ID: 905938892

View in Genome Browser
Species Human (GRCh38)
Location 1:41847014-41847036
Sequence TATATAAAGGCATCCAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 247}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905938886_905938892 -2 Left 905938886 1:41846993-41847015 CCAGAGCCACCCAAGTGTGGCTA 0: 1
1: 0
2: 0
3: 10
4: 133
Right 905938892 1:41847014-41847036 TATATAAAGGCATCCAGGAAAGG 0: 1
1: 0
2: 1
3: 22
4: 247
905938887_905938892 -8 Left 905938887 1:41846999-41847021 CCACCCAAGTGTGGCTATATAAA 0: 1
1: 0
2: 0
3: 9
4: 135
Right 905938892 1:41847014-41847036 TATATAAAGGCATCCAGGAAAGG 0: 1
1: 0
2: 1
3: 22
4: 247
905938884_905938892 17 Left 905938884 1:41846974-41846996 CCAGGCAAGGCAACGGAAGCCAG 0: 1
1: 0
2: 3
3: 20
4: 266
Right 905938892 1:41847014-41847036 TATATAAAGGCATCCAGGAAAGG 0: 1
1: 0
2: 1
3: 22
4: 247
905938883_905938892 23 Left 905938883 1:41846968-41846990 CCTGTTCCAGGCAAGGCAACGGA 0: 1
1: 0
2: 0
3: 8
4: 144
Right 905938892 1:41847014-41847036 TATATAAAGGCATCCAGGAAAGG 0: 1
1: 0
2: 1
3: 22
4: 247
905938881_905938892 24 Left 905938881 1:41846967-41846989 CCCTGTTCCAGGCAAGGCAACGG 0: 1
1: 0
2: 0
3: 13
4: 204
Right 905938892 1:41847014-41847036 TATATAAAGGCATCCAGGAAAGG 0: 1
1: 0
2: 1
3: 22
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905938892 Original CRISPR TATATAAAGGCATCCAGGAA AGG Intronic
900101845 1:965289-965311 TAAATAAAGACATGAAGGAATGG - Exonic
901270202 1:7946798-7946820 TAAATAAAGGCATACAGGGCCGG - Intergenic
901732461 1:11290154-11290176 GAAATAAAGGCAGCCAGGCACGG - Intronic
901786940 1:11630846-11630868 TAAATAAAGGCATGAAGAAACGG + Intergenic
902274040 1:15326483-15326505 TGTGTACAGGCATCCAGCAAAGG + Intronic
903114233 1:21165364-21165386 TATATAAAAACATCCATGAACGG + Intronic
905171484 1:36112410-36112432 TGTACAAAGGCACCCAAGAAAGG - Intronic
905938892 1:41847014-41847036 TATATAAAGGCATCCAGGAAAGG + Intronic
907970791 1:59378875-59378897 TATAGACAGACATCCAAGAATGG - Intronic
908944743 1:69481020-69481042 CAGAAAGAGGCATCCAGGAAAGG - Intergenic
912598163 1:110900302-110900324 CATTTAAAGACATCCAAGAAAGG + Intergenic
912647334 1:111406207-111406229 TATCTAAAGGCATCACTGAAAGG + Intergenic
914241789 1:145857636-145857658 TATATAAACGATTCCAAGAAAGG - Intronic
914422455 1:147541808-147541830 TCTTTCAAGGCATCCAGGACTGG + Intronic
915385749 1:155490313-155490335 TATATAAAGACATCCAGGGTTGG + Intronic
917015205 1:170522812-170522834 TATAAAAGGGCTTCCAGGAGTGG + Intergenic
917760664 1:178153784-178153806 TGTATATAGACATCAAGGAATGG + Intronic
918361021 1:183758350-183758372 TATATAAAGTTAGCCAGGCATGG - Intronic
918944531 1:191045823-191045845 TATATAAAGGGCTCATGGAATGG + Intergenic
919238074 1:194872103-194872125 TAAAAAAAAGCATGCAGGAAGGG - Intergenic
920671645 1:208008209-208008231 TAGATTAAATCATCCAGGAAGGG - Intergenic
922862315 1:228829969-228829991 TAAATCAAGGCATCCAGAAGAGG + Intergenic
923421271 1:233817711-233817733 TACAGAAAAGCATCCAGAAAAGG + Intergenic
1063169720 10:3496688-3496710 GAGATAGAGGAATCCAGGAAAGG + Intergenic
1063822464 10:9853740-9853762 TTTTTAGAGGCCTCCAGGAAAGG + Intergenic
1066332105 10:34435018-34435040 TAAATAAAGGTATCAGGGAACGG + Intronic
1068727280 10:60317423-60317445 TTTAAAAAGGCATCCAAGTAGGG - Intronic
1069169293 10:65204956-65204978 TATATAAAGGGAGAAAGGAAGGG - Intergenic
1069420844 10:68245087-68245109 TGTATACAGGAACCCAGGAAAGG + Intergenic
1071273226 10:84028071-84028093 TTTTTAAAGGCATCCAAGGAGGG - Intergenic
1072760489 10:98052309-98052331 CATTTGAAGGCATCCTGGAAGGG + Intergenic
1073677612 10:105666019-105666041 TAGATGAAGACATCAAGGAAGGG + Intergenic
1073743684 10:106441022-106441044 TATAGAAATGTTTCCAGGAAGGG + Intergenic
1075081919 10:119390044-119390066 GATCTAAAGGCTACCAGGAAAGG - Intronic
1075359172 10:121814263-121814285 TGTCTAAAGGCAGACAGGAAGGG + Intronic
1079693345 11:23447255-23447277 CAAATAAAGGCATCTAGGAAAGG + Intergenic
1080226134 11:29962882-29962904 TATATAAAGGAGTAGAGGAAAGG - Intergenic
1080307229 11:30849873-30849895 AATAGAAAGTCATCCTGGAAAGG - Intronic
1080805427 11:35648718-35648740 TATAAAAGGGCATGCAGGATGGG - Intergenic
1081347364 11:42006696-42006718 TAAATAAAAGAATCCAGGCATGG - Intergenic
1083370069 11:62171455-62171477 TTGAGAACGGCATCCAGGAACGG - Intergenic
1083515978 11:63259508-63259530 TATATATATGCATCCAGTACAGG - Intronic
1085924836 11:81004976-81004998 TATATTAAAGCTTCTAGGAAAGG + Intergenic
1087660136 11:100977668-100977690 CATGTAAAGACATCCAGTAATGG - Intronic
1089421805 11:118337685-118337707 AATATAAATGCAGCCAGGCATGG - Intergenic
1089467224 11:118693073-118693095 TATATACAGGCAACGAGGAATGG - Intergenic
1089526764 11:119102047-119102069 TAAAGAAAGGCAGCCAAGAACGG + Intronic
1090270018 11:125379476-125379498 TTTTTAAAGGCCTTCAGGAATGG - Intronic
1093067670 12:14675375-14675397 CATACAAATGCAACCAGGAAAGG + Intronic
1094304682 12:29005640-29005662 TATATAAAAGCTTCCACAAAGGG + Intergenic
1096958519 12:55552067-55552089 TATATGAAGGGATTCAGTAAGGG - Exonic
1097011377 12:55955688-55955710 TATATAAGGGGATCTGGGAAGGG + Intronic
1097021266 12:56022191-56022213 TATTTAAAGGTCTCAAGGAAAGG + Intronic
1097197672 12:57252735-57252757 TAAAGAAAGGCAGCCAGGCACGG + Intronic
1097622317 12:61954996-61955018 TATATAAGAGTATTCAGGAAGGG - Intronic
1097656679 12:62372560-62372582 TCTGCAAAGGCATACAGGAAAGG - Intronic
1099754177 12:86821013-86821035 TAAATAAAGGCTTCCAGCATGGG - Intronic
1099908277 12:88798063-88798085 TCTATGAAGGCATCAAAGAATGG - Intergenic
1100688616 12:97013964-97013986 AATCTAAAGGAAGCCAGGAAGGG + Intergenic
1104776903 12:131394918-131394940 TAAATAAAGACATCCAGTGACGG - Intergenic
1105670132 13:22604285-22604307 TTTAAAAAGGCTTTCAGGAATGG + Intergenic
1106498606 13:30306682-30306704 GAAATAAACGTATCCAGGAAAGG + Intronic
1106504365 13:30358086-30358108 TATATACACGCAGCCAGGCATGG + Intergenic
1106567758 13:30900956-30900978 TGGACAAAGTCATCCAGGAAAGG + Intergenic
1106863069 13:33932438-33932460 TAAATAAAGGCATACAAAAATGG - Intronic
1107955039 13:45503703-45503725 TGTAGAAAGGCATGCAGGAATGG + Intronic
1108714314 13:53063908-53063930 AATAGAAAGGATTCCAGGAAAGG - Intergenic
1108939106 13:55927378-55927400 TATATTAATCTATCCAGGAAGGG + Intergenic
1109119526 13:58436600-58436622 GATATAGAGGGATGCAGGAATGG + Intergenic
1109521263 13:63513151-63513173 AATATATAGGCAATCAGGAATGG + Intergenic
1110248813 13:73358235-73358257 TGAAAAAAGGCATCCAGGTATGG + Intergenic
1111149997 13:84240107-84240129 TATATAAAGGCAAAAAGGCAAGG + Intergenic
1111163297 13:84422367-84422389 TTTATAAAGGAATAAAGGAAAGG - Intergenic
1111286884 13:86105677-86105699 AATATAAATGCATCCAGTACAGG - Intergenic
1111771269 13:92599276-92599298 TATATTTAGGGAACCAGGAAAGG + Intronic
1112074684 13:95898693-95898715 TATAAAAAGGCTTTCAGGAGTGG + Intronic
1114427211 14:22633946-22633968 TATATAAAGGGGTTGAGGAATGG + Exonic
1114956723 14:27830073-27830095 CCTGTAAAGGCATCCATGAAAGG - Intergenic
1115836817 14:37415200-37415222 TATATATGTGCCTCCAGGAAAGG + Intronic
1116528378 14:45935152-45935174 CTTATGAAGGCATCCAGGATGGG + Intergenic
1117632770 14:57710574-57710596 TCTATAAAAGCAACCAGGATGGG + Intronic
1118098425 14:62566422-62566444 AATACAAAGGGATCCAGAAAAGG - Intergenic
1118248075 14:64131211-64131233 TTTATAAAAGCATCTAGCAAGGG - Intronic
1119686536 14:76637163-76637185 TTTAAAAAGGAATCCAGGACAGG + Intergenic
1121705982 14:95994143-95994165 TATATAAAGCCACCCTGGAGTGG + Intergenic
1124044462 15:26135714-26135736 TATATATACACATCCAGGAAAGG + Intergenic
1126304188 15:47236269-47236291 TTTATCAAGCTATCCAGGAAAGG - Intronic
1130901182 15:88207856-88207878 CTTTTAAAGGCAGCCAGGAAGGG - Intronic
1131372283 15:91892571-91892593 TCCATAAAGGCATCCTGGCATGG + Intronic
1132161563 15:99547668-99547690 AATAAGACGGCATCCAGGAAAGG - Intergenic
1135482878 16:22837098-22837120 ACTGTATAGGCATCCAGGAAGGG - Intronic
1137366953 16:47868661-47868683 TCTATAAAGCCATTAAGGAATGG + Intergenic
1137767052 16:50985735-50985757 TATATATATGCATCTGGGAAAGG - Intergenic
1139255120 16:65533716-65533738 TATATATGGGCATCAAAGAAGGG - Intergenic
1140249488 16:73283428-73283450 TATATACAGACAACCAGAAATGG - Intergenic
1142975644 17:3642377-3642399 TTTCTAATGGCATTCAGGAAAGG - Intronic
1144174742 17:12694251-12694273 CACAAAAAGGCATCCGGGAAGGG + Intronic
1149166445 17:53758154-53758176 TAAAAAAAGGCATCCAGGCCCGG + Intergenic
1149205314 17:54237705-54237727 GAAATAAAAGCCTCCAGGAAAGG - Intergenic
1149526715 17:57361876-57361898 TATATAAAATGATCCAGGACAGG - Intronic
1151190029 17:72391616-72391638 ATTAGAAAGGCATCTAGGAAGGG + Intergenic
1155127800 18:22896879-22896901 TATAAAAAAGCATTCAGGATGGG + Intronic
1155329010 18:24695372-24695394 AATACCAAGGCATGCAGGAATGG - Intergenic
1155844280 18:30685848-30685870 TATATAAAAGCATTCAGTAATGG - Intergenic
1156231638 18:35158856-35158878 TAAATCAAAGCACCCAGGAAAGG - Intergenic
1156537043 18:37874086-37874108 AATAAAAAGGCAGCCAGGCACGG - Intergenic
1157334261 18:46726036-46726058 TATATATATATATCCAGGAATGG + Intronic
1160209514 18:76864917-76864939 TCTAAAAAGTAATCCAGGAAGGG + Intronic
1162434026 19:10645964-10645986 GAAACAAAGGCATCGAGGAAGGG - Intergenic
1164458354 19:28427312-28427334 AATATAAAGGCATGGAGGACAGG - Intergenic
1166187064 19:41147232-41147254 TAGATATAGGCATCCAGGCATGG - Intergenic
1166797012 19:45432695-45432717 TAAATAAAAGCAGCCAGGAGTGG - Intronic
1167933210 19:52885257-52885279 TATATAAAGTTCTCCAGTAAAGG + Intronic
1167996192 19:53404390-53404412 TATATAAAGTTCTCCAGTAAAGG - Intronic
1168001675 19:53451525-53451547 TATATAAAGTTCTCCAGTAAAGG - Intronic
1168006049 19:53488341-53488363 TATATAAAGTTCTCCAGTAAAGG - Intronic
925468191 2:4130152-4130174 TTTATAAAGTCATCTGGGAAAGG + Intergenic
925734472 2:6949286-6949308 TATATAAATGTTTCCAGGATGGG + Intronic
926094001 2:10069091-10069113 TAAATAAAAGTCTCCAGGAAGGG + Intronic
927901106 2:26819121-26819143 TAGATAAAGGCTTCCAGGTGTGG - Intergenic
928915556 2:36466295-36466317 TAAATACAAGCATACAGGAAAGG + Intronic
930261924 2:49157054-49157076 TATTTAAAGACATCAAAGAAGGG - Intergenic
931674726 2:64683023-64683045 TATAGAAAGGCATGCAAGAGTGG - Intronic
932541880 2:72664016-72664038 AAAATAAAGTCAACCAGGAATGG + Intronic
932652566 2:73574721-73574743 TAGATAAATGGATCCAGGAGAGG + Intronic
932698856 2:73979377-73979399 TAGAGAAAGAAATCCAGGAAAGG - Intergenic
933489598 2:82968741-82968763 TATACAAAGAGATCCAGAAATGG - Intergenic
933521941 2:83384940-83384962 TAAATAAAGTAATCCATGAAAGG - Intergenic
934480559 2:94637920-94637942 CCTGTAAAGGCATCCATGAAAGG + Intergenic
935353248 2:102174012-102174034 CATGTAAAAGCATCCAGAAAAGG - Intronic
935538757 2:104325491-104325513 TATATAAAGGAAGAAAGGAAGGG - Intergenic
935597729 2:104892619-104892641 TATATAAAATCAGCCAGGAGTGG - Intergenic
936824154 2:116560109-116560131 GATATAAAGGACACCAGGAATGG + Intergenic
936858308 2:116986634-116986656 TAAATGAAGTCACCCAGGAATGG + Intergenic
937316962 2:120937791-120937813 TTTTGACAGGCATCCAGGAAAGG + Intronic
939502414 2:143004418-143004440 AAAATAAAGGCAGCCTGGAATGG + Intronic
941544878 2:166836534-166836556 TATAATAAGGCATCTAGAAAAGG + Intergenic
941864863 2:170324238-170324260 TAGAAAAAGGGATCCAGCAAAGG - Intronic
943238382 2:185352232-185352254 AATACAAAGACATCCAAGAACGG + Intergenic
943894749 2:193341864-193341886 GATCTATAGGCCTCCAGGAAAGG - Intergenic
944734890 2:202553590-202553612 TTCAGAAAGGCATCCAGGAAAGG + Intronic
946949269 2:224854994-224855016 AATATCCAGGCTTCCAGGAATGG + Exonic
947021623 2:225683758-225683780 AATATAAAAGCAGCAAGGAAGGG + Intergenic
947070275 2:226280950-226280972 TCTACAAAAGCAGCCAGGAAGGG + Intergenic
948331558 2:237170799-237170821 TATAAAAAAGCAGCCAGGCATGG + Intergenic
1169178875 20:3544130-3544152 TATATAAATGCATACAAAAATGG - Intronic
1170096211 20:12648480-12648502 GATATAAAGGCTTCCACCAAAGG + Intergenic
1170250993 20:14282568-14282590 TATTTAAAGCAATCCAAGAATGG - Intronic
1172221197 20:33276227-33276249 TAGATAAAGGAAGACAGGAAGGG - Intronic
1173566643 20:44043859-44043881 CATATATAGGCAAACAGGAATGG + Intronic
1174009831 20:47440736-47440758 TAAAAAAACCCATCCAGGAATGG + Intergenic
1175702056 20:61146739-61146761 TAAATAAAGGTATCCTGGAAAGG - Intergenic
1176920394 21:14680839-14680861 TATATAATAGCACTCAGGAAAGG + Intergenic
1177292744 21:19136283-19136305 TTTATAAAGTCATTCAGCAAAGG - Intergenic
1178897091 21:36568031-36568053 TAGAGAAAGGCAACCGGGAATGG + Intronic
1182180770 22:28346049-28346071 TTTAAAAAAGCATCCAGGATAGG - Intronic
1183805089 22:40202463-40202485 TATATAAACGCATGTAGGACAGG + Intronic
1183966163 22:41444244-41444266 TATTGAAAGGCTTCCAGGACTGG + Intronic
1185045838 22:48528365-48528387 TATACACAGGCATCGGGGAATGG - Intronic
950193077 3:10991736-10991758 TTTATAAAGGCTTCTGGGAATGG - Intergenic
950963405 3:17129010-17129032 TCCATGAAGGCATCCAGGAGTGG + Intergenic
951133595 3:19077024-19077046 TATACAAAGGCTCCCATGAACGG - Intergenic
951429537 3:22590123-22590145 CCTCTAAAGGCACCCAGGAAGGG + Intergenic
952023355 3:29049676-29049698 TAAATACAGGAACCCAGGAAAGG + Intergenic
952152553 3:30607867-30607889 TATATATATGCATGCAGGAATGG + Intronic
952286457 3:31974028-31974050 TGTATACAGGCATCCAGCAAAGG + Intronic
953322970 3:41988713-41988735 TATATCAATGCAGCCAGGAGCGG - Intergenic
955010252 3:55006916-55006938 TATCTAAAGGCAACCACAAAAGG + Intronic
955065659 3:55531743-55531765 TCGACAAAGGCAGCCAGGAAGGG - Intronic
955334529 3:58074098-58074120 GATATAAAGGCTTTCAGTAAAGG + Intronic
956040038 3:65136029-65136051 TATACAAGGTCATCCAGGATGGG - Intergenic
957035740 3:75290786-75290808 TATATAAAATCAGCCAGGTATGG - Intergenic
959461570 3:106632064-106632086 TATGTAAAGGCATAGAGGTAAGG - Intergenic
961194109 3:124986961-124986983 TCTATAAAGGGCTGCAGGAAAGG - Intronic
963029577 3:140955225-140955247 TATATAAAGGAAAGCAGGCATGG - Intronic
964516459 3:157514414-157514436 GATATAAAGGAATATAGGAATGG - Intronic
964611539 3:158621131-158621153 TAAAAAAAGGCAGCCAGGCAGGG - Intergenic
967233818 3:187366090-187366112 TAGACACAGGTATCCAGGAAGGG + Intergenic
967813379 3:193779411-193779433 TCCCTAAAGGCTTCCAGGAAAGG + Intergenic
968315665 3:197722613-197722635 TATATACAGGCATCCAACATGGG + Intronic
969185382 4:5470565-5470587 CATATAAAGGTGTCCAGGAGAGG + Intronic
970723161 4:19011140-19011162 TATTTAAAGGCATCCTGGAAAGG + Intergenic
973116699 4:46469255-46469277 AATCTATAGACATCCAGGAATGG - Intronic
975397335 4:73891911-73891933 TATATAAAGGGAACCAGGCCAGG - Intergenic
976204824 4:82614793-82614815 TATAGAAATGCATCCTGCAAGGG - Intergenic
976884986 4:89971024-89971046 TTTATAATGTCATCCAGGCAAGG + Intergenic
976978772 4:91197363-91197385 TACAGAAAGGCATTCTGGAACGG + Intronic
979284653 4:118908978-118909000 AACATAAAGGCATAGAGGAATGG + Intronic
983007263 4:162499290-162499312 TATATAAAGTAATGTAGGAAAGG - Intergenic
984574271 4:181428954-181428976 AAAATGAGGGCATCCAGGAAGGG + Intergenic
986944702 5:13001717-13001739 TCTATAAAAGCATCTAGGAGTGG + Intergenic
987198081 5:15547522-15547544 TAGAGAGAGGCAGCCAGGAATGG + Intronic
987887900 5:23834245-23834267 AATATAAAGACATCCAATAAAGG + Intergenic
990796164 5:59543546-59543568 GATATAAAGGAATCCAGGACAGG + Intronic
991339418 5:65591629-65591651 TATATAAAGGAATCTTGGATTGG - Exonic
993016614 5:82541837-82541859 TATATAAAATCATCCAGAAATGG + Intergenic
994797239 5:104319036-104319058 TATTTAATGGTATCCAGTAATGG + Intergenic
994889660 5:105616335-105616357 TATATAAAAAAATCCAGGTATGG + Intergenic
995288638 5:110422640-110422662 CATATAAAAGCAGCCAAGAAGGG + Intronic
999340175 5:150763363-150763385 AAAATAAAAACATCCAGGAAAGG + Intergenic
999814659 5:155163741-155163763 TATTTAAAATCATTCAGGAAGGG - Intergenic
1006247630 6:32753467-32753489 TATATTTTGGTATCCAGGAAGGG - Intergenic
1006878646 6:37320153-37320175 GATATAAAGGGAGCCAGTAAGGG + Intronic
1008196801 6:48534310-48534332 TATAAAAAAACATCAAGGAAAGG - Intergenic
1008750100 6:54722583-54722605 TCTATAAAGGAATGCAGGAAAGG + Intergenic
1010598460 6:77794127-77794149 TAAATAAAGGAATGCAGGAGTGG + Intronic
1010816395 6:80362546-80362568 TAGATAAGGGCAACCAAGAATGG + Intergenic
1011286439 6:85729457-85729479 TAAATTAAGTCATTCAGGAAAGG - Intergenic
1013429527 6:110043321-110043343 TATAGAAAGTTATCCAGGAAGGG + Intergenic
1013870703 6:114755800-114755822 TAAAGAAAGGCATGCAGCAATGG + Intergenic
1015438437 6:133218386-133218408 AATGAAAAGGCATCCATGAATGG - Intergenic
1016291354 6:142531590-142531612 GATAAAAAGGCTTTCAGGAATGG - Intergenic
1017866859 6:158451445-158451467 TCTATCTAGGCATCTAGGAAGGG + Intronic
1017982404 6:159412144-159412166 TAGATATAGGCATGCAGGTATGG - Intergenic
1018404575 6:163465336-163465358 GAAATAAAGGCAGCCAGGAGTGG + Intronic
1021531308 7:21648886-21648908 AATATCAAGGTATTCAGGAAGGG - Intronic
1021607073 7:22418879-22418901 GAAAGAAAGGCAGCCAGGAAAGG - Intergenic
1022966282 7:35475645-35475667 GATATAAAGATATCCAGTAAAGG + Intergenic
1023290311 7:38661146-38661168 TTTCTAAAGCAATCCAGGAAAGG + Intergenic
1023310379 7:38880450-38880472 TCTTTACAGGCATCCAGGAGAGG - Intronic
1026047110 7:66913687-66913709 TATATAAAATCATCCAGAAAAGG - Intergenic
1026366183 7:69650730-69650752 TTTAAAAAGGCAAACAGGAATGG - Intronic
1026637646 7:72098195-72098217 CCAAAAAAGGCATCCAGGAAAGG + Intronic
1027702008 7:81480895-81480917 TATATATATGCATCCAGTACAGG + Intergenic
1027846489 7:83384047-83384069 TATAGAAATGCAATCAGGAAAGG - Intronic
1032647095 7:133836838-133836860 TATCTAAATGAAACCAGGAAGGG - Intronic
1033035067 7:137867564-137867586 TGTAATCAGGCATCCAGGAAAGG + Intergenic
1033456146 7:141505739-141505761 TGGATAAAGGGATTCAGGAAAGG + Intergenic
1036528053 8:9553997-9554019 TAAATAATGGCCTCCTGGAATGG - Intergenic
1037742053 8:21615990-21616012 CATTTAAAGGCAACCACGAAAGG + Intergenic
1038047462 8:23777894-23777916 TATATAAAGACAGACAGGGAGGG + Intergenic
1038942366 8:32319307-32319329 TACTTAAAGTCATGCAGGAAAGG - Intronic
1039080020 8:33724844-33724866 TTTACCAAGGCATCCAGCAAGGG - Intergenic
1041536721 8:58934608-58934630 TAAATAAAGACACCCAGTAAAGG + Intronic
1042041481 8:64595779-64595801 TATATGAAAGCATTTAGGAAAGG + Intronic
1043219590 8:77643016-77643038 TATATAAGGGAAGCCAGGCATGG + Intergenic
1044262538 8:90143947-90143969 TATATAAATGCAAGCATGAATGG - Intergenic
1044800840 8:95953537-95953559 AACCTAAAGGCATGCAGGAAGGG - Intergenic
1045748873 8:105457948-105457970 TATATAAAGGCAACAATAAAAGG + Intronic
1046334335 8:112764934-112764956 TATATAAAGCAAGCAAGGAAGGG + Intronic
1047876437 8:129143112-129143134 TAAATAAAGGCCACCAAGAAGGG - Intergenic
1050552616 9:6760988-6761010 AAAAAAAAGACATCCAGGAAAGG - Intronic
1052763971 9:32621587-32621609 TATATACAGGTGTCCTGGAATGG - Intergenic
1053677275 9:40446020-40446042 CCTGTAAAGGCATCCATGAAAGG - Intergenic
1053927032 9:43072176-43072198 CCTGTAAAGGCATCCATGAAAGG - Intergenic
1054286444 9:63178901-63178923 CCTGTAAAGGCATCCATGAACGG + Intergenic
1054290348 9:63281547-63281569 CCTGTAAAGGCATCCATGAAAGG - Intergenic
1054507347 9:65930275-65930297 CCTGTAAAGGCATCCATGAAAGG + Intergenic
1054982876 9:71226696-71226718 TATATATATGCATCCAACAATGG + Intronic
1055306210 9:74931528-74931550 TATATAGATGCATAGAGGAAAGG - Intergenic
1055428086 9:76216284-76216306 GATATCAAGGCATTCAGGAAAGG + Intronic
1056151094 9:83789564-83789586 TATTTAAAGGAATCGAGGAAGGG - Intronic
1056665385 9:88577241-88577263 TAGAAATAAGCATCCAGGAAAGG - Intronic
1057284742 9:93742933-93742955 TGGATCAAGGCATACAGGAAGGG + Intergenic
1058167502 9:101636630-101636652 TATATAACTGCCTCCAGGAAAGG + Intronic
1061707778 9:132466318-132466340 TGTCTAAAGGCATCCCGGGATGG - Intronic
1186387516 X:9125101-9125123 TATATATAATCACCCAGGAATGG + Intronic
1190037691 X:47040972-47040994 TAAATAAAATCATCCAAGAAAGG - Intronic
1190969398 X:55334200-55334222 TCTATACAGAGATCCAGGAAGGG + Intergenic
1193167501 X:78298553-78298575 TATATATATGCATCCAACAAGGG - Intronic
1194272667 X:91837199-91837221 TTTATAAATTCATTCAGGAATGG + Intronic
1194418485 X:93642937-93642959 AATATAAATACACCCAGGAATGG - Intergenic
1196947571 X:120843037-120843059 TATATAAAAACAGCCAGGAATGG - Intergenic
1197095230 X:122586415-122586437 TATATAAATGCATTTGGGAAGGG + Intergenic
1197687019 X:129451613-129451635 TACAGAAAGACATCAAGGAATGG + Intronic
1199922705 X:152426092-152426114 TATTTAATGCCATCCAAGAAAGG + Intronic
1200278394 X:154756023-154756045 TATAAAAAGACAGCCAGGCATGG + Intergenic
1200589911 Y:5058616-5058638 TTTATAAATTCATTCAGGAATGG + Intronic
1201330813 Y:12818887-12818909 TATATAAAAGCAGCCAGGCACGG + Intronic
1201332791 Y:12845492-12845514 TATATAAAGAAATCCAGTAGTGG + Intronic
1201910268 Y:19126713-19126735 CATATAAAAGCTTTCAGGAAGGG - Intergenic