ID: 905938893

View in Genome Browser
Species Human (GRCh38)
Location 1:41847015-41847037
Sequence ATATAAAGGCATCCAGGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 309}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905938881_905938893 25 Left 905938881 1:41846967-41846989 CCCTGTTCCAGGCAAGGCAACGG 0: 1
1: 0
2: 0
3: 13
4: 204
Right 905938893 1:41847015-41847037 ATATAAAGGCATCCAGGAAAGGG 0: 1
1: 0
2: 1
3: 32
4: 309
905938884_905938893 18 Left 905938884 1:41846974-41846996 CCAGGCAAGGCAACGGAAGCCAG 0: 1
1: 0
2: 3
3: 20
4: 266
Right 905938893 1:41847015-41847037 ATATAAAGGCATCCAGGAAAGGG 0: 1
1: 0
2: 1
3: 32
4: 309
905938886_905938893 -1 Left 905938886 1:41846993-41847015 CCAGAGCCACCCAAGTGTGGCTA 0: 1
1: 0
2: 0
3: 10
4: 133
Right 905938893 1:41847015-41847037 ATATAAAGGCATCCAGGAAAGGG 0: 1
1: 0
2: 1
3: 32
4: 309
905938889_905938893 -10 Left 905938889 1:41847002-41847024 CCCAAGTGTGGCTATATAAAGGC 0: 1
1: 0
2: 1
3: 5
4: 93
Right 905938893 1:41847015-41847037 ATATAAAGGCATCCAGGAAAGGG 0: 1
1: 0
2: 1
3: 32
4: 309
905938887_905938893 -7 Left 905938887 1:41846999-41847021 CCACCCAAGTGTGGCTATATAAA 0: 1
1: 0
2: 0
3: 9
4: 135
Right 905938893 1:41847015-41847037 ATATAAAGGCATCCAGGAAAGGG 0: 1
1: 0
2: 1
3: 32
4: 309
905938883_905938893 24 Left 905938883 1:41846968-41846990 CCTGTTCCAGGCAAGGCAACGGA 0: 1
1: 0
2: 0
3: 8
4: 144
Right 905938893 1:41847015-41847037 ATATAAAGGCATCCAGGAAAGGG 0: 1
1: 0
2: 1
3: 32
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905938893 Original CRISPR ATATAAAGGCATCCAGGAAA GGG Intronic
900889632 1:5440353-5440375 ATATAAAGGAATAGAGCAAAGGG + Intergenic
901305891 1:8232455-8232477 ATTTCAAGGCTTCCAGGAAATGG + Intergenic
901732460 1:11290153-11290175 AAATAAAGGCAGCCAGGCACGGG - Intronic
905014102 1:34765294-34765316 ACATCCAGGCATCCAGAAAAAGG + Intronic
905938893 1:41847015-41847037 ATATAAAGGCATCCAGGAAAGGG + Intronic
906695797 1:47822764-47822786 ATGTAAAGGCATCTTGGGAAAGG - Intronic
906865197 1:49410713-49410735 AGACAAATGGATCCAGGAAAAGG - Intronic
907579473 1:55558654-55558676 AGATGCAGGCATCCAGGAGAAGG - Intergenic
907746420 1:57218195-57218217 ATGCAAAGGCACCGAGGAAAGGG + Intronic
908466841 1:64404514-64404536 AAATAATGGCATCCACCAAAAGG - Intergenic
908607557 1:65815812-65815834 ATATAAAAGCAATCAGTAAAAGG + Intronic
908772239 1:67607727-67607749 GTATGTAGGCATCCAGGAGATGG + Intergenic
908967267 1:69780901-69780923 ATATAAAGCTTTTCAGGAAAAGG + Intronic
911826647 1:102495234-102495256 AGATAAATGTATCCAAGAAAGGG - Intergenic
912495110 1:110086492-110086514 ATAGAAGGGGATCCAGGAAAAGG - Intergenic
912598164 1:110900303-110900325 ATTTAAAGACATCCAAGAAAGGG + Intergenic
912647335 1:111406208-111406230 ATCTAAAGGCATCACTGAAAGGG + Intergenic
912749118 1:112270831-112270853 AAATAAATGCATACAGGTAAGGG + Intergenic
912860993 1:113213783-113213805 ATTTAAAAGGATACAGGAAAAGG + Intergenic
913121666 1:115747912-115747934 ATAAAATGGCATGCAGAAAAAGG - Intronic
913722293 1:121609623-121609645 ATATAAAGACATCAAGATAAAGG + Intergenic
913742053 1:121856881-121856903 ATATAAAGACATCAAGATAAAGG + Intergenic
913758367 1:122102788-122102810 ATATAAAGACATCAAGATAAAGG + Intergenic
915385750 1:155490314-155490336 ATATAAAGACATCCAGGGTTGGG + Intronic
916115828 1:161484401-161484423 ATATAATGGTATACAGAAAAAGG + Intergenic
917380964 1:174407648-174407670 AGATAAATGAATCCAGCAAAAGG - Intronic
917765313 1:178209871-178209893 ATAAAAAGAAATCCAGGAAATGG - Intronic
917893479 1:179463067-179463089 AAATAAATGAATCCAGGAACTGG - Intronic
918525347 1:185458405-185458427 ATTTAAAGACATCTAGGAAAAGG + Intergenic
919387371 1:196938910-196938932 AAATCAAGGAATCCAGGAACTGG - Intronic
919627823 1:199929423-199929445 ATATAATGGCATTGAGGAGAAGG - Intergenic
920731919 1:208495736-208495758 TTTTAAAGCAATCCAGGAAATGG - Intergenic
921729291 1:218559189-218559211 ATATAACAGCATTCAGTAAATGG + Intergenic
921981567 1:221264182-221264204 AAAAAGAGGCCTCCAGGAAATGG - Intergenic
922452107 1:225745790-225745812 ATATAAAAGCAGCCAGGTGAAGG - Intergenic
1066439271 10:35422523-35422545 ACATAAAGGCAATCAGAAAATGG + Intronic
1068879985 10:62037711-62037733 ATATAAAGACATGAAAGAAAGGG + Intronic
1068944139 10:62711649-62711671 AAATAAAGGCAACCATGGAATGG + Intergenic
1071984075 10:91033277-91033299 ATAGAAAGGGATCTGGGAAAAGG + Intergenic
1072429508 10:95358303-95358325 ATATAAAATCATCAATGAAAGGG + Intronic
1076018816 10:127053135-127053157 ATATAAAGATATCCTGAAAAGGG - Intronic
1078680739 11:13473370-13473392 GTATATAGGAATGCAGGAAAAGG - Intergenic
1079072233 11:17357169-17357191 GTTTAAAGGCATCCAGTCAATGG - Intronic
1079074321 11:17374256-17374278 GTATAAAGGTATACAGAAAAAGG - Exonic
1079891876 11:26066207-26066229 ATATAGAGGCTTCCTGGAAAAGG + Intergenic
1079939077 11:26655337-26655359 AAATGAATGCCTCCAGGAAAGGG + Intronic
1081406150 11:42700913-42700935 ACATAAAACCATACAGGAAAGGG - Intergenic
1082633556 11:55568421-55568443 ACATAAAAGCAACCAGGAAATGG - Intergenic
1083329028 11:61888594-61888616 AAATAAGGTCACCCAGGAAAGGG + Intronic
1083498880 11:63084593-63084615 ACATAAAGGCACCCAGGGAAAGG + Intronic
1085763873 11:79265208-79265230 ATATAAAGTCAAACAAGAAATGG - Intronic
1085827962 11:79867889-79867911 AAATCAATGAATCCAGGAAATGG + Intergenic
1086492448 11:87369222-87369244 ATTTAAAGGGATGCTGGAAATGG - Intergenic
1086802845 11:91198961-91198983 ATATAAATGTATCTATGAAATGG - Intergenic
1087297320 11:96391486-96391508 ATCTAAAGGCTTGCAGGAAAAGG + Exonic
1087418380 11:97888018-97888040 AAGTAAAGGCAGACAGGAAAGGG - Intergenic
1088299798 11:108344846-108344868 ATAAAAAGTCAGCCAGGTAATGG + Intronic
1088611804 11:111584705-111584727 ATATGAATGCATCATGGAAAAGG + Intergenic
1089824358 11:121260940-121260962 ATACAAAGTCTTCCAGTAAAGGG - Intergenic
1090295063 11:125580213-125580235 ATCTAAAGAAATCCAGAAAATGG + Intronic
1090856099 11:130610437-130610459 ATCTAAAGAAATCCAGGCAAAGG - Intergenic
1090944984 11:131421506-131421528 CCAGAAAGGCATCCAGGAACAGG + Intronic
1092693924 12:11147678-11147700 ATATAAACTCATCTAGGAACTGG - Intronic
1093024970 12:14237151-14237173 CCATAAATGCATCCAGTAAATGG - Intergenic
1093139908 12:15497396-15497418 ATATAAAGGTAAGCAGCAAAAGG + Exonic
1093175592 12:15910415-15910437 ATAGAAAGGCATCCTGGTATAGG - Intergenic
1093212610 12:16325963-16325985 ATAAAAAGGTATCCAGAAAAAGG - Intergenic
1093588041 12:20866253-20866275 ATATAAATGCATCCAGTACAAGG + Intronic
1093601235 12:21026712-21026734 ATATAAATGTATCCAGTAGAAGG + Intronic
1093709297 12:22311607-22311629 ATATAAAGGCTTCAATGAAATGG + Intronic
1095410598 12:41916977-41916999 ATATATAGTCTTTCAGGAAAAGG - Intergenic
1097019561 12:56010304-56010326 AGACAAAGGCATCTAAGAAAGGG + Intronic
1097130172 12:56805666-56805688 ATATAAGGGTCTCCAGTAAAAGG + Intergenic
1097666867 12:62488352-62488374 ATATAAAAGTATCAAGTAAAGGG + Intronic
1099282522 12:80669551-80669573 ATATACAGGTATCCTTGAAAGGG - Intronic
1101477750 12:105066579-105066601 ATATGAAGGTATCCAGAAAAAGG - Exonic
1102326478 12:111989355-111989377 GAAGAAAGGCAGCCAGGAAAAGG + Intronic
1105842845 13:24270269-24270291 ATGTAAAGGCATACATGTAAAGG - Intronic
1106010112 13:25812391-25812413 AAAACAAGGAATCCAGGAAATGG - Intronic
1106661413 13:31803868-31803890 ATTTAAAGCCATAAAGGAAAGGG - Intergenic
1107741495 13:43455030-43455052 AAATCATGGGATCCAGGAAATGG - Intronic
1107860765 13:44659001-44659023 ATATGCAGGCAAGCAGGAAAAGG + Intergenic
1108326454 13:49337065-49337087 ATATAAAGGAAACCAGGTCATGG + Intronic
1110757454 13:79192324-79192346 ATATAGTGGCATCAAGGTAATGG + Intergenic
1111163296 13:84422366-84422388 TTATAAAGGAATAAAGGAAAGGG - Intergenic
1111352536 13:87050205-87050227 ATATAAAGTCATACAGAGAATGG - Intergenic
1111373885 13:87353182-87353204 ATTTAAAGGCAAACAGGAATTGG + Intergenic
1112194001 13:97207071-97207093 AAATGAATGCATGCAGGAAAGGG - Intergenic
1112904060 13:104395424-104395446 ATAGAAAAGAATCCAAGAAAGGG - Intergenic
1115067326 14:29279912-29279934 ATATACAGCCATCTAGGAAGAGG - Intergenic
1116220253 14:42076133-42076155 ATATAAAGAGATACAGAAAAGGG + Intergenic
1116528379 14:45935153-45935175 TTATGAAGGCATCCAGGATGGGG + Intergenic
1117346656 14:54839665-54839687 ATGTGAAAGGATCCAGGAAAAGG + Intergenic
1117928326 14:60809597-60809619 ATATCAATACATGCAGGAAAAGG - Intronic
1118221896 14:63862153-63862175 ATGTAAGGGAAACCAGGAAATGG - Intronic
1118297418 14:64583397-64583419 ATAGAAATGCGTCCAGGAAATGG - Intronic
1119080889 14:71692601-71692623 CTATTCAGGCATTCAGGAAATGG + Intronic
1119942522 14:78656538-78656560 AAATAAAGGCCTCTATGAAATGG - Intronic
1120564117 14:86033429-86033451 AAATAAAGCCACCCAGTAAAGGG + Intergenic
1120625793 14:86824485-86824507 TTATAAAAGCATCCAGGGAAAGG + Intergenic
1120639894 14:86998031-86998053 ATATGAGGGCAGGCAGGAAATGG - Intergenic
1123133182 14:106004959-106004981 ATATTAAGTCATTAAGGAAAAGG - Intergenic
1125110929 15:36033112-36033134 ATATAAAATCATGCATGAAATGG - Intergenic
1125478930 15:40066954-40066976 CTAAAAAGGCATCCAAGACAAGG + Intergenic
1125699456 15:41668973-41668995 ATCTTAAAGCAGCCAGGAAATGG + Exonic
1126304187 15:47236268-47236290 TTATCAAGCTATCCAGGAAAGGG - Intronic
1127118603 15:55751471-55751493 AAATCAAGGCCTCCAGGACAAGG - Intergenic
1128873884 15:71186249-71186271 ATACAAAGACATGGAGGAAATGG + Intronic
1129687055 15:77692491-77692513 AAATAAAGGTAGCAAGGAAAAGG + Intronic
1130901181 15:88207855-88207877 TTTTAAAGGCAGCCAGGAAGGGG - Intronic
1131774808 15:95783223-95783245 ACAGAGAGGCACCCAGGAAAGGG - Intergenic
1133645085 16:7756469-7756491 ATTTAAAGGCTTGGAGGAAAAGG - Intergenic
1134217456 16:12327078-12327100 ATATAAAGGGACCCACGAAGAGG - Intronic
1135609982 16:23857808-23857830 CTTTGAAGACATCCAGGAAATGG - Intronic
1136255201 16:29034357-29034379 ACATAATGGCATCTAGGAACAGG + Intergenic
1137859990 16:51836958-51836980 ATGTAAAGGTATGCAGGAAATGG - Intergenic
1138032493 16:53570891-53570913 ATCTAAAGGCCTAGAGGAAATGG - Intergenic
1138732781 16:59214334-59214356 AAATAGAGGCATCTAGGATAAGG + Intergenic
1139712802 16:68789381-68789403 ATGTAAAGGGATGCAGGACAAGG + Intronic
1140669796 16:77266700-77266722 AAATAAACGCATCCAGGAGCCGG - Intronic
1141052798 16:80787242-80787264 AAATGAAGCCAGCCAGGAAATGG + Intronic
1144174743 17:12694252-12694274 ACAAAAAGGCATCCGGGAAGGGG + Intronic
1144281455 17:13730982-13731004 AAAGAAAGGAAGCCAGGAAAGGG + Intergenic
1144825199 17:18101862-18101884 GGAGCAAGGCATCCAGGAAAGGG - Intronic
1145354143 17:22122487-22122509 ATATAATGCCATCAAGTAAATGG - Intergenic
1145679455 17:26569711-26569733 ATATAAAGACATCAAGATAAAGG + Intergenic
1145681034 17:26592383-26592405 ATATAAAGACATCAAGATAAAGG + Intergenic
1147264492 17:39226331-39226353 GTATAAAGGCATCCAATTAATGG - Intergenic
1148536301 17:48441934-48441956 CTGTAAAGGGATCCTGGAAAAGG - Intergenic
1149526714 17:57361875-57361897 ATATAAAATGATCCAGGACAGGG - Intronic
1153154558 18:2133839-2133861 ATGGAAAGGGATCCAGGCAAGGG - Intergenic
1153379633 18:4423766-4423788 ATATATAGACATCCTGGGAATGG + Intronic
1153410753 18:4789781-4789803 CTACAAATGCATACAGGAAAAGG + Intergenic
1153702936 18:7714562-7714584 AAATAAATGAATCCAGGATATGG + Intronic
1153705925 18:7745736-7745758 ATATAAGGGCATCTAGAAAAAGG + Intronic
1155844279 18:30685847-30685869 ATATAAAAGCATTCAGTAATGGG - Intergenic
1155919604 18:31590162-31590184 ATAGAAGGTCATCCGGGAAACGG + Intergenic
1156231637 18:35158855-35158877 AAATCAAAGCACCCAGGAAAGGG - Intergenic
1156537042 18:37874085-37874107 ATAAAAAGGCAGCCAGGCACGGG - Intergenic
1157589287 18:48826621-48826643 ATTTAAAAGCAACCAAGAAAGGG - Intronic
1157651573 18:49337885-49337907 ATACAAAGGCAGCCACAAAAAGG + Intronic
1158653110 18:59305299-59305321 ATATCATGGCATACAGGACAAGG + Intronic
1160113005 18:76051501-76051523 ATATAAATACATGCATGAAATGG - Intergenic
1160570830 18:79816474-79816496 TCATCAAGGCATACAGGAAAGGG - Intergenic
1161168267 19:2800150-2800172 AAATAAAGGCAGGCAGGAAGTGG - Intronic
1162434025 19:10645963-10645985 AAACAAAGGCATCGAGGAAGGGG - Intergenic
1162885771 19:13695928-13695950 AAAGAAAGGCAGACAGGAAAAGG + Intergenic
1164458353 19:28427311-28427333 ATATAAAGGCATGGAGGACAGGG - Intergenic
1167683205 19:50938553-50938575 ATATCAAGAAATCCAGGTAAGGG - Intergenic
1168598691 19:57700572-57700594 ATATCAAGGCATACAGGACCTGG + Exonic
928898043 2:36287378-36287400 ATATAAAGGTATCCTGAATAAGG + Intergenic
928915557 2:36466296-36466318 AAATACAAGCATACAGGAAAGGG + Intronic
929271802 2:39981012-39981034 AGAGAAAGGAATCCAAGAAAGGG - Intergenic
929463527 2:42124152-42124174 AGATACAGGAATACAGGAAATGG - Intergenic
929538379 2:42799926-42799948 ATAAAAAAGAAACCAGGAAAAGG - Intergenic
930249753 2:49022079-49022101 AGAATAAGGCATGCAGGAAAAGG + Intronic
930788254 2:55294829-55294851 TTTTAAAGGCATGCAGAAAATGG + Intronic
932652567 2:73574722-73574744 AGATAAATGGATCCAGGAGAGGG + Intronic
932657702 2:73624729-73624751 AAAGAAAGGCTTCCAGGGAAAGG + Intergenic
932657796 2:73625584-73625606 ATGTAAGGGCTTCCAGGGAACGG - Intergenic
932664378 2:73685013-73685035 AAAGAAAGGCTTCCAGGGAAAGG + Intergenic
932664477 2:73685872-73685894 ATGTAAGGGCTTCCAGGGAATGG - Intergenic
933292420 2:80452702-80452724 ATAAAAAGAAATCTAGGAAAGGG + Intronic
935353247 2:102174011-102174033 ATGTAAAAGCATCCAGAAAAGGG - Intronic
936244445 2:110814352-110814374 ATAAAAAGTCATCAATGAAAAGG - Intronic
937260400 2:120582231-120582253 ACATAAAAGCATCCAATAAAGGG - Intergenic
939302842 2:140368775-140368797 ATTTTAAGGCATTGAGGAAATGG - Intronic
940176383 2:150881813-150881835 AGATAAAGACATACAGGAATTGG - Intergenic
941363396 2:164580893-164580915 ATATAAAGATATCCAGCACAGGG - Intronic
941864862 2:170324237-170324259 AGAAAAAGGGATCCAGCAAAGGG - Intronic
942490470 2:176484728-176484750 ATATCAAGACACCTAGGAAAAGG + Intergenic
944164800 2:196707456-196707478 AAATCAAGGAATCCAGGAGACGG - Intronic
944734891 2:202553591-202553613 TCAGAAAGGCATCCAGGAAAGGG + Intronic
947021624 2:225683759-225683781 ATATAAAAGCAGCAAGGAAGGGG + Intergenic
947440321 2:230115036-230115058 ATATAAATGAATCCAGGAGCCGG - Intergenic
1169608853 20:7355741-7355763 CTATAAAGGCATATATGAAATGG - Intergenic
1169828947 20:9801833-9801855 ATATAAAAGTAACTAGGAAAAGG + Intronic
1170311164 20:14993454-14993476 ATATAAAGACACACAGAAAATGG - Intronic
1170721430 20:18883233-18883255 ATATAAAAGCAGAGAGGAAAAGG - Intergenic
1171181947 20:23097599-23097621 AAATAAAAGCATCAAGGATATGG + Intergenic
1171433003 20:25097776-25097798 ATATAAACAAATCCAGGCAATGG + Intergenic
1171564405 20:26166621-26166643 ATATAATGCCATCAAGTAAATGG - Intergenic
1172048793 20:32100583-32100605 ATATAGAGACATCCAAGTAAAGG + Intronic
1173068096 20:39733884-39733906 CTGTAAAGGGATCAAGGAAAAGG + Intergenic
1175378023 20:58542655-58542677 ACATGAAGGCACCCTGGAAAGGG - Intergenic
1175473070 20:59247169-59247191 TTAGAAAGCCATCCAGGACAGGG + Intronic
1175544003 20:59766381-59766403 ATGGAAAGGAATCCAGGCAAAGG + Intronic
1177896429 21:26859586-26859608 ATATACAGGGATGCAGAAAAAGG - Intergenic
1179067288 21:38037470-38037492 AAAGGAAGGCAGCCAGGAAAGGG - Intronic
1180579681 22:16820471-16820493 ATATGAAGGAATCCAGCAAAAGG - Intronic
1182180769 22:28346048-28346070 TTAAAAAAGCATCCAGGATAGGG - Intronic
1182495847 22:30706909-30706931 ACAAAAAGGCATCCAGAAGAAGG - Intronic
1182905083 22:33929040-33929062 CTATAATTGCATCCAGGAATAGG - Intergenic
949266288 3:2160400-2160422 ATATAAGGCCATCCAGGACATGG - Intronic
950963677 3:17131144-17131166 GTTTAAAGGCAGCCAGGCAAGGG + Intergenic
952136378 3:30426672-30426694 GTCTAAGGGCATCCAGCAAATGG - Intergenic
952152554 3:30607868-30607890 ATATATATGCATGCAGGAATGGG + Intronic
952196062 3:31076352-31076374 ACCTAAAGCCATCCATGAAATGG + Intergenic
952286458 3:31974029-31974051 GTATACAGGCATCCAGCAAAGGG + Intronic
953234878 3:41097427-41097449 ATATAAAGGCCTTCAAAAAAAGG + Intergenic
953870462 3:46621917-46621939 ATAGAAAGGAATACAGAAAAGGG - Intronic
954641822 3:52105065-52105087 AAACAAAAGCATCCAGGAACTGG + Intronic
956413584 3:69003839-69003861 ATGTAAAAGCATACAGAAAAAGG - Intronic
957219452 3:77363325-77363347 ATATACAGGCCACCAGGAAATGG - Intronic
959461569 3:106632063-106632085 ATGTAAAGGCATAGAGGTAAGGG - Intergenic
959479270 3:106851749-106851771 ATATAAAGTCTTCCAGATAATGG + Intergenic
961194108 3:124986960-124986982 CTATAAAGGGCTGCAGGAAAGGG - Intronic
964939471 3:162138188-162138210 ATTTAAGGGAGTCCAGGAAATGG + Intergenic
965077772 3:164001818-164001840 AAATAAAGGAATCCAGGACCTGG - Intergenic
965241052 3:166198178-166198200 TTATAAAAGAATCCAGCAAATGG - Intergenic
965768449 3:172155599-172155621 AGAAAATGGCTTCCAGGAAAGGG - Intronic
966538635 3:181063965-181063987 GTAAAAAGGAATCAAGGAAATGG - Intergenic
967093097 3:186152094-186152116 AAATAAAGGGCTCCAGGAAATGG + Intronic
969185383 4:5470566-5470588 ATATAAAGGTGTCCAGGAGAGGG + Intronic
970723162 4:19011141-19011163 ATTTAAAGGCATCCTGGAAAGGG + Intergenic
971147895 4:23999153-23999175 TTATAAAGGCACTCAGGAAGAGG - Intergenic
971484590 4:27146350-27146372 ATAGGAAGGGATCCAGGCAATGG + Intergenic
971742476 4:30538249-30538271 ATACAAAGGTATTCTGGAAATGG + Intergenic
971986692 4:33834660-33834682 ATATAATGCCATCAAGTAAATGG + Intergenic
972231518 4:37078024-37078046 CTATAAAGACAACAAGGAAAAGG - Intergenic
972664775 4:41154403-41154425 ATGGAAACGCAACCAGGAAATGG - Intronic
974469964 4:62306266-62306288 ATAAAAAGCCTTCCAGCAAAAGG + Intergenic
976116846 4:81736828-81736850 ATATAAAAGCATCCATCACAAGG + Intronic
976294814 4:83459761-83459783 CCATAAATGCATCCAGTAAATGG - Exonic
977743321 4:100513998-100514020 ATATACGGGCATCCAGAAGAAGG + Intronic
978855716 4:113392152-113392174 ATAAAAAGGCATGAAGTAAAAGG - Intergenic
980644599 4:135626867-135626889 ATATCAATGAATCCAGGAACTGG - Intergenic
981323404 4:143418338-143418360 CTATAAATGCAAACAGGAAAGGG - Intronic
981409716 4:144415263-144415285 GTATAAAACCATGCAGGAAATGG + Intergenic
982021203 4:151206742-151206764 ATACAAAGGTATCCTGGGAATGG + Intronic
982147530 4:152412647-152412669 ATATAAAGGAATCTATGAGATGG + Intronic
982894343 4:160898682-160898704 ATACAAAGAAATCCAGAAAAAGG + Intergenic
983601000 4:169527718-169527740 ATCTAAAGGCAGCAGGGAAATGG + Intronic
985280251 4:188279304-188279326 ATGAGAAGGCATCCAGGAGAGGG + Intergenic
985570525 5:642350-642372 ATATAGAGGCTTCCAGAGAAGGG - Intronic
987896696 5:23955389-23955411 ATCTAAAGCCATCCAGGAGCAGG + Intronic
987910108 5:24131966-24131988 ATATATAGGCATTCAGGCTAAGG - Intronic
987998387 5:25315640-25315662 ATATAAAGTAACCCATGAAATGG + Intergenic
988998581 5:36738101-36738123 ATCTCAAGGCAACCAGGAAGAGG - Intergenic
990147859 5:52783152-52783174 AAATAAATGCATCAAGGGAAGGG - Intergenic
990488096 5:56278727-56278749 AATGAAAAGCATCCAGGAAAGGG + Intergenic
990597547 5:57326585-57326607 ATGAAAAGGCACGCAGGAAAGGG - Intergenic
992084767 5:73268460-73268482 AAATAAAGGCATACTGGCAAAGG + Intergenic
992774054 5:80074456-80074478 TTACAAAGGCAGCCAGGACAAGG + Intronic
993016615 5:82541838-82541860 ATATAAAATCATCCAGAAATGGG + Intergenic
993026692 5:82655115-82655137 AGATCAAGGCATACAGAAAAGGG - Intergenic
993045313 5:82859758-82859780 ATATAAAACCATTCAAGAAACGG - Intergenic
993208165 5:84912044-84912066 ATATAAAAGCATATAAGAAATGG + Intergenic
993337443 5:86678515-86678537 AAATAAAGTTATCCAGGGAAAGG + Intergenic
993362483 5:86995020-86995042 AGATCAATGAATCCAGGAAATGG - Intergenic
994634885 5:102332449-102332471 ATATAAAGGAATCCATGACAAGG - Intergenic
995288639 5:110422641-110422663 ATATAAAAGCAGCCAAGAAGGGG + Intronic
995320646 5:110830189-110830211 ATCTAAGGGTCTCCAGGAAAAGG - Intergenic
995510542 5:112904981-112905003 ATATGAAAGAAGCCAGGAAAAGG + Intronic
996020124 5:118581630-118581652 ATATAAAGGGACTCGGGAAAGGG - Intergenic
996323789 5:122249743-122249765 ATATCAGTGAATCCAGGAAATGG - Intergenic
996514674 5:124356733-124356755 ATATAAACACATCCTGCAAATGG + Intergenic
998726693 5:145025629-145025651 ATATGAATGCTCCCAGGAAATGG + Intergenic
1000587673 5:163120521-163120543 ATATATATGCATCCAAGACAGGG - Intergenic
1000700692 5:164445389-164445411 ATAAAAAGGCTTCTAGGAGAAGG - Intergenic
1000913225 5:167047251-167047273 CTGAAAAGGAATCCAGGAAAGGG - Intergenic
1005400050 6:25422826-25422848 ATATAAAGTCATCCAGCAGAAGG - Intronic
1005728575 6:28673554-28673576 CTATGAATGCATCCAGGAAGAGG - Intergenic
1006466525 6:34197836-34197858 AGATAAAGCGATCCAGGAGAGGG + Intergenic
1006878647 6:37320154-37320176 ATATAAAGGGAGCCAGTAAGGGG + Intronic
1007786562 6:44283396-44283418 AGATAAAGGAATGAAGGAAAGGG + Intronic
1008593166 6:53013883-53013905 ACAGAAAGGCATCCTGGAAAAGG - Exonic
1009550817 6:65089285-65089307 CTATGAAAGCATCCAGGAGAGGG + Intronic
1011104966 6:83769264-83769286 ATATAGAGGCATGGTGGAAATGG + Intergenic
1012409468 6:98939593-98939615 AGATAAACGAATCCAGCAAAAGG - Intronic
1013464105 6:110401624-110401646 ATATAAATACATATAGGAAAAGG + Intronic
1015584612 6:134762677-134762699 ATATAAAGGCCAGCAGGAAATGG - Intergenic
1015953500 6:138577141-138577163 ATATACTGGCATCCTGAAAAAGG + Intronic
1016291353 6:142531589-142531611 ATAAAAAGGCTTTCAGGAATGGG - Intergenic
1017249755 6:152266707-152266729 ATAGGAAGGCATTCAAGAAAAGG - Intronic
1020084118 7:5301480-5301502 AGGGAAAGGCATCCAGGAAGAGG + Intronic
1020655081 7:10919345-10919367 AAATAAATGTTTCCAGGAAAAGG - Intergenic
1020927940 7:14356224-14356246 AAATAAATGAATCCAGGAACTGG - Intronic
1021178095 7:17473981-17474003 AGATAAAGCCAACCAGGCAAAGG + Intergenic
1021306787 7:19041519-19041541 GTGTAGAGGGATCCAGGAAAAGG - Intronic
1022235719 7:28458546-28458568 AAATATAGGCAGGCAGGAAAGGG + Intronic
1023621063 7:42073541-42073563 ATATTAAGGCATCAACGATATGG - Intronic
1025210165 7:57015716-57015738 AGGGAAAGGCATCCAGGAAGAGG - Intergenic
1025661786 7:63561135-63561157 AGGGAAAGGCATCCAGGAAGAGG + Intergenic
1026047109 7:66913686-66913708 ATATAAAATCATCCAGAAAAGGG - Intergenic
1027806314 7:82829055-82829077 ATTTCTAGGCATCCAGGATATGG - Intronic
1028409828 7:90517696-90517718 ATGAAAAGGCAGCAAGGAAAAGG + Intronic
1028442808 7:90883140-90883162 AAATAAATGAATCCAGGAACTGG + Intronic
1030852961 7:114513859-114513881 AACAAAAGGCATACAGGAAATGG + Intronic
1031252799 7:119409990-119410012 ACATAAAGGAATCCATAAAATGG + Intergenic
1031595766 7:123647864-123647886 TAAGAAAGGCATCCATGAAAGGG + Intergenic
1033026605 7:137780480-137780502 ATCTAAGGGCACCCTGGAAAAGG + Intronic
1033456147 7:141505740-141505762 GGATAAAGGGATTCAGGAAAGGG + Intergenic
1033488503 7:141816144-141816166 ATTCAAAGGCAGGCAGGAAAGGG - Intergenic
1035308117 7:157946417-157946439 AAAAATAGGCATCCATGAAATGG - Intronic
1039949867 8:42161633-42161655 AAATAAAAGGATCCAGGTAATGG + Intronic
1040988735 8:53326172-53326194 ATAAAAAGGCATTTATGAAAAGG + Intergenic
1041536722 8:58934609-58934631 AAATAAAGACACCCAGTAAAGGG + Intronic
1042041482 8:64595780-64595802 ATATGAAAGCATTTAGGAAAGGG + Intronic
1043118079 8:76285527-76285549 AAATCAAGGAATCCAGGAGATGG - Intergenic
1043959442 8:86399890-86399912 ATATATAGGCAACAAGGGAAAGG + Intronic
1045178246 8:99750362-99750384 ATATAAATGGGCCCAGGAAAGGG - Intronic
1045408776 8:101894556-101894578 AAATCAAGGAATCCAGGAACTGG + Intronic
1045748874 8:105457949-105457971 ATATAAAGGCAACAATAAAAGGG + Intronic
1045834604 8:106505749-106505771 ATATCAAGGCAACTAGGACATGG + Intronic
1046979055 8:120316466-120316488 GTATAAAGATATTCAGGAAAGGG + Intronic
1047351137 8:124075472-124075494 ATCAGAAGGCATCCAGAAAAAGG - Intronic
1047807967 8:128379069-128379091 ATATAATTGCATGCAGGAGAAGG - Intergenic
1048459215 8:134606066-134606088 GAGGAAAGGCATCCAGGAAAAGG + Intronic
1050465323 9:5916829-5916851 CTATAAAGGCATACATGAAAAGG - Intronic
1051485119 9:17599893-17599915 TAATAAACCCATCCAGGAAACGG + Intronic
1051982610 9:23041576-23041598 ATTCTGAGGCATCCAGGAAAAGG + Intergenic
1052511274 9:29424175-29424197 ATATAAAGAGATACAGGACATGG + Intergenic
1053181798 9:35978448-35978470 ACAGAAAGGCAGGCAGGAAAAGG - Intergenic
1055962412 9:81833193-81833215 ATATAAATGCATTTAAGAAATGG + Intergenic
1058502360 9:105633740-105633762 ACATAAAGCCATACATGAAAAGG - Intronic
1058932314 9:109733181-109733203 ATTTAGATGCATCCTGGAAAGGG + Intronic
1061593095 9:131611044-131611066 ACACAAGGGCATCAAGGAAAAGG - Intronic
1203759973 EBV:7325-7347 ATTAAACGGCATGCAGGAAAAGG + Intergenic
1203625010 Un_KI270750v1:8279-8301 ATATAATGCCATCAAGTAAATGG + Intergenic
1185669846 X:1799152-1799174 ATAGAAATGCTTCCAGAAAATGG - Intergenic
1186120549 X:6356461-6356483 ATATATCAGCATTCAGGAAAAGG - Intergenic
1187287775 X:17922646-17922668 ATGTATACACATCCAGGAAATGG - Intergenic
1187771001 X:22695890-22695912 ATGAAAAGGCAACCAAGAAATGG + Intergenic
1188022325 X:25172405-25172427 ATATAAAGGCATGTACAAAAAGG + Intergenic
1188428214 X:30074179-30074201 ATCTAAAGTCATTCAGGCAAGGG + Intergenic
1189158317 X:38783126-38783148 ATATGAAGACATACAGGGAAGGG + Intergenic
1190731377 X:53228347-53228369 GTAGTAAGGCATTCAGGAAATGG + Intergenic
1190804938 X:53826136-53826158 CCATAAATGCATCCAGTAAATGG - Intergenic
1192844921 X:74896593-74896615 TTATAAAGGAATACATGAAAAGG + Intronic
1193701426 X:84766487-84766509 AGATAAATGGATCCAGGAATTGG - Intergenic
1194108074 X:89796652-89796674 ATATTAAGTCCTCCAGGCAATGG - Intergenic
1194418484 X:93642936-93642958 ATATAAATACACCCAGGAATGGG - Intergenic
1195062929 X:101213931-101213953 GTTTAAAGGCATCCCTGAAATGG + Intergenic
1195955000 X:110318706-110318728 GTACAAAGCAATCCAGGAAATGG + Intronic
1196125548 X:112095077-112095099 ATATGATGGCATCAAGAAAAAGG + Intergenic
1196947570 X:120843036-120843058 ATATAAAAACAGCCAGGAATGGG - Intergenic
1197420903 X:126236044-126236066 ATATAAACACTTCCAGTAAAAGG - Intergenic
1197629748 X:128844698-128844720 ATAAGAAGGCATACAGCAAAGGG + Intergenic
1198564688 X:137892241-137892263 ATCTATAGGCATCCAGAGAAGGG - Intergenic
1200386555 X:155896888-155896910 ATTTAAAAGCATTCTGGAAAAGG - Intronic
1202415021 Y:24613897-24613919 GTAACAAGGCATTCAGGAAAAGG - Intronic
1202455765 Y:25056189-25056211 GTAACAAGGCATTCAGGAAAAGG + Intronic