ID: 905940238

View in Genome Browser
Species Human (GRCh38)
Location 1:41857240-41857262
Sequence CAGAGTAAACAGAGAGAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 581
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 527}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905940238 Original CRISPR CAGAGTAAACAGAGAGAAGC CGG (reversed) Intronic
900438374 1:2641901-2641923 CAGAGGACACAGAGAGAGGCAGG + Intronic
900640128 1:3684551-3684573 CAGAACGAACAGAGTGAAGCGGG + Intronic
900666247 1:3817424-3817446 GAGAGGAACCAGGGAGAAGCAGG - Intronic
900848770 1:5125453-5125475 CAGAGTAAGCAGAAAGGAACAGG + Intergenic
901773044 1:11540483-11540505 AAGAGGAAGGAGAGAGAAGCGGG - Intergenic
901917223 1:12508988-12509010 CAGCGAAAACCGAGAGCAGCTGG + Exonic
902319241 1:15648747-15648769 CAGAGTAAACACCTAGATGCAGG + Intronic
902364112 1:15959596-15959618 GAGAGTAGACAGAGGGAAGGAGG + Intronic
902745018 1:18468042-18468064 CAGAGCAAAAAGAGAGAGGTAGG + Intergenic
903225810 1:21893667-21893689 CAGAGTAGAGACAGAGAAGGAGG + Intronic
903657242 1:24956868-24956890 CAGAGGAAACAGAGGGCATCTGG - Intronic
905030160 1:34876880-34876902 CAGTGGATACAGAGAGAAGTGGG - Intronic
905940238 1:41857240-41857262 CAGAGTAAACAGAGAGAAGCCGG - Intronic
905949827 1:41940813-41940835 GAGAGGATAAAGAGAGAAGCTGG + Intronic
906232636 1:44178740-44178762 CAAAGTAGAGAGAGAGAATCTGG + Intergenic
906457389 1:46008818-46008840 GAGAGTACACAGACAGAAGTAGG + Intronic
906519153 1:46457098-46457120 CAGAGTAAACGGAGCAAAGGTGG + Intergenic
906703471 1:47876771-47876793 AAGAGTAAACAGAGACATGAAGG - Intronic
907097304 1:51793422-51793444 CAGAGGCTCCAGAGAGAAGCAGG + Intronic
907250943 1:53139036-53139058 CAGAGTAAACGAAGAGAAAAGGG - Intronic
907281750 1:53351581-53351603 CAGCGGGAACAGAGAGAAGAGGG - Intergenic
907328920 1:53658857-53658879 CAGAGTAGGCACAAAGAAGCTGG + Intronic
907875951 1:58488774-58488796 CAGGGGAAACAGTGAGAAGTGGG - Intronic
909214703 1:72871615-72871637 CAGAATAGGCAGAGAGAAGATGG - Intergenic
909426477 1:75531218-75531240 CAGATTAAACAGAGATAAATAGG - Intronic
910935984 1:92484914-92484936 CAGTGGAAACAGCGCGAAGCCGG - Intronic
911438127 1:97888696-97888718 CAGAGAGACCAGAGAGAAGTGGG + Intronic
911539172 1:99137873-99137895 CAGAGGAAACAAAGAAAAGAGGG - Intergenic
912555550 1:110513641-110513663 CAGAGAAAAAGGAGAGAGGCGGG - Intergenic
912574355 1:110651901-110651923 CAGAGTAAATTAAGAGATGCAGG - Intergenic
913128951 1:115820413-115820435 GAGAGGAAACAGAGTGGAGCGGG + Intergenic
913168761 1:116213020-116213042 GAGAGGACACAGAGAGAAGGTGG + Intergenic
914576828 1:148979499-148979521 AAGAAAAAGCAGAGAGAAGCTGG - Intronic
914858394 1:151368391-151368413 CAGAGTCAGCAGATAGAAGTAGG - Intronic
914984889 1:152448003-152448025 CAGAGGAGACAGAGAGAAGGTGG + Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
916690057 1:167181375-167181397 GAGAGGACACAGAGAGAAACAGG - Intergenic
917114745 1:171591644-171591666 CAGAGCAAACAGATAGGAGGAGG + Exonic
917690585 1:177464154-177464176 CTAAGTAAACACAGAGAAGTGGG - Intergenic
917968524 1:180193377-180193399 CAGAGGAGAGAGAGAGAGGCAGG + Intronic
918033463 1:180841136-180841158 TAGAGTATAAAGAGATAAGCAGG + Intronic
920014322 1:202894049-202894071 TAGAGAAAACAGAGACAAGGAGG + Intronic
920579665 1:207094635-207094657 CAGAATAAACAGAAAGAATCTGG - Intronic
920858382 1:209683513-209683535 AAAAGTAAACAGAGAGTAGGAGG - Intergenic
921030404 1:211331045-211331067 CAGAGAGAACAGAGAGAAAGAGG - Intronic
922059330 1:222072766-222072788 CAGATATACCAGAGAGAAGCTGG - Intergenic
922323854 1:224510710-224510732 AAGAGGAAACACAGAGGAGCCGG + Intronic
923193808 1:231645001-231645023 CACAGTGAACAGAAAGAGGCTGG - Intronic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923525925 1:234772721-234772743 CAGAATAAACAAAGAGATGCTGG - Intergenic
923727732 1:236522177-236522199 CAGAGTTAACAAAGAAAATCTGG - Intronic
924030716 1:239882541-239882563 GAGAGATAACAGAGAGATGCAGG + Intronic
924217836 1:241842817-241842839 AAGCGGAAGCAGAGAGAAGCAGG - Intergenic
1062895378 10:1098944-1098966 CAGATGAAACAGTGAGAAACAGG - Intronic
1063262336 10:4403915-4403937 CAGAGAAAACTAACAGAAGCCGG + Intergenic
1063262347 10:4404027-4404049 CAGAGAAAACTAACAGAAGCCGG + Intergenic
1063819493 10:9818886-9818908 CAGAGTGAAGACACAGAAGCTGG + Intergenic
1065167089 10:22990989-22991011 CAGAGGAAGCAGAGAGGAGGAGG - Intronic
1066069354 10:31790702-31790724 CAAATTAAACAGAAAGAAGTAGG - Intergenic
1066292871 10:34029795-34029817 CAGAGAAAACAGAAAATAGCAGG + Intergenic
1067383274 10:45794837-45794859 CAAAGAAAACAGAAAGAAGCTGG - Intergenic
1067408263 10:46043200-46043222 GAGAGTCAACAGGGACAAGCAGG + Intronic
1067890980 10:50135385-50135407 CAAAGAAAACAGAAAGAAGCTGG - Intergenic
1069071866 10:63997962-63997984 CAGAGGAAAAACACAGAAGCTGG + Intergenic
1069340349 10:67402566-67402588 CACAGAAAACAGAGAAAAGTAGG + Intronic
1070976331 10:80608834-80608856 CAGTGAACAGAGAGAGAAGCTGG - Intronic
1071699363 10:87913666-87913688 CAGAATAAAAAGAGAGAAAAGGG - Intronic
1071770772 10:88727042-88727064 CAAATTAAACAGAGAGATGGGGG - Intronic
1072162789 10:92784020-92784042 CAGAGTAGAAAGAGAGAAGGAGG - Intergenic
1072351055 10:94557608-94557630 AAGAGTCACCAGAAAGAAGCAGG - Intronic
1072551965 10:96485958-96485980 AAGAGAAGAAAGAGAGAAGCAGG + Intronic
1072738481 10:97895533-97895555 CAGAGGAAAAAGATAGAAACAGG + Intronic
1073027384 10:100497913-100497935 TAGAGTAGAAAGAGAGAGGCAGG + Intronic
1073234767 10:102004725-102004747 CTGAATAAACAGAGACAAGTAGG + Intronic
1073649893 10:105347177-105347199 CAGAGACAACAGAGAGAAATGGG - Intergenic
1073770054 10:106726104-106726126 CAAAATAAACAGAGAGGAGGAGG - Intronic
1074200763 10:111233167-111233189 CAGAGGAACCAGAGAGAAGATGG - Intergenic
1074728565 10:116342815-116342837 CAGGAAGAACAGAGAGAAGCAGG - Intronic
1075553542 10:123412139-123412161 CAGAAGGAAGAGAGAGAAGCAGG - Intergenic
1077288735 11:1779154-1779176 CAGAGCCAACAGAGAGAGGCAGG - Intergenic
1077915633 11:6609907-6609929 AAGAGAAAACAGATAGAAGGAGG - Intronic
1078366987 11:10715095-10715117 CAGAGAGCACAGAGAAAAGCAGG + Intergenic
1078493211 11:11788522-11788544 CAGAGTAACCTAAGTGAAGCAGG - Intergenic
1079102023 11:17547733-17547755 GAGAGTAAACAGGGAGATCCTGG + Intronic
1079155607 11:17944729-17944751 CTAATCAAACAGAGAGAAGCGGG - Intronic
1079777173 11:24546380-24546402 CATACTAAACAGGGAGGAGCTGG - Intronic
1080715336 11:34794628-34794650 CAGAATATCGAGAGAGAAGCAGG + Intergenic
1081188700 11:40077402-40077424 CAAAGCACACAGAGAAAAGCAGG + Intergenic
1081287550 11:41289592-41289614 CACAGTACACAGTGAGAAGCAGG + Intronic
1081730195 11:45366512-45366534 CAAAGGCCACAGAGAGAAGCTGG - Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083929402 11:65832278-65832300 GAGATCAAGCAGAGAGAAGCTGG - Intronic
1084122172 11:67076026-67076048 CAGAGTTTACAGAGACAAGAAGG + Intergenic
1084343698 11:68528055-68528077 CAGAGAAAACAGAGACAGGCAGG - Intronic
1084686217 11:70697443-70697465 CAGAGCCCACAGACAGAAGCAGG + Intronic
1085004489 11:73072947-73072969 CAGAGTAAACACAGACATGTTGG - Intronic
1086330138 11:85745745-85745767 CAGAGTAAAGACAGAGAAAATGG - Exonic
1087058625 11:93957218-93957240 AAGAGAAAAGAGAGAGAAGGAGG + Intergenic
1087365883 11:97218036-97218058 CACAGTAAAAAGAAAGAACCTGG - Intergenic
1087897023 11:103597520-103597542 CAGAGTAGACAGAAGGAAACAGG - Intergenic
1088967635 11:114739720-114739742 CAGAGGAAATAGGGAGATGCTGG - Intergenic
1089113017 11:116072065-116072087 CAGAGAGAACAGATAGAGGCAGG - Intergenic
1089881160 11:121775109-121775131 CAGAGTAAGCAAAGCGGAGCTGG + Intergenic
1089961698 11:122622523-122622545 CAAAAGAAACAGAGAGAAGTTGG + Intergenic
1090764486 11:129864913-129864935 CAGTGGAATCAGAGAGGAGCCGG + Intronic
1090772994 11:129938265-129938287 CAGAGGGAACAGAGAGAGTCTGG - Intronic
1090936120 11:131344170-131344192 CAGTGCAAACAGAGAGAAAAGGG + Intergenic
1091415372 12:278267-278289 CAGAGTAAACTGACAGAGGGGGG + Intergenic
1092041047 12:5384672-5384694 CATGGGATACAGAGAGAAGCAGG - Intergenic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1093426898 12:19037975-19037997 CAGAGTAGACAGTGTAAAGCTGG + Intergenic
1094137415 12:27143243-27143265 CTTTGTAAAAAGAGAGAAGCTGG + Intergenic
1094186867 12:27653283-27653305 CTTTGTAAAAAGAGAGAAGCTGG + Intronic
1094351332 12:29528999-29529021 CAGATTGAACCGACAGAAGCAGG - Intronic
1095824535 12:46517199-46517221 CACAGAAAACAAAGAAAAGCAGG - Intergenic
1096190508 12:49614800-49614822 CAGAGGAAAAAGTGGGAAGCGGG + Intronic
1096456801 12:51794156-51794178 AACAGAAAACAGAGAGAAGCTGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097153780 12:56997902-56997924 CCCAGTAAACAGGGAGATGCAGG - Intergenic
1097450250 12:59729415-59729437 CAGAATAAAGAGAGAGAGGCAGG - Intronic
1097722760 12:63041383-63041405 GTGGGGAAACAGAGAGAAGCTGG + Intergenic
1098418653 12:70266765-70266787 AAAAGTAAACAAAGAGAAGCTGG - Intronic
1098546370 12:71716334-71716356 CAGAGGAGTCAGAGAGATGCTGG + Intergenic
1102819365 12:115894848-115894870 CTGAGCAAAGAGAGGGAAGCAGG + Intergenic
1102911768 12:116720527-116720549 GAAAGTACACAGACAGAAGCTGG + Intronic
1103073573 12:117964538-117964560 CAGATTGGACAGAGAGAAGGAGG - Intronic
1103993794 12:124816182-124816204 CAGACAAAACAGTGTGAAGCCGG - Intronic
1104318658 12:127728764-127728786 CAGAATAAACATGGAAAAGCTGG - Intergenic
1104647056 12:130505167-130505189 TAGAGCACACAGTGAGAAGCAGG + Intronic
1104877911 12:132049321-132049343 AAGAGTAAGCAAAGGGAAGCAGG - Intronic
1104938921 12:132385731-132385753 CAGGGAAAACACAGAGAGGCTGG + Intergenic
1104949371 12:132432201-132432223 AAGAGAAAACAGAGACAAGGAGG + Intergenic
1105461534 13:20594187-20594209 CAAGGGAAACAAAGAGAAGCTGG - Intronic
1107276174 13:38681847-38681869 TAGAGGAAACAGAGACAAGGAGG - Intergenic
1107376149 13:39806909-39806931 CAGATTAGAGAGAGAGAAGGTGG - Intergenic
1108146516 13:47483274-47483296 CAGAGAAAGAAGAGAGAAGTGGG + Intergenic
1108909357 13:55524297-55524319 CAGAGTAAAGAGAAAGTAGTGGG - Intergenic
1109070693 13:57763314-57763336 TACAGGAAAGAGAGAGAAGCAGG + Intergenic
1110159945 13:72363818-72363840 CAGAGTAAAGAGAGAGAAACTGG - Intergenic
1111286895 13:86105818-86105840 CACAGAAAACAGAAAAAAGCAGG - Intergenic
1112067209 13:95806002-95806024 CAGAGAGAACAGAGATAAGGGGG + Intronic
1112769982 13:102784218-102784240 CAGTAAAAACAGAGAGAATCTGG - Intergenic
1114576483 14:23719114-23719136 AAGAGGAAAAAGAGAGAAGAAGG + Intergenic
1114843115 14:26289449-26289471 AAGAGTAGACAGAGAGTAGGAGG - Intergenic
1114998640 14:28392894-28392916 CAATGTAAACAGAGAGATACTGG - Intergenic
1115141615 14:30177847-30177869 AATAGTAAACAGAGACAAACAGG + Intronic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1115555802 14:34544284-34544306 TGGAGCAAACAGAGAGAAGCAGG + Intergenic
1115558106 14:34558803-34558825 TGGAGCAAACAGAGAGAAGCAGG - Intergenic
1115892538 14:38047422-38047444 CAGAGGAAACAGGAAGAAGTTGG - Intergenic
1116209567 14:41917439-41917461 CAGAGAAGACAGAGAAAAGGGGG - Intergenic
1117612229 14:57496247-57496269 CAGAGGAGATGGAGAGAAGCAGG + Intergenic
1118139012 14:63059385-63059407 CAGTGGAAACAGATAGAAGATGG + Intronic
1118159920 14:63277836-63277858 CAGAGAGAAAAGAGAGAAGTGGG + Intronic
1118571775 14:67201397-67201419 CAGAGCAAAAAGAGAGAATTGGG - Intronic
1118746885 14:68780757-68780779 CAGGATGCACAGAGAGAAGCAGG + Intergenic
1118899614 14:69975472-69975494 AAGAGGAATAAGAGAGAAGCAGG + Intronic
1119072442 14:71600536-71600558 CAGAGCAAAAAGAATGAAGCTGG - Intronic
1120278239 14:82405786-82405808 CATTGTAAACAGAAAGACGCAGG - Intergenic
1120715734 14:87838952-87838974 TAGAGGAAAGAGAGTGAAGCAGG - Intronic
1121993136 14:98580890-98580912 CAGAGAAGAAAGAGAGAAGCTGG + Intergenic
1123137594 14:106044021-106044043 CTGAGCACACAGAGAGCAGCAGG + Intergenic
1123203408 14:106690460-106690482 CTGAGCACACAGAGAGCAGCAGG + Intergenic
1123706404 15:22954200-22954222 GAGAGGACACAGAGAGAAGGTGG + Intronic
1124415654 15:29471463-29471485 CACAGAAAACAGAGAGACCCCGG + Intronic
1124521236 15:30407965-30407987 CACATTAAAGAAAGAGAAGCAGG - Exonic
1124621583 15:31277031-31277053 CAGAGTCCACAGAGGCAAGCTGG - Intergenic
1124923213 15:34046781-34046803 CACAGAAAACAAAGAAAAGCAGG + Exonic
1125642345 15:41241772-41241794 CAAAGTGAACAGGGACAAGCAGG - Intronic
1126261366 15:46696639-46696661 TAGAGTGACCAGAGAGAAGAGGG - Intergenic
1126367599 15:47912020-47912042 CAGAGTAAATAGAATAAAGCAGG - Intergenic
1126406136 15:48324466-48324488 ATGAGTACACAGAGAGAAGGTGG + Intergenic
1126945788 15:53818395-53818417 CAAAGTAAACGGAGAGAAAGAGG + Intergenic
1128400103 15:67270318-67270340 CATACTAAACAGGGAGAAACTGG - Intronic
1128679372 15:69636855-69636877 CAGTGTAAACAGAGAGCAGCAGG + Intergenic
1128940923 15:71786992-71787014 CCAAGAAAAGAGAGAGAAGCGGG + Intergenic
1129124509 15:73427079-73427101 CAGAGTAAGAAGAGAAAAGGAGG + Intergenic
1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG + Exonic
1129614035 15:77083943-77083965 CTGAGTGATCGGAGAGAAGCCGG - Intronic
1130288308 15:82573407-82573429 AAGGGTGAACATAGAGAAGCAGG - Intronic
1130573962 15:85074044-85074066 CAGAGTGAACACAGAAAAGCAGG + Intronic
1131569683 15:93522121-93522143 CAGAGTAGACAGAAAGGGGCTGG - Intergenic
1132185301 15:99798192-99798214 GAGAGAAAGCAGAGAGAAGCAGG + Intergenic
1132190232 15:99848859-99848881 CAGAGTATAGAAAGTGAAGCAGG - Intergenic
1132431685 15:101766341-101766363 AAAAGCAAGCAGAGAGAAGCAGG - Intergenic
1132431686 15:101766370-101766392 GAGAGAAAGCAGAGAGAAGCAGG - Intergenic
1134225004 16:12382839-12382861 GAGAGGCACCAGAGAGAAGCAGG - Intronic
1137411665 16:48233476-48233498 AAGAGAAAAGAGAGAGAAGGAGG + Intronic
1139958292 16:70703711-70703733 CAGAGAAACCAAAGAGAAGCTGG - Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140930040 16:79618948-79618970 CAGAGGAGACAGAGAGGAGGCGG - Intergenic
1141108317 16:81251616-81251638 CAGAGTACAGAGGGAGAAGCTGG + Intronic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1141743640 16:85911373-85911395 CAAAGTCAAAAGAGAGAAGTTGG - Intronic
1142200520 16:88759120-88759142 TGGAGGAAACAGACAGAAGCAGG + Intronic
1144266417 17:13573859-13573881 CAGAGAGAGCAGAGAGAAGGAGG - Intronic
1144518843 17:15940953-15940975 CAGAGCAGAAAGAGAGAACCTGG + Intergenic
1145829897 17:27907459-27907481 CAGAGGAAAGAGGGAGAAGATGG + Intergenic
1146430649 17:32790763-32790785 CAGGGCAAAGAGAGAGAAGAGGG + Intronic
1146500504 17:33360468-33360490 AAGGGTATTCAGAGAGAAGCTGG - Intronic
1147499405 17:40948470-40948492 CAAAGGAAACAGAGAGAGGGAGG - Intergenic
1149093483 17:52813681-52813703 CAGAGGTAACAAAGAGGAGCTGG - Intergenic
1150819258 17:68421905-68421927 CAGAGTGAGCAGGGAGAGGCTGG + Exonic
1150871830 17:68920454-68920476 AAGAGTTGACAGATAGAAGCTGG + Intronic
1151162276 17:72175669-72175691 CAGAGCAAAGGCAGAGAAGCAGG - Intergenic
1151169907 17:72237305-72237327 CAGAATCAAAAGAGAGAAGGAGG + Intergenic
1151811618 17:76446479-76446501 CAAACAAAACAGAGAGAAACAGG + Intronic
1151925751 17:77194965-77194987 CAGAGCAAACAGAGAGAAAACGG - Intronic
1152137561 17:78513730-78513752 CAGATTAAATAGAGGAAAGCCGG - Intronic
1152840330 17:82563408-82563430 CAGCGAGAAGAGAGAGAAGCAGG + Exonic
1154078454 18:11229421-11229443 TAGAGAAAACAGAGAGAAGGAGG - Intergenic
1154371771 18:13769792-13769814 CACACTGAACAGGGAGAAGCTGG + Intergenic
1155464378 18:26119688-26119710 CACAGAGAACAGAGAAAAGCAGG + Intergenic
1155567125 18:27147554-27147576 CTGAGTAAACCGAGACCAGCAGG + Intronic
1155875161 18:31077117-31077139 GAGAGAAAACAATGAGAAGCAGG + Intronic
1155984716 18:32218057-32218079 CATAGGAAACAGAGAGAAGAAGG - Intronic
1156144697 18:34160952-34160974 GAGAGAAAATAGGGAGAAGCTGG - Intronic
1157501607 18:48194553-48194575 CAGAGTAAACAGAGGCTTGCAGG + Intronic
1157836815 18:50911500-50911522 GAGAGTTAACAGAGGGAAGTAGG + Intronic
1159362649 18:67425303-67425325 GAGAGGAGACAGAGAAAAGCAGG - Intergenic
1159579427 18:70218612-70218634 CTGAGGACACAGAGAGAAGATGG - Intergenic
1160515850 18:79478813-79478835 CAGCGGCATCAGAGAGAAGCTGG + Intronic
1161131421 19:2591319-2591341 GAGAGGAAACAGAGAGGAGGCGG - Intronic
1161458408 19:4381556-4381578 CAGGGGGAACAGAGAGAGGCAGG - Intronic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1161563486 19:4986552-4986574 CACAGTAAACATGGAGACGCTGG - Intronic
1162377983 19:10316317-10316339 CAGAGTCAAGGGAGGGAAGCTGG + Exonic
1164859344 19:31550450-31550472 CAGAGTGAAGAGAGTGAAGATGG + Intergenic
1165719574 19:38069503-38069525 CAGAGAGAGCAGAGAGAAGAGGG - Intronic
1166872412 19:45878930-45878952 CAGAGTAGACAGAGAGACGGTGG - Intergenic
1167083507 19:47293420-47293442 CAGAGAAAACCGAGAGGAGAGGG - Intronic
1167190129 19:47981655-47981677 CAGAGTAAACTGAGGGCAGATGG - Intronic
1167304419 19:48698908-48698930 CAGAAGACACAGAGAGAGGCAGG - Intronic
1167945446 19:52984675-52984697 TAGAGTAAACAGAGAGGAAGGGG + Intergenic
925139614 2:1540809-1540831 CGGAGTAAACAGAAATATGCAGG - Intronic
925569172 2:5290595-5290617 CAGAGAAATCAATGAGAAGCTGG - Intergenic
925933701 2:8732883-8732905 CAGAGCAAAGTGAGAGATGCAGG - Intronic
926566514 2:14481442-14481464 CAGAGTGCACTGAAAGAAGCAGG + Intergenic
926630740 2:15134014-15134036 CATAGTAAGGAGAGAGTAGCAGG - Intergenic
926992913 2:18698862-18698884 CAGAGGAAACAGGGAGGAGTAGG + Intergenic
927041670 2:19236826-19236848 CTGAGGAAACAGAGAGAATGGGG - Intergenic
927427021 2:22992624-22992646 TAGACTAAACAAAGAGACGCAGG - Intergenic
927495847 2:23551182-23551204 CAGCGTAAACTGAGGGAAGAAGG - Intronic
927727351 2:25436445-25436467 AAGAGTGTACAGAGTGAAGCAGG - Intronic
928328829 2:30341684-30341706 AGGAGTAAACAGACAGAAGAGGG + Intergenic
928724939 2:34161525-34161547 CAGATGAAACAGAGAGAATGTGG + Intergenic
928830364 2:35475439-35475461 GAGGGTAAAATGAGAGAAGCAGG + Intergenic
928866893 2:35927913-35927935 AAGAGCAAAAAGACAGAAGCAGG - Intergenic
929241665 2:39659779-39659801 CAGTGGAAACAGAGAGAAATGGG - Intergenic
929399466 2:41563282-41563304 CAGAGTAAAGGGAGAGAGGATGG - Intergenic
929489298 2:42382278-42382300 AAGAGGAAACAGAGAGAAAAGGG + Intronic
930229148 2:48826492-48826514 CACAGAGAACAGAGAAAAGCCGG + Intergenic
930527153 2:52544398-52544420 CAAAGTAAACAGGGACAAACAGG - Intergenic
931543633 2:63356095-63356117 AATAGAAAACAGAAAGAAGCAGG + Intronic
932437893 2:71713637-71713659 TAGAGTAAGCAGAGAGGAGAAGG + Intergenic
933808430 2:86017026-86017048 CAAAGGATGCAGAGAGAAGCTGG + Intergenic
933973210 2:87486876-87486898 CAGAGCAAGCAGAGAAAAGGTGG - Intergenic
935757052 2:106284442-106284464 CAGAGCAGACACAGGGAAGCTGG - Intergenic
936112509 2:109676546-109676568 CAGAGCAGACACAGGGAAGCTGG + Intergenic
936320511 2:111463337-111463359 CAGAGCAAGCAGAGAAAAGGTGG + Intergenic
936728481 2:115352854-115352876 CATAGTAAAGAGAGAGATGTAGG - Intronic
937183279 2:120014767-120014789 CAGAGCAAACAGAGGGGAGTAGG + Intronic
937524329 2:122748539-122748561 AAGAGTAAACAGAGAGAACAAGG - Intergenic
937757382 2:125556768-125556790 CAGGAGAAACAGAGAGAGGCAGG - Intergenic
937800970 2:126079841-126079863 CAGAAAAAACAGAGAGAAGGAGG + Intergenic
938165118 2:129019355-129019377 GAGAGTCAGCAGAGAGAAGGGGG + Intergenic
938752818 2:134350632-134350654 CCAAGTAAACAGAAAGCAGCAGG - Intronic
939978423 2:148748177-148748199 CAGAAGAAAGAGAGAGAAGGGGG - Intronic
940305043 2:152216494-152216516 CACTGTAAAAAGAGACAAGCTGG - Intergenic
940771712 2:157845689-157845711 CAGAGCAAGCAAAGACAAGCCGG + Intronic
941664036 2:168226000-168226022 CAGGGAAAGAAGAGAGAAGCTGG + Intronic
941667373 2:168255863-168255885 CAGAGAAAAGAGAGAGCAGAAGG + Intergenic
941801969 2:169669985-169670007 AAGAGTAGAAAGAGAGAAGAGGG - Intronic
941861680 2:170288163-170288185 CTGAGCAAAAAGAGCGAAGCTGG - Intronic
942840946 2:180360061-180360083 CACAGGAAATGGAGAGAAGCAGG + Intergenic
942881382 2:180865276-180865298 CAGAGCAAAAAGAAAGAATCTGG + Intergenic
943073588 2:183170318-183170340 AACAGTAAACAGAAAAAAGCAGG - Intergenic
943079128 2:183236207-183236229 CAGTGTAAACAGAAAGAATAGGG + Intergenic
943187549 2:184631960-184631982 AAGAACAAACATAGAGAAGCTGG + Intronic
943204905 2:184882109-184882131 AAGAGAAAACAGAAAAAAGCAGG + Intronic
943231150 2:185254113-185254135 CAGAGAAAACAGAGAGAGAGAGG - Intergenic
943704846 2:191023485-191023507 CAGGGGAAACAGAGAGAACATGG + Intergenic
943949410 2:194111667-194111689 GTGAGGACACAGAGAGAAGCTGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944708791 2:202317220-202317242 GAGAGTAAACAGGTGGAAGCTGG - Intergenic
945950325 2:216033508-216033530 CAAAATAAGCAGAGAGAAACAGG + Intronic
946085038 2:217162416-217162438 CAGAGTAAAAAGAGAAAAAAGGG + Intergenic
946085158 2:217163458-217163480 CAGAGGAACCAGAGAGGATCTGG + Intergenic
946375023 2:219302687-219302709 CAGAGGGGACAGAGAGGAGCTGG + Exonic
947215229 2:227744112-227744134 CAGACAAAACAGAGAGCAGGAGG + Intergenic
947410864 2:229838081-229838103 TACAGTAAAGTGAGAGAAGCAGG + Intronic
947742567 2:232491287-232491309 CAGAGTAACCAGAGGAAAGAGGG - Intergenic
948334723 2:237199004-237199026 CAGAGAGGACAGAGACAAGCTGG - Intergenic
1169024040 20:2352222-2352244 CAGAGTACATTGAGAGCAGCTGG + Intergenic
1169577065 20:6975549-6975571 CCAAGTAAACAGAGAGAAATTGG - Intergenic
1169614345 20:7423057-7423079 CAGAGAAAACCAAGATAAGCAGG - Intergenic
1169652303 20:7882858-7882880 AAGAGTAAAGAAAGAGAAGTAGG + Intergenic
1169963619 20:11190941-11190963 CAGAGAAAAGAGAGAGCAGAAGG + Intergenic
1170158797 20:13292214-13292236 CAGAGGAAACAGTAAAAAGCAGG - Intronic
1170353523 20:15468016-15468038 GAAAGTAAAAAGAGAGAACCTGG - Intronic
1170948857 20:20915948-20915970 CAAGGAAAAGAGAGAGAAGCAGG - Intergenic
1171282501 20:23912464-23912486 CTGAATAAACAGAGAGACCCTGG - Intergenic
1172258601 20:33541455-33541477 CTGAGTAAGGACAGAGAAGCCGG + Intronic
1172494921 20:35373850-35373872 TAGAGTAAACAGAGAGCAAAAGG - Intronic
1174294626 20:49536879-49536901 CAGAGAAAACACACAGATGCTGG + Intronic
1174596864 20:51691042-51691064 CTGAGTAAACAGAGAAACGAGGG - Intronic
1174686916 20:52465099-52465121 CAGGGAAAGCAGAGACAAGCTGG - Intergenic
1174830037 20:53804139-53804161 CAGAGTAAATAATGTGAAGCAGG - Intergenic
1174881331 20:54282450-54282472 CAGAGTAAACAGAGGTAAAGAGG - Intergenic
1174885039 20:54324322-54324344 CAGAGTGTACAGAGAAAAACAGG - Intergenic
1175018825 20:55822507-55822529 GAGAGGAGAGAGAGAGAAGCTGG - Intergenic
1175704994 20:61170179-61170201 CAGACTCAAGAGGGAGAAGCTGG + Intergenic
1176127308 20:63481811-63481833 CAGAGTAAAGACAGAGCAGTGGG + Intergenic
1177196770 21:17911593-17911615 CAGAGTACAAAGAGACAAGCAGG - Intronic
1177425445 21:20916794-20916816 CATACTAAATAGAGAAAAGCTGG + Intergenic
1177492972 21:21852608-21852630 CAAACTAAACATAGAGAAGAAGG - Intergenic
1177689578 21:24488029-24488051 CAGAGTAACAAGAGAGAACCTGG - Intergenic
1179396877 21:41048336-41048358 CAGAGAAATCAGGCAGAAGCAGG + Intergenic
1179598978 21:42462865-42462887 CAAAGTAAATAGTGAGAAGTAGG + Intergenic
1180660564 22:17463384-17463406 AGGAGCAGACAGAGAGAAGCAGG + Intronic
1181112594 22:20610720-20610742 GAGAGTGAACAGAGAGAAGCCGG + Intergenic
1181179068 22:21054651-21054673 CTGAGAAGTCAGAGAGAAGCGGG + Intronic
1181308868 22:21932948-21932970 CAGAGAGAAGAGAGGGAAGCTGG - Intronic
1181410024 22:22712234-22712256 CAAAGGAAACAGAGAGAGGAGGG - Intergenic
1181544302 22:23592343-23592365 CAGAGTAATCAGAGAGGAGGTGG + Intergenic
1182014976 22:27032109-27032131 CAAGGGAGACAGAGAGAAGCTGG + Intergenic
1182073071 22:27476957-27476979 CAGAGACAGCAGACAGAAGCAGG + Intergenic
1182452084 22:30427680-30427702 CAAAACAACCAGAGAGAAGCAGG + Intronic
1182962169 22:34485487-34485509 CAGAAGGAAGAGAGAGAAGCGGG + Intergenic
1183245930 22:36693374-36693396 CATAGTAAACAGAGAGTAAAGGG - Intronic
1183499801 22:38171993-38172015 CAGAGCAAGGAGAGAGAACCTGG - Intronic
1184004003 22:41695775-41695797 GAGAGAAACCAGAGAGAACCTGG + Exonic
1184046038 22:41972722-41972744 CAGAGTGAACAGAGCCAAGCTGG + Intergenic
949419704 3:3852818-3852840 CAGAGAAAAAAGAGAGTAGAAGG - Intronic
949672845 3:6419626-6419648 CAGAGTAAATAAAGACAAGAAGG + Intergenic
949785775 3:7740108-7740130 TAGAGTATAAAGAGGGAAGCTGG + Intronic
949808751 3:7983560-7983582 CAATGAAAACAGAGAGAGGCTGG + Intergenic
950151640 3:10692231-10692253 CAGAGTTAACACATAGATGCAGG + Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
950916242 3:16648086-16648108 CAGAGCAAACAGGCAGAAGAAGG - Intronic
951097828 3:18652401-18652423 CATGGTAGACAGAGAGAAGGTGG + Intergenic
952887530 3:38020760-38020782 CAGAGTGAACTGAAGGAAGCTGG + Intronic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
955377443 3:58410024-58410046 AAGAATAAACACAGTGAAGCTGG - Intronic
956618096 3:71193075-71193097 CAGAGGAACCTGAGAGAATCAGG - Intronic
958049312 3:88324090-88324112 CATACTAAACAGAGGGAATCAGG + Intergenic
958676187 3:97272067-97272089 CAGAGGAAAAAGAGAGAAGTAGG - Intronic
959021760 3:101195231-101195253 CAGAAGAAAGAGAGTGAAGCGGG + Intergenic
960445252 3:117740455-117740477 CAGACTAACCAGAGATAAGTTGG - Intergenic
961143803 3:124577453-124577475 CACACTAAACAGAGATAAGAAGG + Intronic
961362414 3:126376194-126376216 CAGAGGAAACAGAGTGGAGGCGG + Intergenic
961507922 3:127383755-127383777 CACAGTAAACAGAGGCAACCGGG - Intergenic
962200162 3:133394423-133394445 AAGAGAAAACAGGGAGAAGGAGG - Intronic
962849155 3:139295006-139295028 GACAGTAAACACAGGGAAGCCGG - Intronic
963200724 3:142583353-142583375 CAGAATAAAAGGAGAGTAGCAGG + Intergenic
963219700 3:142795455-142795477 CAAAGCAAACAGAGAATAGCAGG + Intronic
963465647 3:145678090-145678112 CAGAGAAAACAGAGACAATGTGG + Intergenic
964550209 3:157877261-157877283 CAGAGGTATCAGAGAAAAGCAGG + Intergenic
965464680 3:169013337-169013359 CAGTGCAGATAGAGAGAAGCAGG - Intergenic
965619195 3:170625543-170625565 CAGAAGAAAGAGAGAGAAGGGGG - Intronic
967202893 3:187089601-187089623 CTGAGTAAAAAGAATGAAGCTGG - Intergenic
967240687 3:187436413-187436435 CAGAGTGAAAAAAGAGAAGGAGG - Intergenic
967397754 3:189025373-189025395 CAGAGAAAATGGAGAAAAGCAGG - Intronic
969179614 4:5427922-5427944 CAAAGTAAGCAGAGAGAAGGAGG - Intronic
969331936 4:6478885-6478907 CAGAGGTAACAGAGAGAGACAGG + Intronic
969545041 4:7820482-7820504 TAGAGTTAAAGGAGAGAAGCTGG + Intronic
971005579 4:22370619-22370641 CTGAGTAAACAGAACAAAGCTGG + Intronic
971430872 4:26565876-26565898 GAGAGCCAAGAGAGAGAAGCAGG - Intergenic
971504872 4:27355654-27355676 CAGGGTAATCAAAGAGAAACGGG - Intergenic
971782853 4:31060006-31060028 CTGACTAAACAAAGAAAAGCTGG - Intronic
974144835 4:57934331-57934353 CACAGTTAACAGAGAGTGGCTGG + Intergenic
974621033 4:64355139-64355161 CAAAGGAAACAGAGAAAAGTTGG + Intronic
975361718 4:73477850-73477872 CAGAGGAAAGACACAGAAGCTGG - Intergenic
975758865 4:77598311-77598333 TAGAGTTAACAGAGAGCAGTGGG + Intronic
975872014 4:78789696-78789718 CAGACTAACCTGGGAGAAGCTGG - Intronic
976790057 4:88868400-88868422 GAAAGTAAACAGATAAAAGCTGG - Intronic
979576448 4:122297122-122297144 CAGAGTAAACAGACAGAATGGGG + Intronic
980140468 4:128909997-128910019 CAGAGAAACCAGAGTGAAGGCGG + Intronic
980796473 4:137690662-137690684 CACAGCCAACAGAGAGAAGAAGG - Intergenic
982434415 4:155367269-155367291 CAGAGAAAACACAGGGAAGAAGG + Intronic
983509602 4:168593301-168593323 CAGATCCAGCAGAGAGAAGCTGG - Intronic
983722938 4:170880815-170880837 CAGAGTAACCAAAAAGGAGCGGG - Intergenic
984162115 4:176265719-176265741 CACAGTATACAGAGAGAATGAGG - Intronic
984264290 4:177478021-177478043 CAAAGCAAAAGGAGAGAAGCAGG + Intergenic
985485831 5:147949-147971 CAGTGTAAACAGAATGAAGGGGG + Intronic
986615238 5:9610151-9610173 CAGAGGTAACAGAATGAAGCTGG + Intergenic
986835765 5:11635315-11635337 CAGAGAGAACAGTGAGAAACTGG + Intronic
987084671 5:14457517-14457539 CTGAGCCCACAGAGAGAAGCTGG + Intronic
987480084 5:18442351-18442373 CACAGGAAACTGAGAGAAGATGG + Intergenic
987899062 5:23987492-23987514 GAGAAGAAACAGAGAGAGGCAGG - Intronic
988149755 5:27362684-27362706 CACAATAAACAGAGAGAAAAGGG + Intergenic
988907230 5:35802151-35802173 AAGAGTAAAGACAGAGAGGCAGG - Intronic
988918108 5:35915860-35915882 CAGAGCAATCAGACAGGAGCAGG + Intronic
988943877 5:36174686-36174708 CAGAGTAACCAGATAGAATGTGG + Intronic
989700294 5:44255896-44255918 CAGAGTTGAGAGAGTGAAGCAGG + Intergenic
989734507 5:44687765-44687787 AAGAGGAAGCAGAGAGAAGTGGG + Intergenic
990345050 5:54863548-54863570 AGGAGGAAACAGAGAAAAGCAGG - Intergenic
990509843 5:56480662-56480684 CAGAGAAAGAAAAGAGAAGCTGG + Intronic
990934842 5:61136996-61137018 CAGAGTAAGCTGAGAGAATATGG + Intronic
991492281 5:67195028-67195050 GAGAGGACACAGAGAGAAGATGG + Intronic
994925218 5:106108570-106108592 CAGTGGATACAGAGAGATGCAGG - Intergenic
994955615 5:106527506-106527528 CACATTAATCAGAAAGAAGCAGG + Intergenic
995505345 5:112854228-112854250 CACATAAAACAGAGACAAGCTGG + Intronic
997067733 5:130581705-130581727 CAAAATAAACAGAGAGCATCAGG + Intergenic
997191832 5:131945185-131945207 CAGAGAAAGCAGAGCGGAGCAGG - Intronic
997459688 5:134043477-134043499 CAGAATAACCAGAGAGGAGGAGG - Intergenic
997997946 5:138601573-138601595 AAGAGAAAGCTGAGAGAAGCAGG + Intergenic
998274254 5:140737082-140737104 CAGAGACAAAAGGGAGAAGCTGG - Intergenic
998666039 5:144298418-144298440 CAGCCTTTACAGAGAGAAGCTGG + Intronic
999875720 5:155803577-155803599 CAGAGAAGAGAGAGGGAAGCAGG + Intergenic
999950558 5:156645296-156645318 CTGAGAAAACAGAGAGAGGATGG + Intronic
1000371908 5:160544908-160544930 CAGAGGAAACATGGAGAAGGGGG - Intergenic
1000760383 5:165216249-165216271 CTGAGGAAACAGAGTGAAGCAGG + Intergenic
1000803066 5:165752445-165752467 CAGACTAAATAGATAGAAGTAGG - Intergenic
1001478028 5:172064819-172064841 CAGAGACAGCAGAGAGTAGCTGG + Intronic
1001517176 5:172364180-172364202 CAGAGACCCCAGAGAGAAGCGGG + Intronic
1002212341 5:177606478-177606500 CAGTGGCAACAGCGAGAAGCGGG - Intronic
1002213099 5:177609900-177609922 CACAGTGATCAGAGAGAGGCTGG + Exonic
1002295751 5:178230237-178230259 CAGAGCAGGGAGAGAGAAGCTGG + Intronic
1002308539 5:178298560-178298582 CAGGGGCAACAGAGAGGAGCAGG - Intronic
1002711042 5:181195195-181195217 TGGAGCAAACAGAGAAAAGCGGG + Exonic
1002843104 6:922845-922867 CAGGGTGAACCCAGAGAAGCAGG - Intergenic
1002952475 6:1828340-1828362 CAGAAGAAGCAGAGAGAAGAAGG + Intronic
1003014959 6:2461091-2461113 CACAGGGAACAGAGAGGAGCTGG - Intergenic
1005487000 6:26310085-26310107 CAGAGAAAAGAGCAAGAAGCGGG + Intergenic
1005704795 6:28440800-28440822 CAGAGTATACAGAGAAAATAGGG - Intronic
1005814333 6:29538669-29538691 CAGAGAACACTGAGAGAAACTGG + Intergenic
1005997580 6:30940756-30940778 CAGAGGAACCAGAAAGGAGCAGG - Intergenic
1006038825 6:31236286-31236308 CAGAGATAACAGAGATAAACAGG - Intergenic
1006047994 6:31315181-31315203 CAGAGAGAACAGAGATAAACAGG - Intronic
1006614320 6:35315391-35315413 CTGAGTAAAAAGAACGAAGCTGG - Intronic
1007452607 6:41951593-41951615 GGGAGTAAGAAGAGAGAAGCAGG + Intronic
1007657747 6:43462151-43462173 CAGAGTGAGCAGAGAGGAGGAGG - Intergenic
1009729733 6:67585052-67585074 CAGACTGAACAGAGAAAAGCTGG - Intergenic
1011142771 6:84178344-84178366 CAAAATAAAAAGAGAGTAGCTGG + Intronic
1011828842 6:91344514-91344536 CAGAGTAAACCTAAAGAAACAGG + Intergenic
1011865907 6:91826618-91826640 TAGAGGGAACAGAGAGAAGATGG - Intergenic
1012701001 6:102457745-102457767 CAGGTTAAACACAGAGAAGGAGG - Intergenic
1013614874 6:111833509-111833531 GAGTGAAAACAGAGAGAAACGGG + Intronic
1013650541 6:112190269-112190291 CAGGCTAAAGAGAGAGAAGGCGG - Intronic
1013788000 6:113804160-113804182 CAAAATAAACCAAGAGAAGCTGG - Intergenic
1014451827 6:121590973-121590995 CAGAGTAATCAGGGAAATGCAGG + Intergenic
1015297158 6:131608982-131609004 CAGCGAATACAGAGAGTAGCGGG - Intronic
1015386550 6:132631244-132631266 CAGAGTAAATAGAGACCAGAGGG + Intergenic
1015414545 6:132933585-132933607 AAGAGGAAAAAGAGAAAAGCGGG + Intergenic
1015468642 6:133576976-133576998 CAGCTTAGGCAGAGAGAAGCTGG - Intergenic
1015793357 6:136986314-136986336 GAGAGGAAGCAGAGAGAAGCAGG - Intergenic
1016133210 6:140503231-140503253 CAGAGTAAATAGAAAGAGGTGGG + Intergenic
1016523315 6:144971205-144971227 CAGGCTAATGAGAGAGAAGCTGG + Intergenic
1017346860 6:153393334-153393356 GAGAGATAACAGAGAGAAGGGGG - Intergenic
1017663423 6:156695787-156695809 CAGAAGAACAAGAGAGAAGCAGG - Intergenic
1017841468 6:158226058-158226080 CAGAGTCAAAAGATAGAAGTGGG + Intergenic
1018044847 6:159956695-159956717 CAGAGTTAATAAAGAGAAGCTGG + Intergenic
1019162414 6:170077698-170077720 CAGAGGACACAGCGAGAAGGCGG - Intergenic
1021801063 7:24306752-24306774 CAGATGAGATAGAGAGAAGCTGG + Intergenic
1022102391 7:27176172-27176194 GAGAGAAAAGAGAGAGAAACAGG + Intronic
1022838226 7:34136978-34137000 CAGAGAAAGCAGAGAGCAGAGGG + Intronic
1023070318 7:36425034-36425056 TAGAGAACACAGAGAGAAGAGGG - Intronic
1023915468 7:44585448-44585470 CAAAGTAACCAGAGAGATGAGGG - Intergenic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024568594 7:50705377-50705399 AAGGGGAAAAAGAGAGAAGCTGG - Intronic
1024653718 7:51431413-51431435 CAGAGCAGCCAGGGAGAAGCTGG + Intergenic
1024673401 7:51616880-51616902 CAGAGTGACCAGAGAGAACTGGG + Intergenic
1024862120 7:53856913-53856935 CAGAGAAAACTTAGAAAAGCAGG + Intergenic
1025279803 7:57619067-57619089 CAGAGGAGACAGAGAGCAGGAGG - Intergenic
1025304929 7:57846434-57846456 CAGAGGAGACAGAGAGCAGGAGG + Intergenic
1025638173 7:63342847-63342869 CAGTGAAGACAGAGTGAAGCAGG + Intergenic
1025644523 7:63405242-63405264 CAGTGAAGACAGAGTGAAGCAGG - Intergenic
1026212658 7:68319517-68319539 CTTAGAAAACAGAGAGAAGGAGG + Intergenic
1026509568 7:71016857-71016879 GTGAGGACACAGAGAGAAGCTGG - Intergenic
1027130308 7:75585811-75585833 CACAGAAAAAAGAGAGAAGAAGG - Intronic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1030148578 7:106380477-106380499 GGGAGAAAACAGAGAGAACCTGG + Intergenic
1031573434 7:123386673-123386695 CAGAGGAAACAGACTGAAGTAGG - Intergenic
1033015283 7:137664688-137664710 GAGAGAAAACAGACAGAACCAGG + Intronic
1033272183 7:139942322-139942344 CAGAATAAACAAAGTTAAGCAGG - Intronic
1033279746 7:139997203-139997225 CGGAGTAAATAGAGGGAACCAGG + Intronic
1033318898 7:140321956-140321978 CAGTGAAAACACAGAGAACCTGG + Intronic
1033630080 7:143148958-143148980 CAGAGTGAACAGAGGGGTGCAGG - Intergenic
1033630564 7:143153524-143153546 CACAGTAAAAAGGGAAAAGCAGG + Intergenic
1034913557 7:155018190-155018212 CAGAGTTATCACAGTGAAGCAGG - Intergenic
1035582072 8:746800-746822 CAGAGCAGACAGAGGGAACCTGG - Intergenic
1035704549 8:1665572-1665594 CAAAGGCAACAGAGAGACGCGGG - Intronic
1036191831 8:6678014-6678036 CAGAGTATACAGGAAGGAGCGGG + Intergenic
1036607337 8:10319131-10319153 CAGGGGAAACAGAGACCAGCAGG - Intronic
1036641421 8:10586505-10586527 CAGATTGTACAGAGAGAAGTAGG + Intergenic
1037541872 8:19879918-19879940 ATGAGAATACAGAGAGAAGCTGG + Intergenic
1037627361 8:20619800-20619822 CAGAGGAGACATAGAGAAGAAGG + Intergenic
1037636320 8:20703863-20703885 CAGAGGAAGTAGAGAGATGCAGG + Intergenic
1038694502 8:29794090-29794112 CAGAGTACAAAGAGAGAAAGAGG + Intergenic
1038698938 8:29831479-29831501 CAGAGCAAAGACAGAGAAGATGG + Intergenic
1038932779 8:32213791-32213813 CAGCTTAACAAGAGAGAAGCAGG + Intronic
1039574829 8:38614614-38614636 AAGAGTACACAGTGAGAAGGTGG + Intergenic
1040483740 8:47851115-47851137 CAGAGTAAACATAAAGAAGTTGG - Intronic
1040829763 8:51663640-51663662 CAGAGTAAACTGAGAAAACCTGG + Intronic
1041170608 8:55138371-55138393 AAGAGGAAAGAGAGAGGAGCTGG + Intronic
1041648229 8:60275365-60275387 CAGAGTAAACAGAGACAGGTAGG + Intronic
1041750787 8:61258913-61258935 TAGAGTAAACAGAGAGGAGGAGG + Intronic
1041878226 8:62715084-62715106 CAGAGGAGAGAGAGAGAAGTAGG + Intronic
1042544824 8:69942127-69942149 CAGAATATACAGTCAGAAGCGGG - Intergenic
1043456101 8:80413749-80413771 CAGAATAACCACAGACAAGCAGG + Intergenic
1044789676 8:95834673-95834695 CAGAGAAGACAGAGAGAATATGG + Intergenic
1044846995 8:96391813-96391835 CAGAGAACACTGAGAGATGCTGG + Intergenic
1044905940 8:97003085-97003107 AATAGGAAACAGAAAGAAGCAGG - Intronic
1046615014 8:116466823-116466845 CAGAGTAAACAGAAACAAATTGG + Intergenic
1046894980 8:119463005-119463027 CAGCGGAAACACACAGAAGCTGG + Intergenic
1047183705 8:122613464-122613486 CAGAGTTTCCAGAGAGAAGATGG - Intergenic
1047338536 8:123958286-123958308 CATAGAAGACAGAGAGCAGCTGG - Intronic
1047940722 8:129825448-129825470 CAGAGGACACAGTGAGAAGGTGG - Intergenic
1048940449 8:139396077-139396099 CAGGGCAGACAGAGAGAAGACGG - Intergenic
1049508548 8:143016405-143016427 CAGAGCACAGTGAGAGAAGCAGG + Intergenic
1050630916 9:7557585-7557607 AAAAGTAAACAGAGAGACACTGG + Intergenic
1050768220 9:9163020-9163042 CAGAGGAAAAAAAGAGAAGCTGG - Intronic
1050911392 9:11076272-11076294 CTGAGCAAAAAGAGCGAAGCTGG - Intergenic
1051404568 9:16721760-16721782 TAGAGAAAACAGAGTGAATCGGG - Intronic
1052030107 9:23618927-23618949 CAGAGTGAGCAGGGAGAAGGAGG - Intergenic
1052166858 9:25340404-25340426 CATAGGAAACATAGAAAAGCAGG + Intergenic
1052195174 9:25703891-25703913 CAGAGAGAAAAGATAGAAGCTGG + Intergenic
1052255560 9:26452361-26452383 CAGAGCAAAAAGAAAAAAGCTGG - Intergenic
1052515091 9:29470572-29470594 AATAGAAAACAGAGAAAAGCAGG - Intergenic
1052709472 9:32035769-32035791 CAGAGTATGAATAGAGAAGCAGG + Intergenic
1052723137 9:32196895-32196917 CTGAGTAAAAAGAGCAAAGCTGG - Intergenic
1053230324 9:36402189-36402211 CAGGACAAACAAAGAGAAGCTGG + Intronic
1053416847 9:37952143-37952165 AAGAGTCAACAGAGAGATACAGG + Intronic
1053874351 9:42528284-42528306 GAGGGTAAAGAGAGAGAAGGAGG + Intergenic
1053898262 9:42766304-42766326 GAGGGTAAAGAGAGAGAAGGAGG - Intergenic
1054267984 9:62938470-62938492 GAGGGTAAAGAGAGAGAAGGAGG - Intergenic
1054351331 9:64019164-64019186 CAGAGTAATCAGACAAAAGAAGG - Intergenic
1055001392 9:71453512-71453534 CAGAGGAATCCGAGGGAAGCTGG - Intergenic
1055712681 9:79081599-79081621 CAGATGAAACAGAGAGAAGGGGG + Intergenic
1055774028 9:79748585-79748607 GAGAGTGAACAGAGAGAATAAGG + Intergenic
1055871547 9:80886555-80886577 CAAGGTAACCAGAGAGAACCTGG + Intergenic
1056082104 9:83106255-83106277 AAGAATAAACAGAGAGATACGGG - Intergenic
1056115539 9:83437936-83437958 CAGGATAAAAAGAGAGAAGGGGG + Intronic
1056729733 9:89155317-89155339 AAGAGCAAGGAGAGAGAAGCCGG - Intronic
1057169592 9:92953513-92953535 CAGTGTGAGCAGCGAGAAGCTGG - Intronic
1057179670 9:93022983-93023005 CAGATTAAACGGAGGGAGGCAGG - Intronic
1057204661 9:93164091-93164113 CAGAGTGTCCAGGGAGAAGCTGG - Intergenic
1057779768 9:98040138-98040160 CAAAGGAAAGAGAGAGATGCCGG - Intergenic
1058288452 9:103209099-103209121 CAGGGGAGACAGAGAGAAGGGGG + Intergenic
1058517583 9:105792386-105792408 CACACTAAACAGACAAAAGCTGG - Intergenic
1059682992 9:116604523-116604545 CGGAGTAAGCAGAGAGCAGGCGG + Intronic
1059860474 9:118455034-118455056 AAGAGTAAAAAGAGAGAAAACGG - Intergenic
1060223816 9:121779399-121779421 CCAAGTATACAGAGAGAAGTAGG - Intronic
1060335606 9:122718969-122718991 GAGAGTAGAAAGGGAGAAGCTGG + Intergenic
1060374413 9:123105803-123105825 CAGATTAGACAGAGAGCAGGTGG + Intergenic
1060465371 9:123899548-123899570 CAGAATAGACAGGGAGTAGCAGG - Intronic
1060919692 9:127411308-127411330 AAGAGGAAACAGAGAAAATCAGG - Intergenic
1185742616 X:2546024-2546046 TAGAAGAAACAGAGTGAAGCAGG + Intergenic
1186213072 X:7270606-7270628 CAGAGTATACATAAAGATGCTGG + Intronic
1186740254 X:12509579-12509601 CAGAGGAAAGAGTGGGAAGCAGG + Intronic
1186891983 X:13968043-13968065 CAGAGTAAACACTGATATGCTGG - Intergenic
1187150736 X:16679429-16679451 CAGAGGAAAAAGAGAGAAAGTGG + Intronic
1187462846 X:19503050-19503072 CAGGGCATATAGAGAGAAGCGGG + Intronic
1188261350 X:28028401-28028423 CAAAGAAAAAAGAGAGAAGATGG - Intergenic
1188793986 X:34440238-34440260 CAAAGCAAAAAGAAAGAAGCTGG + Intergenic
1188806036 X:34591023-34591045 CAGGGTAAACTCTGAGAAGCTGG + Intergenic
1188950881 X:36373006-36373028 CTGAGCAAAAAGAGAAAAGCTGG - Intronic
1189153422 X:38730453-38730475 CAGTTTACACAGAGAGAGGCAGG - Intergenic
1189271042 X:39752177-39752199 GTGAGGAAACAGAGAGAAGGTGG + Intergenic
1189570405 X:42289892-42289914 CAGAGGAGACAGAGAGAAAGAGG - Intergenic
1189628964 X:42931603-42931625 CAGAAGAAAGAGAGAGAAGGGGG + Intergenic
1190434182 X:50407427-50407449 AAGAGTACACAGTGAGAAGGTGG - Intronic
1190444129 X:50505986-50506008 CTGAGTTAACATAGAGAAGTTGG + Intergenic
1190834849 X:54090984-54091006 CTGAGTAAATAGACACAAGCAGG + Intronic
1192245413 X:69367792-69367814 CTGAGAAAACAGACAGAAGGGGG - Intergenic
1192742348 X:73905443-73905465 CTCAGTAAACAGAAAGAAGCGGG + Intergenic
1193275333 X:79579841-79579863 CAGAAGAAAGAGAAAGAAGCAGG - Intergenic
1193998855 X:88401227-88401249 CAGAAGAAACAGAGAGCAGAGGG - Intergenic
1196234117 X:113259732-113259754 AACAGAAAACAGAGAAAAGCAGG - Intergenic
1197455101 X:126669984-126670006 CACAGAAAACAAAGAAAAGCAGG + Intergenic
1198254032 X:134909425-134909447 CAGAGTAAACAGCAAGAGCCAGG - Intronic
1198916146 X:141674411-141674433 TGGAGTCAACAAAGAGAAGCAGG - Intronic
1199418228 X:147611796-147611818 CACAGTAAGCAGAAAGAAGGTGG + Intergenic
1199516923 X:148688371-148688393 AAGAGTAAACTGAGATTAGCTGG - Intronic
1200062395 X:153489366-153489388 CACAGTAATCACAGAGAAGGTGG - Intronic
1201673138 Y:16548494-16548516 CATAGTAAACAGTGAAAAGGAGG + Intergenic
1201724176 Y:17135510-17135532 GAGAGTAAAAAGAGAGAGGAAGG + Intergenic
1201984500 Y:19951053-19951075 CTGAGTAAAAAGAGTGAAGGAGG - Intergenic