359676 6:5412772-5412794 CTGGCTGCTGTTGCCTGGCTTGG + Intronic
1004808981 6:19238857-19238879 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1005378256 6:25207396-25207418 CTGGCTTCAGCTGCCTTTCCAGG - Intergenic
1008785092 6:55158468-55158490 CTGGCTTCAGCTCCCTTTCCAGG - Intronic
1009242922 6:61201867-61201889 CAGGCTTTCTTTGCCTTGCAGGG - Intergenic
1009305922 6:62089198-62089220 CTGGCTTCAGTCCCCTTTCCAGG + Intronic
1009880489 6:69560632-69560654 CTGGCTTCAGGTCCCTTTCCTGG - Intergenic
1010361239 6:74997008-74997030 CTGGATTCCGTTGCCTTTCCAGG - Intergenic
1011020720 6:82809470-82809492 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1011332771 6:86228343-86228365 CTGGCTTCAGCTCCCTTTCCAGG + Intergenic
1011400826 6:86959575-86959597 CTGGGTACCATTGCCTAGCCAGG + Intronic
1011578167 6:88827554-88827576 CTGGCTTCAGCCGCCTTTCCAGG - Intronic
1011831262 6:91374687-91374709 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1012922440 6:105233981-105234003 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1015569185 6:134604328-134604350 CTGGCTGCTGCTGCCTCGCCTGG - Intergenic
1016483512 6:144508215-144508237 CTGGCTTCAGTCCCCTTTCCAGG + Intronic
1018067269 6:160132958-160132980 CTGGCTGCCGTGCCCTGGCCTGG - Intronic
1018108692 6:160513851-160513873 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1018768987 6:166956119-166956141 CTGCCTGGCGTTGCTTTGCCTGG - Exonic
1019912202 7:4107299-4107321 CTGCCTTCCGGGTCCTTGCCTGG - Intronic
1020608617 7:10367714-10367736 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1020629727 7:10625530-10625552 CTGGCTTCAGCTCCCTTTCCAGG - Intergenic
1020889568 7:13861956-13861978 CAGGCTTGCGTTGCCAAGCCCGG - Intergenic
1020935471 7:14458865-14458887 CTGGCTTCAGCTCCCTTTCCAGG - Intronic
1021014640 7:15517834-15517856 CTGGCTTCAGCTCCCTTTCCAGG - Intronic
1023864778 7:44233498-44233520 CTGGCTCCCGAAGCCTGGCCTGG + Intronic
1024617118 7:51125291-51125313 CTTGCTGCCGTGGCCTTGCAGGG - Intronic
1027864594 7:83629766-83629788 CTGGCTTCACTTTCCTTTCCAGG + Intronic
1028998385 7:97126773-97126795 CTGGCTTCAGCTCCCTTTCCAGG + Intronic
1029851131 7:103462723-103462745 CTGGCTTCAGCTCCCTTTCCAGG + Intergenic
1030325867 7:108217896-108217918 CTGGCTTCAGCTCCCTTTCCAGG + Intronic
1030386848 7:108876104-108876126 CAGGCTTTCTTTACCTTGCCGGG + Intergenic
1030442709 7:109608089-109608111 CTGGCTTCCTTGGCCTGACCTGG + Intergenic
1032313224 7:130808408-130808430 CTGCCTTCCGTTACAGTGCCAGG + Intergenic
1033617640 7:143032177-143032199 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1033680026 7:143584559-143584581 CTGGCTTCAGCTCCCTTTCCAGG - Intergenic
1033691808 7:143744883-143744905 CTGGCTTCAGCTCCCTTTCCAGG + Intergenic
1041323326 8:56637294-56637316 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1041630593 8:60082912-60082934 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1042179247 8:66068892-66068914 CTGGCTTCTGTTACCTTGGTTGG - Intronic
1042622737 8:70724359-70724381 CTGGCTTCAGTTCCCTTTCCAGG + Intronic
1044566988 8:93675222-93675244 CTGGCTTTCAGTGCATTGCCGGG - Intergenic
1046014607 8:108590224-108590246 CTGGCTTCAGCCGCCTTTCCAGG - Intergenic
1046153500 8:110257856-110257878 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1047121280 8:121908083-121908105 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1050112352 9:2229865-2229887 CATGCTTCCTTTGCCTTGCTAGG - Intergenic
1050750637 9:8932848-8932870 CTGGCTTCCGTCGCCTTTCCAGG + Intronic
1050973933 9:11912388-11912410 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1051049074 9:12909962-12909984 CTGGGTGCAGCTGCCTTGCCAGG - Intergenic
1053391339 9:37738831-37738853 CTGTCTTCCTTTTCCGTGCCTGG - Intronic
1054884937 9:70185857-70185879 CTGGCTTCAGCTCCCTTTCCAGG + Intronic
1054889105 9:70232660-70232682 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1055210296 9:73783197-73783219 CTGGCTTCAGCTCCCTTTCCAGG - Intergenic
1055239207 9:74163658-74163680 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1057217579 9:93237969-93237991 CTGGTTTACGGTGCCTTGTCTGG + Intronic
1057520193 9:95753815-95753837 CTGGCTTCCGTCTCCTGGCAGGG + Intergenic
1060849030 9:126860186-126860208 CTGCCTTCAGCTGCCCTGCCAGG + Intergenic
1061097733 9:128469479-128469501 CGGGCTTCAGTTGCCTGCCCCGG + Intronic
1061216239 9:129223644-129223666 CTGGCTTCGCTTTCCTGGCCTGG - Intergenic
1061570526 9:131475205-131475227 CTGGCTTCCCAGGCCTTGTCAGG - Exonic
1187703535 X:21987472-21987494 CAGGCATCCATTGCCATGCCTGG + Intronic
1188497498 X:30795337-30795359 GTGCCTTGCCTTGCCTTGCCTGG + Intergenic
1188498447 X:30801879-30801901 TTGCCTTGCGTTGCCTTGCTTGG + Intergenic
1189911177 X:45811867-45811889 CTGGCTTCTGATGGCTTGCTGGG - Intergenic
1191094369 X:56659129-56659151 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1191098995 X:56704909-56704931 CTGGCTTCAGCTTCCTTTCCAGG + Intergenic
1192128998 X:68530443-68530465 CTGGCTTCAGCTCCCTTTCCAGG + Intronic
1192933981 X:75839238-75839260 CTGGCTTCAGTTTCCTTTCCAGG + Intergenic
1192994001 X:76492835-76492857 CTGGCTTCAGTACCCTTTCCAGG - Intergenic
1193010616 X:76671196-76671218 CTGGCTTCAGCTCCCTTTCCAGG - Intergenic
1193034456 X:76934389-76934411 CTGGCTTCAGCTCCCTTTCCAGG - Intergenic
1193284643 X:79697262-79697284 CTGGCTTCTGTCCCCTTTCCAGG + Intergenic
1194315308 X:92369490-92369512 CTGGCTTCAGCTCCCTTTCCAGG + Intronic
1194379521 X:93176501-93176523 CAGGCTTTCTTTGCCTTGCAGGG + Intergenic
1197350151 X:125372727-125372749 CTGGCTTCAGGTCCCTTTCCAGG + Intergenic
1197653671 X:129092514-129092536 CTAGCTTCCCTTGCCATGCAAGG - Intergenic
1199344134 X:146719225-146719247 AGGGCTTCCGTTGCCTCACCAGG + Intergenic
1199658298 X:150021033-150021055 CTAGCTTCCATTGCCTTCCTTGG - Intergenic
1200623356 Y:5481025-5481047 CTGGCTTCAGCTCCCTTTCCAGG + Intronic
1201262418 Y:12172943-12172965 CAGGCACCCGTTGCCATGCCTGG - Intergenic
1201611854 Y:15851881-15851903 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic