ID: 905938891

View in Genome Browser
Species Human (GRCh38)
Location 1:41847009-41847031
Sequence GTGGCTATATAAAGGCATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 92}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905938886_905938891 -7 Left 905938886 1:41846993-41847015 CCAGAGCCACCCAAGTGTGGCTA 0: 1
1: 0
2: 0
3: 10
4: 133
Right 905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG 0: 1
1: 1
2: 0
3: 11
4: 92
905938884_905938891 12 Left 905938884 1:41846974-41846996 CCAGGCAAGGCAACGGAAGCCAG 0: 1
1: 0
2: 3
3: 20
4: 266
Right 905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG 0: 1
1: 1
2: 0
3: 11
4: 92
905938881_905938891 19 Left 905938881 1:41846967-41846989 CCCTGTTCCAGGCAAGGCAACGG 0: 1
1: 0
2: 0
3: 13
4: 204
Right 905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG 0: 1
1: 1
2: 0
3: 11
4: 92
905938883_905938891 18 Left 905938883 1:41846968-41846990 CCTGTTCCAGGCAAGGCAACGGA 0: 1
1: 0
2: 0
3: 8
4: 144
Right 905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG 0: 1
1: 1
2: 0
3: 11
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905938891 Original CRISPR GTGGCTATATAAAGGCATCC AGG Intronic
902936705 1:19769771-19769793 GTGGCTTAATGCAGGCATCCTGG + Intronic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
907955960 1:59228571-59228593 GATGCTATATCAAGGCATCAGGG + Intergenic
910061624 1:83100408-83100430 GAGGCTATATGATTGCATCCAGG + Intergenic
915803370 1:158818259-158818281 GTGGCTATATAAATGTATAAAGG - Intergenic
919891013 1:201974618-201974640 TTGGCTATAAAAAGGCAGCATGG - Intergenic
920848257 1:209611409-209611431 GTGGCTATTTACACTCATCCAGG - Intronic
921600287 1:217099549-217099571 GTGGCTAGAAAATAGCATCCTGG - Intronic
922556037 1:226532776-226532798 GTGTCTAGATAAAAGGATCCTGG + Intergenic
923412167 1:233721448-233721470 GCTGCCATATAAGGGCATCCTGG - Intergenic
1068828058 10:61462031-61462053 GTGGGTATGCAAAGGCATACAGG + Intergenic
1069910851 10:71758312-71758334 CTGGAGATACAAAGGCATCCAGG - Intronic
1081184410 11:40024550-40024572 GAGGATATAAAATGGCATCCTGG - Intergenic
1082901517 11:58258512-58258534 GTGGGTACACAAAGGCATACAGG - Intergenic
1084449435 11:69227080-69227102 GTGGCAATAGAAGGGCACCCTGG + Intergenic
1093406999 12:18816617-18816639 GTGGTTATAAAATGGCATCCTGG + Intergenic
1094143964 12:27209586-27209608 GTGGGTACACAAAGGCATACAGG + Intergenic
1095379865 12:41577867-41577889 GTGGCTATATATAGGTAGACTGG - Intergenic
1095523342 12:43094881-43094903 GAGGCTCTCTAAAGGAATCCTGG - Intergenic
1098446574 12:70572020-70572042 GTGACTATTTAAGGGTATCCTGG - Exonic
1098466656 12:70794778-70794800 GTGGCTATGTCAAGGTTTCCAGG - Intronic
1102778335 12:115540785-115540807 GTGGAGATATAAAGGGATCTTGG - Intergenic
1103514111 12:121495708-121495730 ATGGCTCTATGAAGGCATCAAGG - Intronic
1106232958 13:27836088-27836110 GTGGCTATAAAAGGGCATCAGGG - Intergenic
1108441905 13:50462739-50462761 GTGGCTATAAAAGGGCACCACGG + Intronic
1109157197 13:58925690-58925712 TTCTATATATAAAGGCATCCAGG - Intergenic
1114826295 14:26084525-26084547 GTGGCTTGCTCAAGGCATCCTGG - Intergenic
1118008492 14:61586680-61586702 ATGGCTAAATAAAGGAAGCCCGG + Intronic
1119840713 14:77790810-77790832 GTGTATATATACAGACATCCAGG + Intergenic
1121611298 14:95282697-95282719 GGGGTAATATAAAGGCTTCCTGG - Intronic
1122353716 14:101111580-101111602 GTTGCTATTTAAAGGCATCTTGG - Intergenic
1124058573 15:26265622-26265644 GTGGCTATATAAAGCCAGTGTGG - Intergenic
1124147163 15:27138607-27138629 GTGTCCAGATGAAGGCATCCAGG - Intronic
1127722932 15:61720540-61720562 GTGGGTACATGAAGGCATCTTGG - Intergenic
1131556912 15:93407664-93407686 GTGAGGATACAAAGGCATCCTGG + Intergenic
1131623114 15:94088485-94088507 TTGGTCATATAAAGGAATCCTGG + Intergenic
1133146354 16:3789758-3789780 GTGACTTTATAAAATCATCCTGG + Intronic
1134805266 16:17118820-17118842 GTGGCTAAAACAAGGCATCCTGG - Intronic
1138193846 16:55037798-55037820 GTGAATATATAAAAGTATCCGGG - Intergenic
1139027828 16:62840711-62840733 CTGACTATAAGAAGGCATCCTGG - Intergenic
1149166442 17:53758149-53758171 GTCCCTAAAAAAAGGCATCCAGG + Intergenic
1151504815 17:74520853-74520875 GTGGCTATTTAAGGGCATGACGG + Intergenic
1153190198 18:2529512-2529534 GTGTCTATAAAAAAGCCTCCTGG - Intergenic
1153613076 18:6907679-6907701 GTGGCTATAAAGAGGCAACAGGG + Intronic
1158380121 18:56920270-56920292 GGGGCTATAAGAAGGCTTCCAGG - Intronic
1161849627 19:6731721-6731743 GAGGCCAGATAAAGGCATTCGGG + Intronic
1162562393 19:11424164-11424186 GGGGCCAGATAAAGGCACCCGGG + Intronic
1164817006 19:31211923-31211945 GAGGTTATATAAAGATATCCAGG + Intergenic
1164913721 19:32032865-32032887 GTGGCTATAAAGAGGAATCTAGG - Intergenic
930828963 2:55723160-55723182 GTGTCTATAGAAGAGCATCCAGG - Intergenic
936104326 2:109612328-109612350 GTGGTTATAAAAAGGCATTAAGG + Intronic
940118348 2:150235480-150235502 GTGACTCTCTAAAGTCATCCAGG - Intergenic
946300079 2:218817749-218817771 GTGGATATACAAAGTCTTCCTGG - Intergenic
1169542714 20:6617888-6617910 GTGGATATATAAAGACACTCAGG - Intergenic
1170115863 20:12858864-12858886 GTGGCTATGTAAGGGCACACAGG + Intergenic
1174274127 20:49391233-49391255 ATGGCTCTATAAAGTCATCATGG - Intronic
1183659345 22:39209488-39209510 GTGGCCATATAACGGCACTCTGG - Intergenic
1185045839 22:48528370-48528392 TTGGCTATACACAGGCATCGGGG - Intronic
950578710 3:13849105-13849127 GTGGCTATACAAGGGCAACCTGG + Intronic
950692971 3:14675560-14675582 GTGACTATATAGATGCAGCCTGG - Intronic
951273258 3:20653804-20653826 GTGGCTATATAATGTCATCAAGG + Intergenic
956279905 3:67545256-67545278 GTTGCCATAAAAAGGAATCCAGG + Intronic
956616105 3:71174360-71174382 GTGGCTATTTAGAGGCAGCTGGG - Intronic
958096375 3:88950810-88950832 GTGGCTGTGTATAGGCATTCTGG - Intergenic
964635860 3:158858350-158858372 GTGGCTATAGACAGCCTTCCTGG - Intergenic
969933980 4:10663152-10663174 GGGGCTAGATAAGGGCATCTTGG - Intronic
970723160 4:19011135-19011157 GTGGCTATTTAAAGGCATCCTGG + Intergenic
974689882 4:65283997-65284019 GTGGCTAAATAAAGTTATACTGG + Intergenic
978797878 4:112726283-112726305 GAGTATGTATAAAGGCATCCTGG + Intergenic
981937571 4:150251857-150251879 GTGGCCACATAAACGCAGCCGGG - Intronic
985608935 5:875645-875667 GTTGCTATAAAAAAGCATCTGGG - Intronic
986854920 5:11857327-11857349 GTGGCGATACAAAGGCACCGAGG + Intronic
987073698 5:14360758-14360780 GTGGCCAAGCAAAGGCATCCAGG - Intronic
992744604 5:79806777-79806799 GGGGTTTTATAAAGGCCTCCTGG + Intergenic
993846842 5:92954512-92954534 TTGGCCTTATTAAGGCATCCAGG + Intergenic
995495656 5:112739333-112739355 GTGGCTTTGTAAAGCCCTCCAGG + Intronic
999881838 5:155873203-155873225 GTGGCTAACTAAAGTCATGCTGG - Intronic
1000888275 5:166773466-166773488 GTGGCAATAACAGGGCATCCAGG + Intergenic
1001164793 5:169354291-169354313 GTGGTTATAAAAAGGCAACAGGG + Intergenic
1003077905 6:2999198-2999220 GTGGCTATAAAAACGCAACCCGG - Intronic
1003085148 6:3054566-3054588 GTGGCTATAAAAACGCAACCCGG + Intergenic
1004734270 6:18389214-18389236 TTGGCAATTTAAAGGCATTCAGG + Intronic
1013390982 6:109686228-109686250 GTGTCTTTATAAGGGGATCCGGG - Intronic
1014199728 6:118595166-118595188 GTAGCTATTTAATGGCCTCCAGG + Intronic
1014208810 6:118686921-118686943 GTGGCTATGGAAAGGCATGTAGG - Intronic
1019349389 7:546784-546806 GTGGCTATAAAAAGGCAGCTGGG - Intergenic
1031412491 7:121456739-121456761 GTGGGTCTAGAAATGCATCCAGG + Intergenic
1033884639 7:145930358-145930380 GTGGCAACATAAAGGGATGCAGG + Intergenic
1037072636 8:14670976-14670998 ATGGGTATATAAACACATCCAGG - Intronic
1037213570 8:16421901-16421923 GCGGGTATATAAAAGCAACCGGG + Intronic
1037668490 8:20994352-20994374 GTGTCTATACAAAGGCATGATGG + Intergenic
1038908008 8:31928816-31928838 ATAGGTATTTAAAGGCATCCAGG + Intronic
1041684970 8:60635414-60635436 TTAGCTATATAATGCCATCCAGG + Intergenic
1042807949 8:72792197-72792219 CTGGCTACAAGAAGGCATCCTGG - Intronic
1043973266 8:86556780-86556802 GTGGTTATAAAAGGGCAACCAGG - Intronic
1044739034 8:95306633-95306655 GTGGGTATATAAAGACCTCTGGG - Intergenic
1044908662 8:97032718-97032740 GTTGCTAGACAAAGGCATCCTGG - Intronic
1057217082 9:93235040-93235062 GTGGCTCTGTAAAGCCATCCTGG + Intronic
1060723760 9:125994526-125994548 GTGGCCAAATGCAGGCATCCAGG - Intergenic
1187080278 X:15979004-15979026 GTGGGTACACAAAGGCATACAGG + Intergenic
1187495607 X:19792993-19793015 ATGGCTATATAAGAGCATCTGGG + Intronic
1198217672 X:134570624-134570646 TTGGCTATACAAATGCATCTAGG - Intronic
1198860807 X:141067979-141068001 GTGTTGATATAAAGCCATCCAGG + Intergenic
1198901885 X:141519407-141519429 GTGTTGATATAAAGCCATCCAGG - Intergenic
1199230476 X:145431768-145431790 GTGGCCATAGAAAGGCATAGGGG - Intergenic