ID: 905938886

View in Genome Browser
Species Human (GRCh38)
Location 1:41846993-41847015
Sequence TAGCCACACTTGGGTGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905938886_905938894 8 Left 905938886 1:41846993-41847015 CCAGAGCCACCCAAGTGTGGCTA 0: 1
1: 0
2: 0
3: 10
4: 133
Right 905938894 1:41847024-41847046 CATCCAGGAAAGGGCATATGTGG 0: 1
1: 0
2: 5
3: 39
4: 283
905938886_905938892 -2 Left 905938886 1:41846993-41847015 CCAGAGCCACCCAAGTGTGGCTA 0: 1
1: 0
2: 0
3: 10
4: 133
Right 905938892 1:41847014-41847036 TATATAAAGGCATCCAGGAAAGG 0: 1
1: 0
2: 1
3: 22
4: 247
905938886_905938893 -1 Left 905938886 1:41846993-41847015 CCAGAGCCACCCAAGTGTGGCTA 0: 1
1: 0
2: 0
3: 10
4: 133
Right 905938893 1:41847015-41847037 ATATAAAGGCATCCAGGAAAGGG 0: 1
1: 0
2: 1
3: 32
4: 309
905938886_905938891 -7 Left 905938886 1:41846993-41847015 CCAGAGCCACCCAAGTGTGGCTA 0: 1
1: 0
2: 0
3: 10
4: 133
Right 905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG 0: 1
1: 1
2: 0
3: 11
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905938886 Original CRISPR TAGCCACACTTGGGTGGCTC TGG (reversed) Intronic
900293584 1:1936788-1936810 TAGCCACACTCAGGAGGCTGAGG + Intronic
901093979 1:6663725-6663747 AAGCCACCCTTGGGTTGCTGGGG - Intronic
902925224 1:19691539-19691561 GAGCCACACTGTGGTGGCACGGG + Intronic
903669546 1:25027347-25027369 CAGATACACTTGGGGGGCTCTGG + Intergenic
905403643 1:37719429-37719451 AGGGCACACTTGGGGGGCTCTGG + Exonic
905938886 1:41846993-41847015 TAGCCACACTTGGGTGGCTCTGG - Intronic
907147925 1:52253502-52253524 AAGCCACACGTGGGTCGCTGGGG + Intronic
909282226 1:73770457-73770479 TAGCCACACCTGGGAGGGTGGGG - Intergenic
911639404 1:100271043-100271065 TAGACACATTTGGGAGGCTGAGG - Intronic
912235082 1:107842330-107842352 TGGCCACAGTTGAGTGGCCCAGG + Intronic
914332894 1:146689047-146689069 AAGCCACACTTGGTTGGTTTTGG - Intergenic
914440677 1:147703426-147703448 TAGCCACATTTGGGGAGCTAAGG + Intergenic
915145654 1:153794544-153794566 CAGCCAGCCTTGGTTGGCTCAGG - Intergenic
916660311 1:166917410-166917432 TAGCCCCAGTAGGGTGGCTCTGG + Exonic
920933816 1:210412665-210412687 CAGACACACTGGGGTGCCTCTGG + Intronic
922362832 1:224838812-224838834 TGGCCACAGTTGGTTGGTTCTGG + Intergenic
922831039 1:228554504-228554526 TAGAGACACCTGGGTGACTCCGG - Intergenic
924127660 1:240872341-240872363 TAGCTACACTTGGGAGGCTGAGG + Intronic
1063883514 10:10554296-10554318 GAGGCATACCTGGGTGGCTCAGG - Intergenic
1065094493 10:22267227-22267249 TAACCACACATGGGTGGGTATGG - Intergenic
1065561037 10:26964025-26964047 CAGCTACACTTGGGAGGCTGAGG - Intergenic
1065655425 10:27943767-27943789 GAGCCTCACTTCTGTGGCTCAGG - Intronic
1069869308 10:71523556-71523578 GAGCCACACTCGGGAGGCACGGG + Intronic
1069873758 10:71549074-71549096 TATCCACATTTGGGTGTCTGGGG - Intronic
1070669881 10:78370295-78370317 AAGCCACACTTGGGTCACGCAGG + Intergenic
1075762953 10:124870513-124870535 CAGCTACTCTTGGGTGGCTGAGG + Intergenic
1083859998 11:65415237-65415259 TAGCTACGCTTGGGTTGCACGGG + Intergenic
1084659038 11:70536401-70536423 CAGCCACACTTTGCTGGCTGTGG - Intronic
1084978817 11:72817683-72817705 TAGCATCACTTGGGTGCCTTTGG + Intronic
1086934192 11:92726625-92726647 TAGCCACAATTTGGTGCTTCTGG - Intronic
1091032650 11:132204833-132204855 TAGGCACAGTTGAGTGGTTCAGG - Intronic
1092956731 12:13558040-13558062 TAGTCACACTGGGATGGGTCTGG - Exonic
1093731963 12:22575182-22575204 TAGTCCTACTTGGGTGGCTGAGG + Intergenic
1094825266 12:34264646-34264668 GAGGCACACCCGGGTGGCTCCGG - Intergenic
1096575783 12:52552084-52552106 TGGCCACAGCTGAGTGGCTCTGG - Intronic
1097672776 12:62559669-62559691 CAGCCACACTTGGGAGGCTGAGG + Intronic
1103896730 12:124278111-124278133 AGGCCACACTTGCCTGGCTCAGG - Intronic
1105370485 13:19797691-19797713 CAGCTACACTTGGGAGGCTGAGG + Intergenic
1106522005 13:30506382-30506404 GTGCTACACTTGGGTGGGTCTGG - Intronic
1107148096 13:37081369-37081391 TAGATACACTTGGGTAGCTTTGG - Intergenic
1113592899 13:111513179-111513201 TCCCCACACTTGGGAGGCGCAGG - Intergenic
1113992946 14:16042588-16042610 GAGGCACACAGGGGTGGCTCCGG - Intergenic
1114455172 14:22849316-22849338 CAGCCTCACTGGGGTGGATCAGG - Intergenic
1114537855 14:23434193-23434215 TAGACACACTTGAGTAGCCCAGG - Exonic
1118571040 14:67195857-67195879 TAGGCCCACTTGGGAGGCTGAGG - Intronic
1120524874 14:85566270-85566292 GAGCCACACATGCGTGGGTCAGG + Intronic
1121889959 14:97580639-97580661 TTCCCACACATGGGTGGCACTGG + Intergenic
1126465312 15:48956290-48956312 AAGCCAGACCTGGGTCGCTCAGG - Intronic
1128740306 15:70079106-70079128 TGACCACAGCTGGGTGGCTCAGG + Intronic
1130387666 15:83425896-83425918 TAGCCTCATTTGGGTGAGTCTGG - Intergenic
1131581533 15:93648071-93648093 AAGCCAGGCTTGGGTGGCACAGG + Intergenic
1131762476 15:95639418-95639440 TAGCCACACTAGGGTGGGTAAGG + Intergenic
1132904384 16:2274656-2274678 TGGCTACACATGGGTGGCTGTGG + Intergenic
1133213471 16:4275981-4276003 TAGGCACAAGTGGGTGGCCCAGG + Intergenic
1139586732 16:67908777-67908799 TGGACATCCTTGGGTGGCTCGGG - Exonic
1140000723 16:71022197-71022219 AAGCCACACTTGGTTGGTTTTGG + Intronic
1141947205 16:87318689-87318711 TAGCCATTCTTGGGTGGGTGAGG - Intronic
1143525049 17:7466961-7466983 TGGCCAGACTTGGGTGGCTAAGG - Intronic
1145285899 17:21505923-21505945 TTGCCACTGGTGGGTGGCTCAGG + Intergenic
1145391697 17:22460377-22460399 TTGCCACTGGTGGGTGGCTCAGG - Intergenic
1148941152 17:51212870-51212892 TAGCTAGACTTGGGAGGCTGAGG - Intronic
1149140302 17:53424906-53424928 TAGCCACACTTGGAAGGTTCTGG + Intergenic
1149169238 17:53790940-53790962 TGGCCAGTCGTGGGTGGCTCAGG + Intergenic
1150471494 17:65441281-65441303 TGGCCACAGTTGGTTGGTTCAGG + Intergenic
1154934718 18:21041148-21041170 TAGCCAGGCATGGGTGGCTCAGG + Intronic
1157224999 18:45854606-45854628 TACCAACACTTGGGAGGCTGAGG + Intronic
1157885273 18:51360431-51360453 TACCCACATGTAGGTGGCTCAGG - Intergenic
1159980927 18:74778378-74778400 ATTCCACATTTGGGTGGCTCAGG - Intronic
1167203540 19:48084609-48084631 TCGCAACACTTGGGAGGCTAAGG - Intronic
925874948 2:8303629-8303651 TGGCCACGTTTGGGTGGGTCTGG - Intergenic
926441240 2:12890753-12890775 TAGCCACCCTTGGTTAGCTGAGG - Intergenic
930239543 2:48921805-48921827 TAGCCACCCTGGTGTGGCTTGGG - Intergenic
930239545 2:48921808-48921830 AAGCCACACCAGGGTGGCTAAGG + Intergenic
935100052 2:99985718-99985740 TGGCCACCCTTGGGTGGGTAGGG + Intronic
937294974 2:120804583-120804605 TAGTCACACCTGGGTGCATCAGG - Intronic
938538754 2:132268294-132268316 GAGGCACACCGGGGTGGCTCCGG + Intergenic
944616694 2:201467473-201467495 GAGCCACACTTGGATGGCACCGG + Intronic
944620970 2:201515794-201515816 TTGCCACAGGTGGGTGGATCCGG - Intronic
944830053 2:203524599-203524621 AAGCCAGACTTGGGTGGGTTAGG + Intronic
1170767141 20:19299968-19299990 TGTCCACATTTGGGAGGCTCTGG - Intronic
1171183541 20:23109119-23109141 CAGCCACACAAGGATGGCTCTGG + Intergenic
1171812077 20:29753189-29753211 GAGGCACACCGGGGTGGCTCCGG + Intergenic
1171867668 20:30500256-30500278 GAGGCTCACCTGGGTGGCTCCGG + Intergenic
1171907600 20:30912488-30912510 GAGGCACACCTGGGTGGCTCCGG - Intergenic
1176552793 21:8236263-8236285 GAGGCACACCGGGGTGGCTCTGG - Intergenic
1176571691 21:8418666-8418688 GAGGCACACCGGGGTGGCTCTGG - Intergenic
1176579602 21:8463228-8463250 GAGGCACACCGGGGTGGCTCTGG - Intergenic
1178914520 21:36699163-36699185 TAGCCACACATCGCGGGCTCCGG + Exonic
1180314323 22:11264931-11264953 GAGGCACACCGGGGTGGCTCCGG + Intergenic
1180341035 22:11618620-11618642 GAGGCACACCGGGGTGGCTCCGG - Intergenic
1183081925 22:35462333-35462355 CAGCCAGAATTGGGAGGCTCTGG - Intergenic
1183654082 22:39175090-39175112 CAGCCAGACTTGGGGGGCTAGGG + Intergenic
1203257770 22_KI270733v1_random:152663-152685 GAGGCACACCGGGGTGGCTCTGG - Intergenic
949981591 3:9505567-9505589 TAGCCGGACTTGGGAGGCTGAGG - Intronic
954300533 3:49698659-49698681 TAGTCTCCCTTGGGTGGTTCTGG + Intronic
956628387 3:71289760-71289782 CAGCTACACTTGGGAGGCTGAGG - Intronic
961475459 3:127143234-127143256 TAGCCAATCTTGGCTGGCCCAGG + Intergenic
964868911 3:161291685-161291707 TTGCCACATTTGGATGGCACAGG + Intergenic
974875666 4:67700753-67700775 TCACCAGACTTGGGGGGCTCCGG - Intronic
978607540 4:110498206-110498228 AAAACACACTTGGGTGGCACAGG - Intronic
980129803 4:128808022-128808044 TAGCCAGACATGGCTGGATCTGG - Intergenic
981587928 4:146324448-146324470 CAGCCACAATTAGGTGGCTGAGG - Intronic
985756742 5:1723994-1724016 TGGCCACATTTGGCAGGCTCGGG + Intergenic
990006715 5:50953223-50953245 TACCCACACTTGGTTTTCTCAGG + Intergenic
991376223 5:65970700-65970722 CAGCTACACTTGGGAGGCTGAGG - Intronic
994172164 5:96669724-96669746 CAGGCAGACTGGGGTGGCTCTGG - Intronic
997042901 5:130278373-130278395 CAGCCACAGATGGGTGGCTGCGG + Intergenic
997434087 5:133861658-133861680 GATCCAAACTTGGGGGGCTCAGG + Intergenic
999771895 5:154782417-154782439 CAGCCACCCTCGGGTGGCTGTGG - Intronic
1002860348 6:1074450-1074472 CAGCCACACTTCTATGGCTCCGG + Intergenic
1008885809 6:56430902-56430924 TAGTCACGTTTGGTTGGCTCTGG - Intergenic
1011491677 6:87899658-87899680 TAGTCAGAGTAGGGTGGCTCCGG + Intergenic
1012088942 6:94866794-94866816 CAGCTACACTTGGGAGGCTGAGG + Intergenic
1013129995 6:107223596-107223618 CAGCCACACATGGGAGGCTGAGG + Intronic
1017586809 6:155935730-155935752 TATCCATACTGGGGAGGCTCAGG - Intergenic
1018416729 6:163608090-163608112 TAGCCACACTCGGGGGTCCCGGG - Intergenic
1019882849 7:3878399-3878421 TAGTCCCACTTGGGAGGCTGAGG + Intronic
1020286308 7:6683886-6683908 TAGCCACATTTTCATGGCTCAGG - Intergenic
1020985435 7:15128119-15128141 GAGGCAAACTTGGGTGGCACTGG - Intergenic
1022324657 7:29320276-29320298 AAGCCACAGTTTGGTGGCTCTGG - Intronic
1024226855 7:47332073-47332095 TTGACACACTTGGGAGGGTCTGG - Intronic
1026360672 7:69598984-69599006 TCGCCCCTCTTGGGTCGCTCCGG + Intronic
1029733465 7:102452566-102452588 TAGCTACACTTGGGAGACTACGG + Exonic
1037790052 8:21930954-21930976 CAGCCTCACTTGGGAGGCTGAGG - Intronic
1038369574 8:26974682-26974704 AAGCCATACTTGGGAGGCTGAGG + Intergenic
1039875274 8:41579286-41579308 TAGCCACAGTTAAGTGGCTGAGG - Intronic
1040278855 8:46027509-46027531 GAGCCACACATGGATGCCTCGGG + Intergenic
1040301262 8:46189199-46189221 TGGACACACCTGGGTGTCTCTGG - Intergenic
1043867617 8:85394097-85394119 CAGCCAACCGTGGGTGGCTCTGG - Intronic
1045418527 8:101991210-101991232 TTGCCACACTGAGGTGACTCAGG - Intronic
1048291238 8:133183198-133183220 TAGGAACACTTGGAAGGCTCTGG + Intergenic
1049581342 8:143412520-143412542 TAGTCCAGCTTGGGTGGCTCGGG + Intergenic
1053025206 9:34723705-34723727 TAGCCTGAGTTGGTTGGCTCAGG + Exonic
1053036735 9:34832768-34832790 TAGCCTGAGTTGGTTGGCTCAGG + Intergenic
1053546187 9:39025419-39025441 TACCCAGACTTGGGTGTGTCTGG + Intergenic
1054901354 9:70372429-70372451 TAGTCCCACTTGGGAGGCTGAGG + Intergenic
1058505398 9:105661228-105661250 TAGGAACACTTGGGAGGCACTGG - Intergenic
1059646356 9:116272112-116272134 CAGCCCCACTTGGGAGGCCCTGG + Intronic
1061896701 9:133652086-133652108 AAGCCACACTTAGCGGGCTCTGG + Intronic
1203473963 Un_GL000220v1:134686-134708 GAGGCACACCGGGGTGGCTCTGG - Intergenic
1203362632 Un_KI270442v1:231053-231075 GAGGCACACCGGGGTGGCTCCGG + Intergenic
1190871962 X:54432191-54432213 CAGCTACACTTGGGAGGCTGAGG - Intergenic
1192561470 X:72130829-72130851 TAGCCACACGTGGGGGGATGGGG + Exonic
1201075613 Y:10185158-10185180 GAGGCGCACCTGGGTGGCTCTGG - Intergenic