ID: 905941144

View in Genome Browser
Species Human (GRCh38)
Location 1:41864387-41864409
Sequence TCTCACCATTTCTAAAGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 8, 3: 23, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905941143_905941144 26 Left 905941143 1:41864338-41864360 CCTATGTCTTATGGATAAGAAAA 0: 1
1: 0
2: 5
3: 39
4: 438
Right 905941144 1:41864387-41864409 TCTCACCATTTCTAAAGCCCCGG 0: 1
1: 0
2: 8
3: 23
4: 184
905941142_905941144 30 Left 905941142 1:41864334-41864356 CCATCCTATGTCTTATGGATAAG 0: 1
1: 0
2: 1
3: 6
4: 135
Right 905941144 1:41864387-41864409 TCTCACCATTTCTAAAGCCCCGG 0: 1
1: 0
2: 8
3: 23
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905941144 Original CRISPR TCTCACCATTTCTAAAGCCC CGG Intronic
901624061 1:10613592-10613614 CCTCACCAGTACCAAAGCCCTGG - Intronic
903798666 1:25949925-25949947 TCTCACATTTTCTATAGCTCAGG - Intergenic
905356140 1:37386258-37386280 TCTGACCAATTCCAAAGCCAGGG + Intergenic
905538835 1:38744394-38744416 TCACTCCATTTTTGAAGCCCAGG + Intergenic
905941144 1:41864387-41864409 TCTCACCATTTCTAAAGCCCCGG + Intronic
906620870 1:47277447-47277469 CCACACCATCTTTAAAGCCCAGG - Intronic
909902748 1:81158870-81158892 TCTCACCATTCCTCTAGTCCTGG - Intergenic
911301964 1:96185451-96185473 TCAGACCATTTCCAGAGCCCAGG - Intergenic
911519535 1:98911958-98911980 TCTCACTATTGTTACAGCCCAGG + Intronic
911957014 1:104250114-104250136 TCTCACCGTTTCTATGGGCCTGG + Intergenic
914885594 1:151581840-151581862 TCTCACCATTCCCAAGCCCCTGG + Exonic
915093768 1:153444775-153444797 TCTCACCTTCCCTGAAGCCCCGG + Intergenic
915657844 1:157376483-157376505 TCTGTGCAGTTCTAAAGCCCGGG + Intergenic
915671213 1:157490490-157490512 TCTGTGCAGTTCTAAAGCCCGGG - Intergenic
916196152 1:162225231-162225253 TCTCACCTTTCCTGAAGGCCTGG + Intronic
917604132 1:176608733-176608755 TCTCCCTATTCCTAACGCCCAGG - Intronic
917675181 1:177312009-177312031 TCTCTGCCTTTCCAAAGCCCTGG + Intergenic
918380727 1:183952647-183952669 TCTATCCATTTATAAATCCCTGG + Intronic
920543482 1:206796918-206796940 TCTCACCCTTTGTCCAGCCCAGG + Intergenic
921304583 1:213782980-213783002 ACTCACCATTTCGGAAGCGCTGG + Intergenic
921995213 1:221410657-221410679 TCTCAATATATCAAAAGCCCTGG + Intergenic
922044016 1:221926100-221926122 TCTTCCTGTTTCTAAAGCCCAGG + Intergenic
1063107120 10:3002150-3002172 TCTCACCAACTCTACAGCCATGG - Intergenic
1065155723 10:22868567-22868589 TCTCACCCTTTCTGCAGCTCTGG - Intergenic
1069101093 10:64321676-64321698 TCTTACTGTTTCTAAAGCACTGG + Intergenic
1069237254 10:66092196-66092218 CCTCCCCATTTCTAAAATCCTGG + Intronic
1073965870 10:108989022-108989044 TTTCACCATTTTTATAGCCTTGG + Intergenic
1074789990 10:116877121-116877143 TCTCACCATTCACAAAGCCAAGG + Intronic
1074997904 10:118773592-118773614 TCTCACAATTGCTATAGCCAGGG + Intergenic
1075637643 10:124040429-124040451 TTTCAACATGTCTAAAGCTCCGG + Intronic
1078328766 11:10401686-10401708 TGTCCACATTTCTAATGCCCAGG + Intronic
1079181334 11:18196332-18196354 TCTCGCCGGTTCTAAAGCCTGGG - Intronic
1079611423 11:22436984-22437006 TCACACCAATTCCAATGCCCAGG - Intergenic
1082182549 11:49137673-49137695 TCTAACCACTTCTAAACCCCAGG + Intergenic
1083028955 11:59574634-59574656 TCTCACTCTATCCAAAGCCCCGG + Exonic
1083554029 11:63611732-63611754 TTTCATCATTTCTAAAGCAATGG + Intronic
1084936221 11:72588234-72588256 TGACACCATTTCTAGACCCCAGG + Intronic
1085179625 11:74522461-74522483 TCTAATCATTTCCAAAACCCTGG - Intronic
1088790498 11:113221626-113221648 TTTCACCATTTCAAAATGCCTGG - Intronic
1090886461 11:130881123-130881145 TCTCACAGTTTCTAAAGGCCGGG - Intronic
1095737626 12:45575103-45575125 TCTTACCTTGTCTAAAGCGCAGG - Intergenic
1098822624 12:75252270-75252292 TCTCACCATGTCTTAAATCCTGG - Intergenic
1098955135 12:76681642-76681664 TCTCACAGTTTCTATAGGCCAGG - Intergenic
1101424477 12:104576633-104576655 TCTGGTCATTTCCAAAGCCCAGG + Intronic
1104654840 12:130566741-130566763 TCTCACCATTTCTGAGGGTCAGG - Intronic
1106375310 13:29181078-29181100 TTTCGCCATTTCAAAAGCCTTGG + Intronic
1106433005 13:29699489-29699511 TGTTACCAATTCTAAAGGCCTGG - Intergenic
1106565239 13:30878947-30878969 TCTCACTATTTCTGGACCCCAGG + Intergenic
1107402987 13:40087222-40087244 CATCACCATTTCTAAAGGCCAGG - Intergenic
1108514486 13:51187231-51187253 TTTCACTATTTCCAAATCCCAGG + Intergenic
1108932080 13:55837722-55837744 TGTCAACATTTCTAGAGCCAGGG - Intergenic
1108984266 13:56563687-56563709 TCTCACAATTTTTTAAGCCCAGG + Intergenic
1109110515 13:58313309-58313331 TCTCACAATTTCTGAAGATCAGG + Intergenic
1110436638 13:75483224-75483246 TCTCACTTTTTATAAAGCCCTGG + Intergenic
1111378735 13:87417218-87417240 TCTCAACATTTCTAAAGTCCTGG + Intergenic
1111583659 13:90256624-90256646 TCTCATCACCTCTAAAGCCATGG - Intergenic
1113000833 13:105634191-105634213 TCTCACAAGTTTTTAAGCCCAGG - Intergenic
1113454325 13:110437352-110437374 TCCCACCTTTTCTACAACCCAGG + Intronic
1115396843 14:32918423-32918445 TCTCATCATCTCTGAAGCTCAGG - Intergenic
1118155776 14:63239960-63239982 TCTCACTATTTCTAATCCTCAGG + Intronic
1119891754 14:78188072-78188094 TTTCTCCATCTCTAAAGCCAGGG - Intergenic
1120022964 14:79550988-79551010 TCTGACTACTTCTAATGCCCAGG - Intronic
1121282952 14:92712676-92712698 TCTCCCCACTTCTATGGCCCAGG + Intronic
1122032974 14:98926946-98926968 TCTGGCTATTTCTAAAGGCCAGG + Intergenic
1124125741 15:26936984-26937006 TCTTCCCATGTCTAAAGGCCTGG - Intronic
1124163392 15:27295384-27295406 TGTAACCATTTCAAAAGCACGGG + Intronic
1125030060 15:35067164-35067186 TCTCCCCGTTCCTAAAGCTCTGG - Intergenic
1126667324 15:51087165-51087187 GCTCACAATTTCTTAAACCCTGG + Intronic
1127301753 15:57661831-57661853 TCTCACAAATTATAAAGCACTGG - Intronic
1127966295 15:63925172-63925194 ACTCTCCATTGCTAAATCCCTGG + Intronic
1128766011 15:70251614-70251636 CCTCACCATATGCAAAGCCCTGG - Intergenic
1130706145 15:86234831-86234853 CATCACCATTTCAAAAGTCCTGG + Intronic
1130861224 15:87892151-87892173 TCTCACCCATTCTAAATCTCAGG + Intronic
1134818008 16:17222147-17222169 TCTCTCCATTACTAACTCCCAGG - Intronic
1134866606 16:17612754-17612776 TTTCACCATTTATGAACCCCAGG - Intergenic
1135210241 16:20519792-20519814 TCTGTCCATTTTTAAAACCCTGG + Intergenic
1136514640 16:30760843-30760865 CCTCTCCATTTCTAAAGCCTAGG + Exonic
1138130309 16:54473659-54473681 ACTTACCATTTCTAAACCACTGG - Intergenic
1141223452 16:82092656-82092678 TCTCTGCATTTCTATCGCCCTGG - Intronic
1143457759 17:7078740-7078762 TCTTACCATTTTTAAACCCCTGG + Exonic
1143596447 17:7916872-7916894 TCCCAGCATTCCTAAAGCCATGG - Intergenic
1144359116 17:14474909-14474931 TCTCATCACTTCTGAAGCCAAGG - Intergenic
1150148204 17:62788726-62788748 TCTCACCAAGTATAAAGACCAGG + Intronic
1150837319 17:68576219-68576241 TGTCACCATTTCTGGAGCCATGG + Intronic
1151859143 17:76746660-76746682 TCACTGCATTTCTAGAGCCCAGG - Intronic
1154227307 18:12517576-12517598 TCTCACCATATCTCAAGCACAGG - Intronic
1155071132 18:22317259-22317281 TCTCACAGTTTCTAGAGGCCGGG - Intergenic
1156939556 18:42749544-42749566 TGTCAAAATTTATAAAGCCCAGG + Intronic
1157288479 18:46393455-46393477 CAGCCCCATTTCTAAAGCCCTGG - Intronic
1164392861 19:27840854-27840876 TCACACCATTTTTAAAACCAAGG - Intergenic
1166368676 19:42290018-42290040 TCTCCCCCTCTCTCAAGCCCGGG - Intronic
926245400 2:11119459-11119481 TCCCAACATTGCTAAAGCCACGG + Intergenic
927378587 2:22450089-22450111 CCTGACCATTTCTAGAGTCCTGG + Intergenic
928142795 2:28745119-28745141 TCAGTCCAATTCTAAAGCCCTGG - Intergenic
930303644 2:49649795-49649817 ACTCTCCATTGCAAAAGCCCAGG - Intergenic
933906332 2:86897346-86897368 TCGCTCCATTTATAGAGCCCAGG - Intergenic
935776214 2:106474411-106474433 TCGCTCCATTTATAGAGCCCAGG + Intergenic
935805100 2:106737784-106737806 TCTCACCTTTTCCCAAGCCTTGG + Intergenic
937272955 2:120665859-120665881 TCTCACCATTACTACAGGTCAGG - Intergenic
938154838 2:128926188-128926210 TATCAGCATTGCTAAAGTCCAGG + Intergenic
938760001 2:134416291-134416313 TCTCCCCACTTCTCAACCCCTGG + Intronic
938779649 2:134573871-134573893 TGCCTCCATTTCTAGAGCCCAGG + Intronic
941701964 2:168613274-168613296 TCTAACCATCTCTATATCCCTGG - Intronic
942530920 2:176909396-176909418 TCTCACCATTACCAATGGCCAGG + Intergenic
942701344 2:178714594-178714616 TCTCACAAATTTTAAAACCCAGG - Intronic
945208418 2:207356944-207356966 TCTGGCCATTTCTGAGGCCCAGG + Intergenic
946309321 2:218873969-218873991 CCTCACCATTTCCAGAGCCCTGG - Exonic
946725042 2:222654054-222654076 TCTCACCATTTTTAAAAATCTGG + Intronic
947967263 2:234291749-234291771 CCTCCCCATTTCTGAATCCCTGG + Intergenic
948021264 2:234735408-234735430 TCTCACCATTTCTCTGGGCCAGG - Intergenic
1168802063 20:650071-650093 TCTGACCATTCCTGGAGCCCTGG - Intronic
1171036093 20:21714044-21714066 CCTCACCCTTTCCAAACCCCAGG - Intronic
1174511999 20:51060428-51060450 TTTCTTCATTTCTACAGCCCTGG + Intergenic
1175876811 20:62234161-62234183 TCTAACCAGTTCTAAAGGGCAGG + Intronic
1176605672 21:8828381-8828403 TCTCACCATTGCCAGGGCCCTGG - Intergenic
1177697788 21:24595802-24595824 TCTCACCAGTTTTACAACCCAGG + Intergenic
1178356203 21:31912326-31912348 TCTCACCCTTTTTCAAGGCCAGG - Intronic
1180347969 22:11719985-11720007 TCTCACCATTGCCAGGGCCCTGG - Intergenic
1180355747 22:11838087-11838109 TCTCACCATTGCCAGGGCCCTGG - Intergenic
1180382508 22:12154238-12154260 TCTCACCATTGCCAGGGCCCTGG + Intergenic
1180861917 22:19088246-19088268 TCTCACCATTCCTGGTGCCCAGG - Intronic
1181157615 22:20933890-20933912 TCTCACCCTTTTTAAAGGGCAGG - Exonic
1184942626 22:47780388-47780410 ACTCACTCTTTCTAAAGCCTTGG + Intergenic
949989685 3:9568912-9568934 ACTCACCCTACCTAAAGCCCTGG + Intergenic
950635788 3:14313545-14313567 TCTCACCATCTCTTAAGACCAGG + Intergenic
951362007 3:21736599-21736621 TATCCCCATTTGTAAAGCACAGG + Intronic
952087058 3:29836540-29836562 TTTCCCCATTTCTATACCCCTGG - Intronic
952460205 3:33516639-33516661 TCTCACTCATTCTCAAGCCCAGG - Intronic
953229897 3:41055368-41055390 TCTCCCCTTTTCTCAAGCCCAGG + Intergenic
956057673 3:65317794-65317816 TCTCACAATTTCTATAGGGCAGG - Intergenic
956538291 3:70304525-70304547 TTTCACAATTTCTAAAGCCGGGG + Intergenic
957353852 3:79057601-79057623 TTTCACCATTTCTATTACCCTGG + Intronic
960489598 3:118298122-118298144 GCTCACCATTTCCACAGCTCTGG + Intergenic
961832736 3:129632522-129632544 TCTCTCCCTTTCTAAAGCTGGGG + Intergenic
962215966 3:133522048-133522070 TGTCACAATCTCTAGAGCCCGGG + Intergenic
963866078 3:150363090-150363112 TCTACCCATTTCCAAAGCCAAGG - Intergenic
970013189 4:11483003-11483025 TGGCACCATTTCTAAACCCCTGG + Intergenic
970432773 4:16003952-16003974 TGTCACCATTTTTAAAGAGCAGG + Intronic
972279130 4:37585756-37585778 CTACCCCATTTCTAAAGCCCAGG - Intronic
972641731 4:40931495-40931517 TCTCAGCACTTCGAGAGCCCAGG - Intronic
973372437 4:49262608-49262630 TCTCACCATTGCCAGGGCCCTGG + Intergenic
973388564 4:49532533-49532555 TCTCACCATTGCCAGGGCCCTGG - Intergenic
974495592 4:62622962-62622984 TTCCACCCTTTCTAAAGCTCTGG + Intergenic
977418436 4:96764629-96764651 TCTCAGCATTTCCACATCCCTGG - Intergenic
979536132 4:121823094-121823116 TCTCTCCACTTTTAAACCCCAGG - Intronic
979728851 4:123997432-123997454 TCTCATAATTTTTAAAGCCTTGG - Intergenic
984385814 4:179056171-179056193 TCTCACCATTTTTAGAGGCTGGG - Intergenic
985963327 5:3320390-3320412 TCACCCCCTTTCTAAAGCCCAGG + Intergenic
986192716 5:5511726-5511748 ACTCCCCATTTGGAAAGCCCTGG - Intergenic
986298037 5:6455780-6455802 TATCACCACTTCTGAAGCTCTGG - Intronic
987822039 5:22977939-22977961 TCTCACCAGTTTTACAACCCAGG - Intergenic
989641686 5:43589179-43589201 TCTCACCAGTTCCACAGCACAGG + Intergenic
991478838 5:67054728-67054750 TTTCTCCATTTCTAAATGCCTGG + Intronic
991560305 5:67944229-67944251 TCCCTACTTTTCTAAAGCCCTGG + Intergenic
991968603 5:72116091-72116113 TCTCTCTCTTTCTCAAGCCCTGG - Intronic
992727228 5:79620316-79620338 TCTCCCCTTTTCTATATCCCAGG + Intronic
993021361 5:82595447-82595469 TATCTCCATTTCTATAGGCCAGG + Intergenic
995501097 5:112807901-112807923 TCTCAGCATTTCCAGAGGCCGGG + Intronic
998352258 5:141509200-141509222 TCTCTCTATTTCTCAATCCCTGG + Intronic
1001046326 5:168374816-168374838 CCTGACCATTGCTACAGCCCAGG - Intronic
1003464436 6:6364936-6364958 TCTCATCCTTTCTTTAGCCCTGG - Intergenic
1006022209 6:31123926-31123948 TCTCATCATTCCTCAAGGCCCGG - Intronic
1007968195 6:46023418-46023440 TCCCTCCATTGCTAAAGCCCAGG + Intronic
1012982031 6:105840981-105841003 TCTCCCCATCACTAAATCCCTGG + Intergenic
1014287789 6:119521029-119521051 TCTTACCATTTCTAAGGCTGTGG - Intergenic
1015059081 6:128940698-128940720 TCCCAGCATTTCTAGAGACCAGG + Intronic
1019449326 7:1088669-1088691 TCTCACCAACCCTGAAGCCCTGG + Intronic
1020570624 7:9856295-9856317 ATTTACCATTTCTAAAGCCCTGG - Intergenic
1020935194 7:14454951-14454973 TCTTACCAGTTCTGAAGCCTAGG - Intronic
1021438449 7:20649286-20649308 TCTCACCATTTGTAAAGCAATGG - Intronic
1022655863 7:32318974-32318996 TCTCATCATTTCAAAAGAACCGG + Intergenic
1026055596 7:66980928-66980950 TCTCACAATTTCTAAAGGGCAGG + Intergenic
1026106415 7:67424411-67424433 TCTCCCCATCTCTTAGGCCCTGG + Intergenic
1026722097 7:72840891-72840913 TCTCACAATTTCTAAAGGGCAGG - Intergenic
1030238495 7:107293152-107293174 AATCACTATTTCAAAAGCCCAGG + Intronic
1030434824 7:109503285-109503307 GCTCATCATTTCTAAAACACAGG - Intergenic
1031868894 7:127070789-127070811 TGTCACCAGTTCTAAAACCCTGG - Intronic
1039721796 8:40172777-40172799 ACTCACCAATTCCAAATCCCAGG + Intergenic
1040374843 8:46814978-46815000 TCCCACCATTTTAAAGGCCCAGG - Intergenic
1040377757 8:46842873-46842895 TCCCACCATTTTAAAGGCCCAGG - Intergenic
1041441046 8:57897375-57897397 CCTCCCCAATTCCAAAGCCCAGG + Intergenic
1043449644 8:80353680-80353702 TCTCACCCTCTCTAACCCCCAGG + Intergenic
1045882137 8:107053702-107053724 TCTGACCATTTCTAGAATCCTGG - Intergenic
1047961942 8:130017017-130017039 TGTCACCATTCCTGAAGTCCAGG - Intronic
1052458450 9:28731524-28731546 TCTCTTCATTCCTAAACCCCTGG - Intergenic
1052862375 9:33444913-33444935 TCTCCCCATTTCTACAGCCCTGG - Intronic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1057726773 9:97573576-97573598 ACTCACCATTTCTGAGGGCCAGG + Intronic
1061391051 9:130317160-130317182 TCTGTCCAATGCTAAAGCCCAGG - Intronic
1203553066 Un_KI270743v1:180389-180411 TCTCACCATTGCCAGGGCCCTGG - Intergenic
1185698820 X:2215036-2215058 TCTTTCCATTTCTAGAGACCCGG - Intergenic
1186573531 X:10741123-10741145 CCTTTACATTTCTAAAGCCCAGG + Intronic
1189403671 X:40696879-40696901 TCTCCCCAATTCTAAACCCCTGG + Intronic
1195121830 X:101762259-101762281 TCTGACCATTTCTCAAGCCCTGG + Intergenic
1195236693 X:102906375-102906397 TCTGACCATTTCTCAAGCCCTGG - Intergenic
1195238537 X:102927048-102927070 TATGACCATTTCTCAAGTCCTGG - Intergenic
1195239104 X:102933446-102933468 TCTGACCATTTCTCAAACCCTGG - Intergenic
1195239377 X:102935801-102935823 TCTGACCATTTCTTAAGCCTTGG - Intergenic
1195240790 X:102949859-102949881 TCTGACCATTTATCAAGGCCTGG - Intergenic
1195248118 X:103015222-103015244 TCTGACCATTTCTCAAGCCCTGG - Intergenic
1195265426 X:103174920-103174942 TCTGACCATTTCTCAAGCCCTGG - Intergenic
1195296861 X:103487089-103487111 TCTGACCATTTCTCAAGCCCTGG - Intergenic
1195298923 X:103508257-103508279 TCTGACCATTTCTCAAGCCCTGG + Intronic
1195301928 X:103538518-103538540 TCTGACCGTTTCTCAATCCCTGG + Intergenic
1195821120 X:108946353-108946375 TCTCACCTTTTCAAAAGCAGAGG + Intergenic
1198566750 X:137913319-137913341 TCTCACCTTTTCTAAAACAAGGG + Intergenic
1200870708 Y:8095098-8095120 TCCCACCATTTTAAAGGCCCAGG + Intergenic
1202244721 Y:22808301-22808323 TCCCACCATTTTAAAGGCCCAGG - Intergenic
1202260394 Y:22964208-22964230 TCCCACCATTTTAAAGGCCCTGG - Intergenic
1202267654 Y:23037584-23037606 TCCCACTATTTTAAAAGCCCAGG - Intergenic
1202397710 Y:24442047-24442069 TCCCACCATTTTAAAGGCCCAGG - Intergenic
1202413381 Y:24597949-24597971 TCCCACCATTTTAAAGGCCCTGG - Intergenic
1202420646 Y:24671328-24671350 TCCCACTATTTTAAAAGCCCAGG - Intergenic
1202450140 Y:24998754-24998776 TCCCACTATTTTAAAAGCCCAGG + Intergenic
1202457401 Y:25072119-25072141 TCCCACCATTTTAAAGGCCCTGG + Intergenic
1202473071 Y:25228040-25228062 TCCCACCATTTTAAAGGCCCAGG + Intergenic