ID: 905941658

View in Genome Browser
Species Human (GRCh38)
Location 1:41867923-41867945
Sequence TTTTGGAAGGGGAGGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1693
Summary {0: 1, 1: 0, 2: 16, 3: 163, 4: 1513}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905941658 Original CRISPR TTTTGGAAGGGGAGGGGGGA GGG (reversed) Intronic
900278302 1:1847778-1847800 TTTTAAAAGGGTAGGGGGGTGGG + Intronic
900808990 1:4786941-4786963 TTGTGGAAGGGGCAGGGGTAGGG - Exonic
900837807 1:5019355-5019377 TTTTCAAAGGGAAGGGGAGATGG + Intergenic
900857455 1:5197408-5197430 ATTTGGTGGGGGAGGGGGGATGG + Intergenic
901004372 1:6164793-6164815 TCTTGGAAGGGGAAGGGGGCTGG - Intronic
901095564 1:6676435-6676457 TTTGGGAGGCTGAGGGGGGAGGG + Intronic
901183385 1:7356975-7356997 TGATGGGAGGGAAGGGGGGAAGG - Intronic
901285719 1:8077126-8077148 TTTTAGCAGGGGTTGGGGGAGGG + Intergenic
901319100 1:8328917-8328939 TTTCAGGAGGGGAGGAGGGAAGG + Intronic
901446940 1:9314302-9314324 TTTAGGAGCGGGAGGGAGGAAGG - Intronic
901631500 1:10650337-10650359 GTTTAAAAGGGGATGGGGGAGGG - Intronic
901641745 1:10696073-10696095 TTTTGCAAAGGGAGGGGCCAGGG + Intronic
901648902 1:10732080-10732102 TTTGGGAGGGTGAGGCGGGAGGG + Intronic
902252520 1:15163826-15163848 TTGGGGGGGGGGAGGGGGGAGGG + Intronic
902356185 1:15902565-15902587 TTTTGGAGGCCGAGGTGGGAAGG + Intronic
902381064 1:16052455-16052477 TTTGGGAAGGGCTGGGGTGAAGG + Intronic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
903049090 1:20587665-20587687 GTTTGGATGGGGAATGGGGAAGG - Intergenic
903054997 1:20629722-20629744 TTTGGGAAGCTGAGGGAGGAAGG + Intergenic
903131215 1:21280579-21280601 TTTGGGAAGGGCAGGGTGGAGGG + Intronic
903270867 1:22187479-22187501 TGGAGGAAGGGGAGGGGAGAGGG - Intergenic
903323728 1:22557284-22557306 TGCTGGAAGGGGAGGAGAGAGGG + Intergenic
903380835 1:22895961-22895983 CTTAGGAGGAGGAGGGGGGAGGG + Intronic
903646609 1:24899942-24899964 TTTTGTCAGGGGATGGGGGATGG + Exonic
903869037 1:26419070-26419092 TTTTTGGAGGGGATGGGGAAGGG + Intronic
903971040 1:27118974-27118996 TTTTAGAAGAGGCTGGGGGATGG + Intronic
903972312 1:27126996-27127018 TTTTGCGGGGGGAGGGGGCAGGG + Intronic
904012470 1:27397798-27397820 TTTTGGTTGGGGGGTGGGGACGG - Intergenic
904389651 1:30173861-30173883 CTTTGGAAGGGGGTGGGGCAGGG - Intergenic
904407224 1:30300204-30300226 TTTAGGAAGGGGAGGGGAAGAGG + Intergenic
904564146 1:31417509-31417531 TTTTTAAAAGGGAGGGGGCAGGG - Intronic
904686289 1:32263147-32263169 TTTGGGAAGCGGAGGTGGGCAGG + Intronic
904840370 1:33368498-33368520 TTGTGGGAGGGCAGGGGGGTGGG - Intronic
905194047 1:36260343-36260365 GCTGGGAAGGGGAGTGGGGAAGG - Intronic
905241781 1:36586282-36586304 TCGTGGGAGGGGAGGGGAGAAGG + Intergenic
905743251 1:40390548-40390570 TTGAGGAAGGGGAGTGTGGATGG + Intronic
905854567 1:41300083-41300105 TTTTTGTGGGGGAGGGGGGTGGG + Intergenic
905941658 1:41867923-41867945 TTTTGGAAGGGGAGGGGGGAGGG - Intronic
905946606 1:41906513-41906535 TTTTGCAAGGGGATGGGGGTAGG + Intronic
906080509 1:43085205-43085227 TTTTGGTGGGGGTGGGGAGAGGG - Intergenic
906161203 1:43650314-43650336 TTTTGGTGGGGGAGGGGCGGTGG + Intronic
906797411 1:48708937-48708959 AGTTGGAAGGGAAGAGGGGAAGG + Intronic
907091735 1:51731262-51731284 TTGGGGCAGGGGCGGGGGGAAGG - Intronic
907126658 1:52056435-52056457 TGTCGGAAGGGGAGGGCGGGGGG - Intronic
907429492 1:54404010-54404032 TTTTAGTGGGGGAGGGGGGCGGG + Intronic
907718154 1:56946988-56947010 TTTAGGAAGGGTAAGGGAGAAGG - Intronic
908114321 1:60925941-60925963 TTCTGGCAGGGAAGGGTGGAGGG - Intronic
908193606 1:61727711-61727733 TTTTGGAGGGAGAGGGAGGACGG - Intergenic
908331478 1:63074970-63074992 TTGAGGATGGGGAGGGAGGAGGG - Intergenic
908418366 1:63935134-63935156 TGTTGGCAGGGGAGGGAGGTTGG - Intronic
908475487 1:64483861-64483883 ATATGCAAGGGGGGGGGGGAAGG - Intronic
908492366 1:64658940-64658962 TTTTGGAGGGGTGGGGTGGATGG - Intronic
908549206 1:65192510-65192532 TTTTGGAGGGGGAGGTGGGTAGG - Intronic
908920809 1:69189240-69189262 GTGGTGAAGGGGAGGGGGGAAGG - Intergenic
908953077 1:69586373-69586395 TTTTGGCAGGGGGTGGGGCAGGG + Intronic
909011494 1:70340091-70340113 TTTTGGAAGGGCAAGGTGGGAGG - Intronic
909545420 1:76841170-76841192 TGTTGGAAGGGGTGGTGGGGAGG + Intergenic
909871951 1:80752154-80752176 TCTAGGAAGGGGAGGAGGAAGGG + Intergenic
910182691 1:84503518-84503540 TTTTGGAAGGCGGGGGATGAGGG - Intronic
910232543 1:85001198-85001220 TTTTGGTGGGGGAGGGGGATTGG - Intronic
910760001 1:90724193-90724215 TTTTGGAGGGCCAGGGGGGTGGG - Intergenic
910840680 1:91558426-91558448 TTGGGGAGGGGGAAGGGGGATGG - Intergenic
910875309 1:91872958-91872980 TTTTTGACGGGGTGGTGGGAGGG + Intronic
911193068 1:94966920-94966942 TTCTGCAGGGGGAGAGGGGAAGG + Intergenic
911215393 1:95187688-95187710 GTATGGAAGGGGCAGGGGGAGGG - Intronic
911223279 1:95275219-95275241 GTTTGGAAGGGGAGGGGAAAGGG + Intergenic
911611057 1:99959663-99959685 TTTAGGAAGGGGAGGCGAGGGGG - Intergenic
912297509 1:108484609-108484631 TTTTGGAAGTGGAAGGGGGCCGG - Intergenic
912626630 1:111210394-111210416 TTTTGGAGTGGGACAGGGGAAGG - Intronic
912664490 1:111566879-111566901 TTTTGGAGGGGGGAGGAGGAAGG + Intronic
912949206 1:114108999-114109021 TTGTGGGAGGGTAGGGGGGCTGG + Intronic
913211483 1:116586275-116586297 TTTTGGATGGGGAGGGAGAAAGG - Intronic
913596375 1:120381937-120381959 TTGGGTAGGGGGAGGGGGGAGGG + Intergenic
914090895 1:144497038-144497060 TTGGGTAGGGGGAGGGGGGAGGG - Intergenic
914307708 1:146437169-146437191 TTGGGTAGGGGGAGGGGGGAGGG + Intergenic
914326135 1:146618674-146618696 TTGTGGAAGGGGAAAGGGCATGG + Intergenic
914334084 1:146699423-146699445 GATTGGAAGAGGAGGGTGGAAGG + Intergenic
914694017 1:150059299-150059321 TTTTGGGAGGCGGGGGGGGGGGG - Intergenic
914828966 1:151156899-151156921 TTTTGGATGCGGTGGGGGCAGGG + Intronic
914992493 1:152510977-152510999 TTCTGGAAGGGGAGGGTGGAAGG + Exonic
915007758 1:152655875-152655897 TTGGGGAAGGGAAGGAGGGAGGG - Intergenic
915026865 1:152839047-152839069 TGGTGGGGGGGGAGGGGGGAGGG - Intergenic
915147957 1:153806490-153806512 CTGGGGAAGGGGAGGGGGTAGGG - Exonic
915251479 1:154592275-154592297 CTTAGGAAGGAGAGGGGGAAGGG - Intronic
915373750 1:155373910-155373932 TTTTGGAAGGCCAGGGTGGGCGG - Intronic
915530457 1:156499948-156499970 TTTGGGAAGCGGGGGAGGGAGGG - Intronic
915794304 1:158711424-158711446 GGTTGGAGGGGGAGTGGGGATGG - Intergenic
915804862 1:158835609-158835631 TTTTGGTGGGGGCGGGGGGTGGG + Intronic
915839074 1:159201091-159201113 TTTGGAATGGGGAGGGAGGAGGG + Exonic
915862406 1:159458813-159458835 TGGGGGAGGGGGAGGGGGGAGGG + Intergenic
915931016 1:160061098-160061120 TTTGGGAAGGAGTGGGGGCATGG - Intronic
916069678 1:161162591-161162613 TGTTGGGATGGGAGTGGGGAAGG - Intronic
916070188 1:161165538-161165560 TTTTAATCGGGGAGGGGGGAGGG + Exonic
916168356 1:161982677-161982699 TCCTGGAAGGGAAGGTGGGAGGG + Intergenic
916277322 1:163008782-163008804 TTTTAGAAAGGGGGAGGGGAAGG + Intergenic
916433902 1:164759210-164759232 TTTTTGCAGGTGAGGGTGGAAGG + Intronic
916564751 1:165964795-165964817 TTGGGTGAGGGGAGGGGGGAGGG - Intergenic
916704752 1:167337674-167337696 TTTTGCAGGGGGTGGGGTGAGGG - Intronic
917284472 1:173410019-173410041 ATTTGGAAGGCCAGGGTGGATGG + Intergenic
917316551 1:173731714-173731736 TTGTGTTGGGGGAGGGGGGAGGG + Intronic
917984521 1:180302036-180302058 TATTGGGGGGGGAGGGTGGAGGG + Intronic
918855337 1:189747470-189747492 GTTGGGGAGGGGAGGGGGGAGGG + Intergenic
919289726 1:195614169-195614191 TTGGGTGAGGGGAGGGGGGAAGG - Intergenic
919352591 1:196477577-196477599 TTTTGGAGGGGGAGGGGAAAGGG - Intronic
919468312 1:197948748-197948770 TTTTAAAAGGGGAGTTGGGAAGG - Intergenic
919982043 1:202647826-202647848 ATTTGGAGGGGGAGGGAGGAGGG - Intronic
920002539 1:202809728-202809750 TTTTGGCGGGAGACGGGGGACGG + Intergenic
920039005 1:203084030-203084052 ATCTGTAAGGGGAGGTGGGAAGG + Exonic
920101900 1:203522054-203522076 TGGTGGCAGGGAAGGGGGGATGG - Intergenic
920210076 1:204321561-204321583 TATGGGAAGGGTAGGGTGGAAGG - Intronic
920227191 1:204447342-204447364 CTTTGGGAGTGGAGGTGGGAAGG - Intronic
920273648 1:204787289-204787311 TGGTGGAAGGGGAAGGGGAAGGG - Intergenic
920562340 1:206947749-206947771 TGTTGGGGGGGGTGGGGGGAGGG - Intergenic
920760764 1:208781889-208781911 TTTAGGAGGGGGAGCGGGAAGGG - Intergenic
920784450 1:209027429-209027451 TTTTTGAAGGGGAAGGTGGGGGG + Intergenic
921010018 1:211132784-211132806 TTCTGGAAGGGGTGGGGTGGGGG + Intronic
921241599 1:213189774-213189796 GTTCGGAAGGGGAAGTGGGAAGG - Intronic
921468864 1:215524696-215524718 TACTAGAAGGGGAGGGAGGAGGG - Intergenic
921498890 1:215875987-215876009 CTATGGAGGGGGCGGGGGGAAGG + Intronic
921573295 1:216803990-216804012 ATTTGGAAAGGGAGGGCAGATGG - Intronic
921624199 1:217359956-217359978 TTGGGTGAGGGGAGGGGGGAGGG + Intergenic
921752885 1:218817994-218818016 CTCTGTAAGGGGAGGGGGGCGGG - Intergenic
922002463 1:221493904-221493926 TTGAGGAAGGAGAGAGGGGAAGG - Intergenic
922047626 1:221962052-221962074 TTTTGGAGGGGCGGGGGTGAAGG - Intergenic
922069070 1:222173549-222173571 TGGTGGAAGGGGAAGGGGAAGGG + Intergenic
922110965 1:222554827-222554849 TTTTATGAGGGGAGGTGGGAAGG + Intergenic
922268248 1:224008500-224008522 TGGGGGAGGGGGAGGGGGGAGGG + Intergenic
922350102 1:224728288-224728310 TCTTTGAATGGGAGGGGGTAGGG + Intronic
922360168 1:224813959-224813981 TGTTGGTAGGGGTTGGGGGAGGG - Intergenic
922383298 1:225055677-225055699 GTGTGGTGGGGGAGGGGGGAGGG - Intronic
922547612 1:226470334-226470356 TTTGGGAAGCTGAGGTGGGAGGG - Intergenic
922689440 1:227676663-227676685 GTGGGGAGGGGGAGGGGGGAGGG - Intronic
922868358 1:228880213-228880235 TTTGGGGAGGGGAGAGGGGCTGG - Intergenic
922911551 1:229221937-229221959 TTCTGGAAAGGAAGGGGAGAAGG + Intergenic
922934278 1:229411486-229411508 GCTGGAAAGGGGAGGGGGGAGGG - Intergenic
923051759 1:230395029-230395051 TCTGGGACGGGGAGGAGGGAGGG - Intronic
923333583 1:232947610-232947632 TGTAGGAAGGGGTGGGGTGAGGG + Intergenic
923401290 1:233617662-233617684 TTTTGGGAGGCCAGGGTGGAAGG + Intronic
923615997 1:235537896-235537918 TTTTTGAGGGGGAGGGGGAGGGG + Intergenic
924048124 1:240053150-240053172 TTTTGGAGCGGGGAGGGGGATGG - Intronic
924506961 1:244695219-244695241 TTTTGGAAGGGTAGGGAAAAGGG - Intronic
924715370 1:246567844-246567866 TTTTTTAAGGGGAGAGGGGGAGG - Intronic
1062777814 10:169010-169032 TCTTGGAGCGGGAGGGGGAAAGG + Intronic
1063218261 10:3943353-3943375 TTTTGGAGTGGGTGGGGGGTCGG + Intergenic
1063331874 10:5167629-5167651 TGTTGTGAGGGGAGTGGGGAGGG + Intergenic
1063391361 10:5651757-5651779 CTTCGGAAGGCGAGGAGGGAGGG + Intronic
1063449611 10:6142755-6142777 TTTGGGGAGGGGAGAGGGGCTGG - Intergenic
1063485961 10:6421239-6421261 CTTTGGAAGGCTAAGGGGGAAGG + Intergenic
1063669831 10:8091150-8091172 TTTGGGAAGGTGAGAGGGGAGGG + Intergenic
1063813454 10:9742055-9742077 TGGTGGAAGGGGAGGCAGGAAGG - Intergenic
1064018189 10:11788760-11788782 TTTGGGAGGCGGAGGTGGGAGGG - Intergenic
1064510344 10:16083153-16083175 TGTGGGGTGGGGAGGGGGGAAGG - Intergenic
1064525233 10:16249268-16249290 TACTAGAAGGGGAGGGAGGATGG + Intergenic
1064863115 10:19848810-19848832 TTTTGGAAGGGGAGGATGGCAGG + Intronic
1065248148 10:23780682-23780704 TTTTGGGAGGGTGGGGGGAATGG + Intronic
1065276197 10:24088436-24088458 TTGAGTAGGGGGAGGGGGGAGGG - Intronic
1065747998 10:28859310-28859332 TTTTGGGGGGGGTGGGGGGCGGG + Intronic
1065816099 10:29484157-29484179 TTTGGGAAGGGAAGAGGGGGAGG - Intronic
1065837806 10:29675080-29675102 TTTTCGAAGAGGAGGAGAGAGGG + Intronic
1065960669 10:30731904-30731926 TTTTGTAAGTGGAAGGGGCATGG - Intergenic
1066426420 10:35311671-35311693 TTTTGGGGGGGTGGGGGGGACGG - Intronic
1066728235 10:38412878-38412900 TTTTGGTAGGGAAGGGGTGGGGG + Intergenic
1067129228 10:43546569-43546591 TTTTTGGGGGGGCGGGGGGAAGG - Intergenic
1067448421 10:46367037-46367059 ATGTGGAGGGGGTGGGGGGAAGG + Intergenic
1067473825 10:46553705-46553727 TTGTGGAGGGGGAATGGGGAAGG - Intronic
1067588954 10:47493729-47493751 ATGTGGAGGGGGTGGGGGGAAGG - Intergenic
1067636080 10:48001820-48001842 ATGTGGAGGGGGTGGGGGGAAGG - Intergenic
1067818302 10:49501458-49501480 TTTTGCAGGGGGAGGGGTTAAGG - Intronic
1068226053 10:54108267-54108289 TTCTGCCAGGGGATGGGGGAGGG - Intronic
1068298522 10:55107737-55107759 TTTTGGAGGCTGAGGGGGGTGGG - Intronic
1068438367 10:57019568-57019590 TTGTGGAAGGGGCAGTGGGAGGG - Intergenic
1068563841 10:58548799-58548821 TTTGGGGAGGGGAGGGGACAGGG + Intronic
1068665276 10:59668367-59668389 GGTTGGAAGGGGAGTGGGGATGG - Intronic
1068723148 10:60269638-60269660 TTGGGGGGGGGGAGGGGGGATGG - Intronic
1068780463 10:60914188-60914210 TTTTGGGTGTGGAGGGGGCAGGG + Intronic
1068868459 10:61919033-61919055 TTTGGGGGGGGGGGGGGGGACGG - Intronic
1068918774 10:62461564-62461586 TATTGGAATGGGAGGGGGATGGG - Intronic
1069037889 10:63664601-63664623 TGTTGGGAGGGGCGGGGGGAGGG + Intergenic
1069085691 10:64137088-64137110 ATTGGGAGGGGGAGGTGGGAGGG + Intergenic
1069467060 10:68650398-68650420 TTTGGGAGGGGGAGGCGGGTGGG + Intronic
1069647488 10:70013091-70013113 CTTTGGAAGGCCAAGGGGGAAGG - Intergenic
1069973978 10:72198080-72198102 GAAGGGAAGGGGAGGGGGGAGGG + Intronic
1069989337 10:72304973-72304995 TTTTTGTGGGGGAGGGGAGATGG + Intergenic
1070065267 10:73027634-73027656 TCAGGGAGGGGGAGGGGGGAGGG + Intronic
1070077077 10:73146993-73147015 TTTGGGAAGCAGAGGTGGGAGGG + Intronic
1070132639 10:73665827-73665849 ATGTGGAGGGGGTGGGGGGAAGG - Intergenic
1070229994 10:74555500-74555522 TTTTGGAAGGCCAAGGTGGAAGG + Intronic
1070411195 10:76142832-76142854 TTGGGTAGGGGGAGGGGGGAAGG - Intronic
1070442850 10:76463639-76463661 CGGTGGCAGGGGAGGGGGGAAGG + Intronic
1070445598 10:76498034-76498056 TTTGGGAAGAGGATGGGGCAGGG - Intronic
1070681505 10:78452242-78452264 TTTTGGGAGGGTAGGGGGAAGGG + Intergenic
1070716726 10:78727850-78727872 GTTTGGAGGGGGAGGGTGGGTGG - Intergenic
1070839127 10:79471025-79471047 TTTGGGAAGCTGAGGTGGGAGGG - Intergenic
1071179829 10:82970405-82970427 CTTGGGAAGTGGAGGTGGGAGGG - Intronic
1071204195 10:83255014-83255036 GTGGGGGAGGGGAGGGGGGAGGG - Intergenic
1071734066 10:88278688-88278710 TTTTGGAAGAGGTTGGGGGAAGG - Intronic
1072108022 10:92291830-92291852 TTGGGGAGGGGGAAGGGGGAGGG - Intronic
1072343059 10:94474486-94474508 TTTTGGAGGTGGAGGGGAGCTGG - Intronic
1072589774 10:96818771-96818793 TTTTGGAAGGCCAAGGTGGAAGG - Intergenic
1072598284 10:96896665-96896687 CTTTGGAAGGGCAGGGCGGGTGG - Intronic
1072727207 10:97822017-97822039 TTTGGGAGGGGGAAGGGGAAGGG + Intergenic
1073015445 10:100395465-100395487 CTTTGGAAGGGGAGGAGAAAGGG - Intergenic
1073039478 10:100592735-100592757 TTTTGGTGGGGGTGGGGGCAGGG - Intergenic
1073052032 10:100673560-100673582 TCTTGGAATGGGGGGGTGGAGGG - Intergenic
1073100580 10:101004242-101004264 TTTTGGCAGGGAACGGGGGTTGG + Intronic
1073147789 10:101291996-101292018 GTGAGGACGGGGAGGGGGGAAGG - Intergenic
1073205071 10:101764739-101764761 TTTTTTGAGGGGCGGGGGGATGG - Intergenic
1073341300 10:102746606-102746628 TTTTGGGGGGGGTGGGGGAAGGG + Intronic
1073345780 10:102781866-102781888 TTTTGGGGGGGGTGGGGGGAGGG + Intronic
1073464798 10:103688316-103688338 TTTTTGAATGGGTGGGTGGATGG - Intronic
1073734522 10:106330558-106330580 TTTTGGGAGGGGAAGGTGGATGG + Intergenic
1074983429 10:118637697-118637719 ATTTGAAAGGGAAGGGGGAAAGG - Intergenic
1075179760 10:120199748-120199770 TTTTGGAAGGCCAAGGCGGATGG - Intergenic
1075222071 10:120593693-120593715 TTTTGAGTGGGGAGGGGGAAGGG - Intergenic
1075229904 10:120667060-120667082 TTTTGGAGGGGGAGGGGAACAGG + Intergenic
1075489977 10:122858403-122858425 TTGGGTGAGGGGAGGGGGGAGGG + Intronic
1075518739 10:123131153-123131175 TTTGGGAAGCTGAGGTGGGAGGG - Intergenic
1075549467 10:123381567-123381589 TTTGGGAAGGGAAGGAGAGACGG + Intergenic
1075794981 10:125113596-125113618 TTTTGGAAAGGAAGGAGGGATGG + Intronic
1076001340 10:126915421-126915443 TTTTGGGGGCGGGGGGGGGATGG + Intronic
1076292585 10:129358875-129358897 TTTTGTAAGGTGAAGGGGGAAGG + Intergenic
1076605288 10:131685465-131685487 TTTCAGCAGGGGAGGGGAGAGGG - Intergenic
1076707104 10:132308008-132308030 TTCTGGAAGGGGCGGGGGCGGGG + Intronic
1076802165 10:132835839-132835861 TTTCGGGAGGGGAGCGGGGGCGG - Intronic
1077475941 11:2790531-2790553 TGTGGGATGGGAAGGGGGGATGG - Intronic
1078008132 11:7547843-7547865 TTGTGGAGGGGGAGAGGGCAGGG - Intronic
1078269515 11:9781939-9781961 TTTTGGGAGGTGAAGGTGGACGG + Intronic
1078399275 11:11009988-11010010 GTTTGGAGAGGGAGGGGAGAAGG + Intergenic
1078515832 11:12021668-12021690 TTTTGGGGGGGGGGGGGGGATGG - Intergenic
1078589480 11:12626998-12627020 TTTTGGCGGGGGGGGGGGGGGGG + Intergenic
1078634367 11:13035120-13035142 ATTTGGAAAAGGAGAGGGGATGG + Intergenic
1078679433 11:13462515-13462537 TTTGGGAATGGGGCGGGGGAAGG - Intronic
1078768724 11:14326655-14326677 TTTGGGAGGGGGAGGGGACAGGG + Intronic
1078913789 11:15758665-15758687 TTGGGGAGGGGGCGGGGGGAGGG - Intergenic
1078949728 11:16116940-16116962 ACTGGGTAGGGGAGGGGGGATGG - Intronic
1079929215 11:26537020-26537042 TTTTGGTAGGGGACGGGGACTGG + Intronic
1080250535 11:30228480-30228502 TTGTGGATGGGGAGGAGTGATGG - Intergenic
1080323139 11:31038069-31038091 TGTTGTTGGGGGAGGGGGGAGGG + Intronic
1080358959 11:31490721-31490743 TTTGGGTAGGGGAGGCAGGAAGG - Intronic
1080438550 11:32268940-32268962 AATGGGAAGGGGAAGGGGGAGGG + Intergenic
1080447874 11:32353900-32353922 TTTTGGGAGGTGAGGGGGGGAGG - Intergenic
1080663453 11:34315600-34315622 TTGGGGCAGGGGAGGAGGGATGG - Intronic
1080711298 11:34750236-34750258 CTTTGGAAGGGGACCTGGGAAGG + Intergenic
1080944621 11:36957625-36957647 TGTTGGGAGGGAAGTGGGGATGG + Intergenic
1081100744 11:38999134-38999156 CTTTGGGAGGGTAAGGGGGACGG - Intergenic
1081126248 11:39326646-39326668 TGGTGGAAGGGGAAGGGGAAGGG + Intergenic
1081231984 11:40596602-40596624 GCTGGGAAGGGGAGTGGGGAGGG - Intronic
1081527672 11:43937657-43937679 TTTTGGAGGGGGCGGGGTGGAGG - Intronic
1081828955 11:46089797-46089819 TTTTGGAGGGGGTGGGGGGCGGG + Intronic
1081942528 11:46955984-46956006 TTTTGGTGGGGGGGGGGGGGTGG - Intronic
1082020396 11:47528097-47528119 TTTTGGGAGGGGTGGGGGGATGG - Intronic
1082132379 11:48506250-48506272 GTGTGGAAGGGAAGGGGGAAGGG - Intergenic
1082244424 11:49905176-49905198 GTGTGGAAGGGAAGGGGGAAGGG + Intergenic
1082565842 11:54676870-54676892 GTGTGGAAGGGAAGGGGGAAGGG - Intergenic
1082813874 11:57495580-57495602 CTTTGGAAGGGCAAGGGGGGAGG + Intronic
1082835867 11:57649784-57649806 ATTGGGAAGGGGATGGGGGTGGG + Intronic
1083037851 11:59657066-59657088 ATTTGGAAGGTATGGGGGGAGGG - Intronic
1083151536 11:60794677-60794699 TTTTGGAAGGGGCGGGGGAACGG + Intronic
1083209832 11:61176386-61176408 GTTTTGAAGGGAAGGGAGGAGGG - Intergenic
1083330825 11:61897648-61897670 TTATGAAGGGGGAGGGAGGAAGG + Exonic
1083459452 11:62801047-62801069 TTTTTGAAGGGGTGGGTAGAGGG - Intronic
1083674743 11:64319057-64319079 GTTTGGGAGGAGAAGGGGGAAGG - Intronic
1083980130 11:66160683-66160705 TTTTGGCAGGGGAGTGAGGGTGG + Intronic
1084077697 11:66794002-66794024 TTTGGGAAGCTGAGGTGGGAGGG + Intronic
1084290502 11:68162621-68162643 TTTTGGAAGGAGGGATGGGATGG - Intronic
1084428158 11:69096840-69096862 TTTTGGAAAGGGAGGCGAGTGGG + Intergenic
1085079880 11:73625303-73625325 GTTTGGATGGGGAGTGGGGAGGG - Intergenic
1085118476 11:73951183-73951205 TTTTGGAAGAGAAGAGGGCAGGG - Intronic
1085544660 11:77306150-77306172 TTTGGGAAGCGGAGGAGGGGTGG - Intergenic
1085592587 11:77778098-77778120 CTTGGGAAGGGGAGGGGAGGAGG + Intronic
1085639970 11:78187529-78187551 TTCTGGAAGGGGCTGGGGGATGG - Intronic
1085759973 11:79233433-79233455 TTGTGGAAGAGGCAGGGGGACGG + Intronic
1085795792 11:79538319-79538341 TTTTGGAAGGGAAGGTGATAAGG - Intergenic
1085840019 11:80001147-80001169 TATGGTGAGGGGAGGGGGGAGGG - Intergenic
1085968327 11:81556027-81556049 TTTTTGAGGGTGAGGGGGCAGGG - Intergenic
1086040715 11:82474179-82474201 TTTTTGCAGGGGAGGGGGTTGGG + Intergenic
1086319420 11:85628968-85628990 GTTTGGCAGGGGAGTTGGGACGG - Intronic
1086500128 11:87444337-87444359 TTTGGGAAGGTGAGAAGGGAAGG - Intergenic
1087250133 11:95889512-95889534 TTTTGGGGGGGGAGGGGGGCGGG + Intronic
1087269722 11:96098955-96098977 TTGTGGAAAGGGATGGGGGCAGG - Intronic
1087772204 11:102222871-102222893 TTTTGGCGGGGGAGGGGGTCGGG + Intronic
1087777149 11:102267013-102267035 TTTTGGGAGGGCAAGGTGGAAGG - Intergenic
1087838565 11:102898948-102898970 CTTGGGAAGGTGAGGAGGGAGGG + Intergenic
1088350897 11:108886118-108886140 TTTGAGAAGGGGAGGGGATAAGG + Intronic
1088530515 11:110803489-110803511 TGGTGGGGGGGGAGGGGGGAGGG - Intergenic
1088531917 11:110819651-110819673 TTTGGGTAGGGGAAGGAGGAGGG + Intergenic
1088711855 11:112515807-112515829 TGTGGGCAGGGGAGGGGGGTGGG - Intergenic
1088751592 11:112846639-112846661 TTTTGGATGGGTAGGAGGGTTGG + Intergenic
1088856583 11:113760673-113760695 TTTTAGAGGGGGGAGGGGGAGGG - Intronic
1089579638 11:119473425-119473447 TTTTGGCAGGGGTGGGGGGTCGG - Intergenic
1089588065 11:119522533-119522555 TTTTGGAAGGTGGGGATGGATGG + Intergenic
1089865933 11:121631739-121631761 TTTTCCAAGGAGAGGGGTGATGG - Exonic
1089962566 11:122628856-122628878 TGTTGGAAGGGGAGGGATGCAGG + Intergenic
1090042227 11:123301297-123301319 TGTTGGGGAGGGAGGGGGGAGGG + Intergenic
1090046522 11:123340074-123340096 TTTTGGAGGGAGAGTGGAGAAGG + Intergenic
1090213860 11:124943003-124943025 TTTTGGAAGGGCAGCAAGGAGGG + Intergenic
1090273762 11:125405493-125405515 TTTTGGAAGTGGGGGGTGCAGGG - Intronic
1090333915 11:125950472-125950494 TGTGGGAAGGGGAAGGGGAAGGG + Intergenic
1090406456 11:126478428-126478450 TCTCAGAAGGGGAGTGGGGATGG + Intronic
1090505392 11:127306935-127306957 TTTTGAAGGGGGAAGGGGAAGGG - Intergenic
1090505393 11:127306936-127306958 TTTTTGAAGGGGGAAGGGGAAGG - Intergenic
1090644631 11:128757889-128757911 TTTGGGCAGTGGAGTGGGGATGG - Intronic
1090892770 11:130941446-130941468 TGGTGTGAGGGGAGGGGGGAGGG - Intergenic
1090931369 11:131300683-131300705 TGTTGGAAGGGGAGGAGGAGGGG - Intergenic
1091028167 11:132160398-132160420 TGTTGGTAGGAGAGGGGTGAAGG - Intronic
1091208855 11:133839530-133839552 GTGGGGTAGGGGAGGGGGGAGGG + Intergenic
1091269138 11:134293362-134293384 TTTGGGATGGGGAAGGAGGAGGG + Intronic
1091446811 12:548360-548382 ATTTGGCAGGGGAGGAGGGGAGG + Intronic
1091653041 12:2323821-2323843 TTTTGGTGGGGGAGGGGGTTGGG + Intronic
1092045660 12:5430593-5430615 GGTTGGATGGGGAGGTGGGAAGG - Intergenic
1092048795 12:5453357-5453379 TTAGGGAAGGGGAGGCAGGAGGG - Intronic
1092348766 12:7738953-7738975 TGTGGGGTGGGGAGGGGGGAGGG - Intronic
1092473426 12:8798095-8798117 TTTTTGTGGGGGAGTGGGGATGG - Intergenic
1092475887 12:8818822-8818844 TTTGGGAAGGCAAGGTGGGAGGG - Intergenic
1092497353 12:9010076-9010098 TTTGGGAAGCTGAGGTGGGAGGG + Exonic
1092599458 12:10043508-10043530 TTTAAGAATGGGAGAGGGGAAGG - Intronic
1092817376 12:12323188-12323210 GGATGGGAGGGGAGGGGGGAGGG + Intergenic
1093345928 12:18038283-18038305 TAGTGAAAGGGGAGGGGTGATGG - Intergenic
1094039795 12:26110663-26110685 TTTGGGGAGGGGAGGGGGACAGG + Intergenic
1094060409 12:26309246-26309268 TATTGTCAGGGGCGGGGGGATGG + Intergenic
1094243061 12:28251280-28251302 TTTTAGAAGGGGAGGGGTGCAGG + Intronic
1094388995 12:29928238-29928260 TATTGGGAGGGGAGAGGAGAAGG + Intergenic
1094398582 12:30036219-30036241 TTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1094749157 12:33385542-33385564 TTTTGGAAGATGATGGGGCATGG - Intronic
1095313795 12:40733487-40733509 CTCTGGCAGGGGAAGGGGGAGGG - Intronic
1095443560 12:42261726-42261748 TTTGAGAAGGGGTGGGGGGAGGG - Intronic
1095493591 12:42761480-42761502 TGTTAGGTGGGGAGGGGGGAAGG + Intergenic
1095559343 12:43547345-43547367 TACTGGAGGGGGAGGGGGAAAGG + Intronic
1095751154 12:45712762-45712784 TTTTGGGCGGGGGGGTGGGAGGG + Intergenic
1095809275 12:46354817-46354839 TTTTGGAAGGGTAAGGAGGTGGG + Intergenic
1095919260 12:47513043-47513065 TTGTGGAGGGGGAGGGGAGAGGG + Intergenic
1095960339 12:47830499-47830521 TTTTGGAAGAGGAAAGAGGAAGG - Intronic
1096003494 12:48149201-48149223 TTTGGGAAGGGGAGGTGCTATGG + Exonic
1096337386 12:50766647-50766669 TTTTATGGGGGGAGGGGGGAGGG - Intronic
1096379518 12:51144275-51144297 TTTTGGAAGGCTAAGGTGGAAGG - Intronic
1096379719 12:51145947-51145969 TTTTTGGTGGGGAGGGGGAAGGG - Intronic
1096399728 12:51295938-51295960 TGTCTGAAGGGGAGGGGAGAAGG - Intronic
1096598586 12:52714071-52714093 TTTGGGAGGCGGAGGCGGGAGGG - Intergenic
1096673074 12:53211557-53211579 CATTGGAAGGGGTGGGGAGAGGG + Exonic
1096918794 12:55061621-55061643 TTTAGGAAGAGAAGGGAGGAGGG - Intergenic
1096957081 12:55536993-55537015 TTGTGGGGGGGGAGGGGGGAGGG + Intergenic
1096987035 12:55766610-55766632 TTTTGGCGGGGGGGGGGGGGGGG + Intronic
1097444376 12:59649943-59649965 TTTTTGGTGGGGAGGGGGGATGG - Intronic
1097453330 12:59764473-59764495 TGGTGGAGGGGGAGGGGGGAGGG - Intronic
1097602216 12:61706866-61706888 GGATGGGAGGGGAGGGGGGAGGG + Intergenic
1097608437 12:61785109-61785131 TCTGGGAAGGGCAGGAGGGAAGG - Intronic
1097767844 12:63545786-63545808 TGTAGGTAGGGGAGGGGGCAAGG + Intergenic
1097784207 12:63740848-63740870 TGTAGGTAGGGGAGGGGGCAAGG + Intergenic
1097933201 12:65213792-65213814 TTTTGAAAGGGGAGTGAGGAAGG + Intronic
1098171187 12:67748931-67748953 ATGTGGAAGGGGTGGGGTGAAGG + Intergenic
1098384956 12:69908910-69908932 TTTTGAAGGTGGAGGGTGGAGGG - Intronic
1098405845 12:70124791-70124813 TGTGGGAGGGGGAGTGGGGATGG + Intergenic
1098837972 12:75444436-75444458 CTTTTGAAGGGGAGTGGGGCTGG + Intergenic
1099144212 12:79018343-79018365 GTGGGGTAGGGGAGGGGGGAGGG + Intronic
1099248045 12:80217299-80217321 GATGGGAAGGGGAGGGAGGATGG + Intronic
1099653438 12:85458202-85458224 TGTTGGCAGGGGAGGAGGGGTGG - Intergenic
1099669273 12:85669580-85669602 TTGTGGAAGGATAGGAGGGAAGG - Intergenic
1099923626 12:88990109-88990131 TTGGGGAAGGTGTGGGGGGAGGG + Intergenic
1099953752 12:89332391-89332413 TTTTGTAGGGGGAGGGGGCAGGG - Intergenic
1099955097 12:89345776-89345798 TTTTGCAGGGGCAGGGGGGTAGG - Intergenic
1100039468 12:90296287-90296309 TTTTGCCTGGGGATGGGGGATGG - Intergenic
1100145699 12:91674952-91674974 TGTGGGAAGGGGAGTGGGAAGGG - Intergenic
1100562703 12:95764658-95764680 TTTTGGTCGGGGCGGGGGGATGG - Intronic
1100782702 12:98046502-98046524 TTTGGGAAGGAGAGGTGGGTGGG - Intergenic
1101589482 12:106113128-106113150 TCTTTGAAGGGGAGAGGGGTGGG - Intronic
1101937262 12:109068397-109068419 TTTTGGAAAGGGAGCTGGGGAGG + Intronic
1102026174 12:109715209-109715231 TCTTGGAAGGGCTGGGGGGTGGG + Intronic
1102026261 12:109715558-109715580 TTTGGGTAGTGGAGGGGTGAAGG + Intronic
1102033563 12:109758578-109758600 TTATGGGAGGGGTGTGGGGAGGG - Intronic
1102572272 12:113834115-113834137 TTTTGGTAGGGCAGGGGAGGGGG + Intronic
1102678936 12:114677074-114677096 CTTTGAAAGGGGGTGGGGGAGGG + Intronic
1103200530 12:119084308-119084330 TTCTGGAAGGTGAGAGGGGAAGG + Intronic
1103480163 12:121245502-121245524 TTTTGGAAGGGATGGGAGGGAGG - Intronic
1103583899 12:121936869-121936891 AATTGGAAGGGGAGAAGGGAAGG + Intronic
1103759051 12:123234390-123234412 TTTTTGTGGGGGAGGGGGGTAGG + Intronic
1104074610 12:125378056-125378078 TATGGGAATGGGAGGGGAGAAGG + Intronic
1104261160 12:127183370-127183392 TTTTGGGGGGGAAAGGGGGAGGG + Intergenic
1104371904 12:128231009-128231031 TTTTGGAACGGGGGCGGGGGTGG - Intergenic
1104548342 12:129732603-129732625 TTGTGGAAGGGGAAGTGGGAGGG - Intronic
1104766414 12:131333117-131333139 TGTTGGATGGGGAGAGGAGACGG + Intergenic
1104813003 12:131629514-131629536 TGTTGGATGGGGAGAGGAGACGG - Intergenic
1105309041 13:19190096-19190118 TTGTGGAAGGGAGGGAGGGAGGG + Intergenic
1105337152 13:19483919-19483941 TTGGGTAGGGGGAGGGGGGAGGG - Intronic
1105510810 13:21050213-21050235 TTTTGGGGGTGGAGGGGGTAGGG + Intronic
1105544639 13:21342606-21342628 TTTTGGAAGAGGGGAGGGGGTGG - Intergenic
1105760755 13:23512264-23512286 TGGTGGCAGGTGAGGGGGGACGG - Intergenic
1105761880 13:23522617-23522639 CTATGGAAAGGGTGGGGGGATGG + Intergenic
1106058228 13:26259291-26259313 TTTTCGAGGGGGTAGGGGGAAGG + Intronic
1106133295 13:26956934-26956956 TTCGGGAAGGGGAGGGGAGGTGG - Intergenic
1106201493 13:27541347-27541369 TTATGGGAGGGGTTGGGGGAAGG - Intergenic
1106604333 13:31213618-31213640 TTTTGGCGGGGGGGGGGGGTGGG - Intronic
1106658332 13:31771479-31771501 CTATGGATGGAGAGGGGGGATGG - Intronic
1106675803 13:31956738-31956760 GTTGGGAAGGGCAAGGGGGAGGG - Intergenic
1106774492 13:32995456-32995478 TTTTGGTAGAGGAGGGGAGATGG - Intergenic
1106913740 13:34489694-34489716 TTTTGGAGGTGGAGGCGGGATGG + Intergenic
1107224394 13:38029843-38029865 TTCTGAAAGGGTAGAGGGGAAGG + Intergenic
1107245318 13:38287101-38287123 TTTAGCAAGGGGAGGAGAGAAGG + Intergenic
1107256667 13:38435651-38435673 TTTGGGAAAGGGAGAAGGGATGG + Intergenic
1107780521 13:43897139-43897161 TGTGGGAAGGGAAGGGGAGACGG - Intergenic
1107927765 13:45279908-45279930 TTTTGGGGGGGGCGGGGGGACGG - Intronic
1108085959 13:46794139-46794161 TTTTGGAGGGGAAGGAGGAAGGG - Intronic
1108085960 13:46794140-46794162 TTTTTGGAGGGGAAGGAGGAAGG - Intronic
1108586342 13:51873381-51873403 TATTGGAATGAGAGAGGGGATGG + Intergenic
1108653221 13:52502750-52502772 TTTCAAAAGGGGAGGGGGGTAGG - Intergenic
1108687718 13:52835271-52835293 ATGGGGAGGGGGAGGGGGGAAGG + Intergenic
1108689612 13:52848999-52849021 TGTTGGCAGGGGCTGGGGGAAGG - Intergenic
1108825655 13:54408892-54408914 TTTTGGCGGGGGGGGGGGGGGGG - Intergenic
1109298290 13:60562313-60562335 TTTTGCCGGGGGTGGGGGGAAGG - Intronic
1109309111 13:60671767-60671789 CTTTGCATGGGGATGGGGGATGG + Intergenic
1109867497 13:68284407-68284429 CTTGGGGTGGGGAGGGGGGAGGG + Intergenic
1109890944 13:68613671-68613693 TTTTTGGAGGGGGAGGGGGACGG + Intergenic
1110032670 13:70636931-70636953 TTTTTGGTGGGGGGGGGGGACGG + Intergenic
1110556533 13:76866023-76866045 GCTGGGAAGGGGAGGGTGGAGGG - Intergenic
1110690252 13:78424176-78424198 AATTGGAAGGGGAAGGGGAAGGG + Intergenic
1111209740 13:85062282-85062304 TTCTGGAAGGAGAGAGGGGCTGG - Intergenic
1112135775 13:96576150-96576172 TTCTGGAAGGGAACGGGCGAGGG + Intronic
1112327197 13:98449798-98449820 GTGTGGGGGGGGAGGGGGGAAGG + Intronic
1112377783 13:98860068-98860090 TTTTGCAGGTGGTGGGGGGAGGG - Intronic
1112474784 13:99721618-99721640 AATTAGAGGGGGAGGGGGGAGGG - Intronic
1112484828 13:99810820-99810842 GTTTGGAGGGGAAGGAGGGAAGG - Intronic
1112560165 13:100505855-100505877 TTTTTGGGGGGGATGGGGGAGGG - Intronic
1112664018 13:101547557-101547579 TCTGGGAAGGGTAGTGGGGAGGG + Intronic
1113179797 13:107612104-107612126 GGGAGGAAGGGGAGGGGGGAGGG + Intronic
1113596451 13:111537409-111537431 TTTTGGTGGGGGACGGGGTAGGG + Intergenic
1113729421 13:112629381-112629403 TTGGGGGAGGGGAGGAGGGAAGG - Intergenic
1113749168 13:112766615-112766637 TAAGGGAAGGGGAAGGGGGAGGG + Intronic
1113975566 13:114225419-114225441 GGGAGGAAGGGGAGGGGGGAGGG + Intergenic
1114055810 14:18966277-18966299 TTGTGTGGGGGGAGGGGGGAGGG - Intergenic
1114106737 14:19435485-19435507 TTGTGTGGGGGGAGGGGGGAGGG + Intergenic
1114490231 14:23095764-23095786 TTTGGGGAGGGGCGGGGGGCTGG + Intronic
1114505858 14:23212746-23212768 TTTGGGAAGCTGAGGTGGGAGGG - Intronic
1114568214 14:23647716-23647738 TTCTGGATGTTGAGGGGGGAGGG + Intergenic
1114929024 14:27444070-27444092 TTTGGGAAGGGGAGGCAGGAGGG - Intergenic
1115100520 14:29692746-29692768 TTTTGAAAGGGCAAAGGGGAAGG - Intronic
1115319991 14:32069439-32069461 TTGTGGAGGGGGATGGGGTAAGG + Intergenic
1115368524 14:32585800-32585822 TTTTGTTAGGGAAGGGAGGATGG + Intronic
1115435281 14:33364997-33365019 TTTTTTTGGGGGAGGGGGGAGGG + Intronic
1115452709 14:33566451-33566473 ATTTGGAAGGGTGGGGTGGAAGG - Intronic
1115577542 14:34725674-34725696 TTTTGGGGGGGAAGGGTGGAGGG + Intergenic
1115724516 14:36198509-36198531 GTCGGGAGGGGGAGGGGGGAGGG + Intergenic
1115763365 14:36597790-36597812 TTTTGGGGGGGGAGGGGGGCTGG + Intergenic
1116029102 14:39549546-39549568 TTTTGGTGGGGGATGGAGGATGG + Intergenic
1116030075 14:39560823-39560845 TGTGGGGTGGGGAGGGGGGAGGG + Intergenic
1116052064 14:39816049-39816071 TTTTTCACGGGAAGGGGGGAAGG + Intergenic
1116791867 14:49348003-49348025 TTTTGGAGGCTGAGTGGGGACGG - Intergenic
1117160990 14:52989495-52989517 TTGTTGGAGGGGAGTGGGGATGG - Intergenic
1117246583 14:53892317-53892339 TTTTGGCAGGGGTGGGGGGGTGG - Intergenic
1117281902 14:54249022-54249044 TTTTGAAAGGTTAGGGGAGAGGG + Intergenic
1117414340 14:55479931-55479953 CTATGGGAGGGGAGGGGAGAGGG - Intergenic
1118033371 14:61839878-61839900 TTGTGGAGGGGAAAGGGGGAGGG + Intergenic
1118103217 14:62628993-62629015 TTTGGTGGGGGGAGGGGGGAGGG - Intergenic
1118303534 14:64635886-64635908 CTATGGAAGTGGAGGGGAGATGG - Intergenic
1118749372 14:68795308-68795330 TTTTGGGGGGGGTGGGGGGTGGG - Intronic
1118756548 14:68849075-68849097 TTTGGGAAGCTGAGGTGGGAGGG + Intergenic
1119214240 14:72856400-72856422 TTTTGGAAGATGAGAGGGGTTGG + Intronic
1119368398 14:74115907-74115929 TTTTTGTAGGGGAAGGGGGTTGG + Intronic
1119401388 14:74364962-74364984 TCATGGAAGAGGAGGAGGGAAGG + Intergenic
1119637856 14:76291368-76291390 TTTTGCAAGGGGTGGTGGGAGGG - Intergenic
1119940270 14:78633448-78633470 ATGTTGAAGGGGAGTGGGGAGGG - Intronic
1120059693 14:79967833-79967855 TTTGGGAAGCAGAGGGGTGAGGG - Intergenic
1120134588 14:80851363-80851385 TTTTAGAAGGCGAGGAGGAACGG + Intronic
1120278550 14:82409447-82409469 TCTTTAAAGGGGTGGGGGGAGGG + Intergenic
1121734468 14:96208356-96208378 TTTTGGAATGTGTGTGGGGAGGG - Intronic
1121956658 14:98219563-98219585 CTTTGGCAGGGGAGTTGGGAAGG + Intergenic
1122081750 14:99271818-99271840 TTTTTGAGGGGGCGGGGTGAGGG - Intergenic
1122329759 14:100904355-100904377 GTGTGGACGGGGAGAGGGGAGGG + Intergenic
1122369371 14:101220830-101220852 TTTTGGTGGGGCAGGTGGGAAGG - Intergenic
1122676222 14:103416407-103416429 TTTTGGAATAGGTGAGGGGATGG + Intronic
1122986101 14:105212418-105212440 TGTTGGAAGGGGAGTGGGCTGGG - Intronic
1123916329 15:25032287-25032309 TTTTGGCAGGGGATGTGGGGAGG - Intergenic
1124022683 15:25938802-25938824 TTTTGGAGGGGGGAGGGGGCAGG + Intergenic
1124199609 15:27667240-27667262 TTTTGGAAGACTAGTGGGGAAGG - Intergenic
1124285614 15:28398272-28398294 TTTTGGCGGGGGGGGGGGGGGGG - Intergenic
1124373628 15:29117008-29117030 TTGTGGGAGGGGAGGTGGGAGGG + Intronic
1124374902 15:29123800-29123822 GTTGAGAAGGGGAGGAGGGATGG - Intronic
1124622476 15:31282069-31282091 CTTTGGGAGGTGAGGGGGGGCGG - Intergenic
1124681643 15:31736825-31736847 TTTTTGGGGGGGCGGGGGGACGG + Intronic
1124839771 15:33230685-33230707 TTTTCGGGGGGCAGGGGGGATGG + Intergenic
1124933127 15:34143230-34143252 TTTGGGAGGGGGAGGTGGGTGGG + Intronic
1124950978 15:34320481-34320503 GCTAGGAAGGGTAGGGGGGAAGG + Intronic
1125013356 15:34905093-34905115 TTTTGGGGGGGGTGGGGGGAAGG + Intronic
1126190124 15:45870333-45870355 TTTTGGCGGGGGGGGGGGGGGGG - Intergenic
1126629039 15:50714935-50714957 TTTTGGGCGGGGAGGGGTGGCGG - Intronic
1127075575 15:55322168-55322190 TTTTTGCGGGGGATGGGGGAAGG - Intronic
1127186330 15:56484609-56484631 TTGTGGAAGGGAAGGAGGCAGGG - Intergenic
1127198342 15:56614930-56614952 TGGTGGAAGGGGAGGGTGGCAGG - Intergenic
1127293409 15:57590279-57590301 TTTTGGAAGGGATAGGTGGATGG + Intergenic
1127332303 15:57951176-57951198 TCTTGGCAGGGAAGGAGGGAAGG - Intergenic
1127338846 15:58019974-58019996 TGTTGGAGGGGGTGGGCGGAGGG - Intronic
1127348026 15:58120761-58120783 TTTTGTGGGGGGAGGGGGGAGGG - Intronic
1127695924 15:61447687-61447709 TATTGGAATGGGAGGGAGAAGGG - Intergenic
1127751354 15:62048246-62048268 TGTTGGGGGGGGTGGGGGGAGGG - Intronic
1127828390 15:62726866-62726888 AATTGGGAGGGGAGGGGGCATGG + Intronic
1127921733 15:63500051-63500073 TTTTGCATTGGTAGGGGGGAAGG + Intergenic
1128012041 15:64306971-64306993 TTGTGGGTGGGGAGGGGGGCGGG + Intronic
1128019539 15:64378511-64378533 TTTTGGAGGCGAAGGCGGGACGG - Intronic
1128146141 15:65333419-65333441 CAGAGGAAGGGGAGGGGGGATGG + Intronic
1128220312 15:65964227-65964249 CTTTGGAAGTGGGGGGTGGAGGG + Intronic
1128263496 15:66249567-66249589 TCTTGGATGGGGAGGGGGAGGGG + Intronic
1128445702 15:67758065-67758087 TATTTGTAGGGGAGGGAGGATGG + Intronic
1128509356 15:68303884-68303906 ATCTGCAAGGGGAGGGGGGCCGG + Exonic
1128609197 15:69060226-69060248 TCGTGGGAGGGGAGGGGGCATGG + Intronic
1128769920 15:70274318-70274340 TTTTGTGAGGTGAGGTGGGAGGG + Intergenic
1128911335 15:71518207-71518229 ATTTGGAAGGGGTGGGGAGGTGG - Intronic
1128919673 15:71598858-71598880 TTTGGGAGGTGGAGGTGGGAGGG - Intronic
1128934467 15:71733397-71733419 TTTTGGCAGGGGAGAGGACATGG + Intronic
1129068728 15:72933226-72933248 CTATGGAATGGGAGTGGGGAGGG + Intergenic
1129076098 15:72997327-72997349 TTCTGGAAGGAGAGAGGGGAAGG + Intergenic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129620719 15:77142812-77142834 TGTTGTAAGGGGCTGGGGGAAGG + Intronic
1129666722 15:77583294-77583316 TTTGGGATGGGGAGGGGACAGGG + Intergenic
1129706696 15:77798475-77798497 CTTTGGAAGGTTTGGGGGGAAGG - Intronic
1130658097 15:85807125-85807147 TATTGGAAGGAGAGGGTGTAGGG - Intergenic
1130841046 15:87701506-87701528 TTCTGGAACAGGAGGGGAGAGGG - Intergenic
1131181039 15:90240263-90240285 TTTGGGAAGCCGAGAGGGGAGGG + Intronic
1131348702 15:91676696-91676718 TTTTGGAAGTGAAAAGGGGATGG - Intergenic
1131668816 15:94597893-94597915 TTGTGGAAGTGGTGGGTGGATGG - Intergenic
1131733000 15:95301763-95301785 GCTTGGAAGGGTAAGGGGGATGG + Intergenic
1131828799 15:96341481-96341503 TATGGGAGGGGGAGGGGAGAAGG - Intergenic
1132180685 15:99750619-99750641 TGTTGGAGGGGAAGGAGGGAGGG - Intergenic
1132180696 15:99750666-99750688 TGTTGGAGGGGAAGGAGGGAGGG - Intergenic
1132180707 15:99750713-99750735 TGTTGGAGGGGAAGGAGGGAGGG - Intergenic
1132240028 15:100250538-100250560 TTAGGGAAGGGGAGGGTGGCAGG + Intronic
1132367898 15:101270893-101270915 TTTTGGTAGGGGTGGAAGGAGGG - Exonic
1132458683 16:38577-38599 TTCTAGAAAGGGAGAGGGGATGG + Intergenic
1132647571 16:1006293-1006315 TTTTGGAAATGGTGTGGGGAGGG + Intergenic
1133249568 16:4471827-4471849 CTTTGGGAGGGTAAGGGGGATGG + Intronic
1133640255 16:7709743-7709765 TTTTGGGAGGGGGTGGGGGGAGG + Intronic
1133640256 16:7709744-7709766 TTTGGGAGGGGGTGGGGGGAGGG + Intronic
1133809497 16:9150131-9150153 TTTCGGAGGCGGCGGGGGGAGGG - Intergenic
1134257294 16:12622749-12622771 CTTTTTAGGGGGAGGGGGGAAGG + Intergenic
1134433208 16:14231133-14231155 TGGGGTAAGGGGAGGGGGGAGGG + Intronic
1134523597 16:14929068-14929090 TGGTGGAGGGGGAGGGGGAAGGG - Intronic
1134610034 16:15600606-15600628 TTTTTTAAGGGGGGAGGGGATGG + Intronic
1134711191 16:16327553-16327575 TGGTGGAGGGGGAGGGGGAAGGG - Intergenic
1134719043 16:16370855-16370877 TGGTGGAGGGGGAGGGGGAAGGG - Intergenic
1134948383 16:18341030-18341052 TGGTGGAGGGGGAGGGGGAAGGG + Intergenic
1134955638 16:18381140-18381162 TGGTGGAGGGGGAGGGGGAAGGG + Intergenic
1134993654 16:18722497-18722519 ATGGGGAGGGGGAGGGGGGAGGG + Intergenic
1135166825 16:20146486-20146508 GTATGGAAGGGGAGGAAGGAGGG + Intergenic
1135483006 16:22838643-22838665 TTATGAAAGGGCAGGGGGCATGG + Intronic
1135708529 16:24695683-24695705 TTTTGGAAGGCCAGGCGGGGTGG - Intergenic
1136033318 16:27519235-27519257 CTGGGGAAGGGGAGGGGAGAGGG + Intronic
1136051885 16:27656787-27656809 GGTGGGGAGGGGAGGGGGGAGGG + Intronic
1136244224 16:28964131-28964153 TGGTGAAAGGGGAGGGGTGAAGG - Exonic
1136536490 16:30902672-30902694 TTTTTGTGGGGGAGAGGGGAGGG + Exonic
1136619672 16:31419985-31420007 TTTTAGAGGGAGAGGGGGAAAGG - Intronic
1136751371 16:32638322-32638344 CTGTGGAAGGGGTGGGGGCAGGG + Intergenic
1136791135 16:32968765-32968787 TTTTGGTGGGGGAGGGGGGCTGG - Intergenic
1136878679 16:33885167-33885189 TTTTGGTGGGGGAGGGGGGCTGG + Intergenic
1137558221 16:49486508-49486530 ATTTGGCAGGTGAGGCGGGATGG - Intergenic
1137666799 16:50254808-50254830 TTTTGGCAGGGGGTGGGGGTGGG - Intronic
1138032004 16:53566759-53566781 TTTGGGAGGTAGAGGGGGGAGGG + Intergenic
1138220879 16:55249529-55249551 TTTTGGGAGGCCAAGGGGGAAGG - Intergenic
1138501729 16:57449538-57449560 TTTGGGAAGCTGAGGTGGGAGGG + Intronic
1138607964 16:58100574-58100596 TTTAGGAGGGTGAGGTGGGAGGG + Intergenic
1138958545 16:62001812-62001834 GTTTGGAGGGCGAGGGGGAAGGG - Intronic
1139497147 16:67327919-67327941 TTTTGGGAGGGTGGGGAGGAGGG + Intronic
1139552487 16:67682515-67682537 TTCTTAAAGGGGAGAGGGGAAGG - Intronic
1139578229 16:67855880-67855902 TTTTTGGCGGGGGGGGGGGATGG + Intronic
1139683195 16:68581239-68581261 TTTTGGGGAGGGAAGGGGGATGG + Intergenic
1139692921 16:68652482-68652504 TGATGGAAGAGGAGGGAGGAAGG + Intronic
1139886465 16:70211558-70211580 TTGTGGTGGGGGAGGGGGAAGGG + Intergenic
1139939743 16:70596625-70596647 TTTTGGCAGGGTGTGGGGGACGG - Intronic
1139999534 16:71011826-71011848 GATTGGAAGAGGAGGGTGGAAGG - Intronic
1140007432 16:71092272-71092294 TTGTGGAAGGGGAAAGGGCATGG - Intronic
1140251448 16:73297940-73297962 TTTGGGAGGCTGAGGGGGGAAGG + Intergenic
1140648380 16:77059909-77059931 TTTTGGAAAGGGAGGAGAGAGGG + Intergenic
1140853435 16:78955888-78955910 TTTGGGAGGCTGAGGGGGGATGG - Intronic
1141105554 16:81230597-81230619 ATTTGGATGGGGAAGGAGGAGGG - Intergenic
1141174467 16:81709925-81709947 TTCTGGGGGCGGAGGGGGGAGGG + Exonic
1141179351 16:81742031-81742053 GCTGGGAAGGGGAGGAGGGAGGG - Intronic
1141189007 16:81809819-81809841 TTTTGGCCGGGGCGGGGGGTGGG + Intronic
1142021500 16:87785666-87785688 TTTTGGTGGGTGGGGGGGGATGG + Intergenic
1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG + Intronic
1142336409 16:89491989-89492011 TTTGGGAAGCTGAGGAGGGAGGG - Intronic
1142344611 16:89546062-89546084 TCTTGGAAGGAGAGGTGGGTGGG - Intronic
1142377385 16:89712869-89712891 TTTTGGAAGGGCAGGCAAGAAGG - Intronic
1142388820 16:89784707-89784729 TTGGGGAAGGGGAAGGGGAAGGG + Intronic
1203053505 16_KI270728v1_random:897577-897599 CTGTGGAAGGGGTGGGGGCAGGG + Intergenic
1203093344 16_KI270728v1_random:1230226-1230248 TTTTGGTGGGGGAGGGGGGCTGG - Intergenic
1142467255 17:143310-143332 ATTTGGAAGGGTAGGAGGGGAGG - Intergenic
1142600722 17:1052367-1052389 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600739 17:1052411-1052433 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600756 17:1052455-1052477 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600773 17:1052499-1052521 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600808 17:1052587-1052609 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600826 17:1052631-1052653 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600844 17:1052675-1052697 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600860 17:1052719-1052741 TTCCGGAAGGGGCTGGGGGACGG + Intronic
1142600877 17:1052763-1052785 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600894 17:1052807-1052829 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600911 17:1052851-1052873 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600929 17:1052895-1052917 TTCAGGAAGGGGCTGGGGGAGGG + Intronic
1142600945 17:1052939-1052961 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600961 17:1052983-1053005 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600978 17:1053027-1053049 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600995 17:1053071-1053093 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142601013 17:1053115-1053137 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142601031 17:1053159-1053181 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142601049 17:1053203-1053225 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142601066 17:1053247-1053269 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142601083 17:1053291-1053313 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142759274 17:2033956-2033978 TTGTGGGAGGGAAAGGGGGAAGG - Intronic
1143129974 17:4671952-4671974 TTTTGGAAGTGGAGGAGCCAGGG - Exonic
1143373410 17:6454208-6454230 TTTTGGCAGGAGAGGGAGGTGGG + Exonic
1143602339 17:7956235-7956257 TTTTGGTGGGGGAGGTGGGGGGG - Intergenic
1143611945 17:8023011-8023033 TTTTTAAGGGGGAGGGGGAACGG + Intergenic
1143786029 17:9256394-9256416 TTAAGGAAGGGAAGGAGGGAGGG - Intronic
1143791014 17:9295735-9295757 TTTTTGGGGGGGAGGGGGGACGG - Intronic
1144037709 17:11382320-11382342 CTTTGGGAGGGGAAGGTGGAAGG - Intronic
1144247972 17:13386556-13386578 TTTAGGAAGGGGAAAGAGGAGGG - Intergenic
1144680754 17:17192424-17192446 TTTTGGGGGGGGGGGGGGGAGGG + Exonic
1144707924 17:17381683-17381705 TTTTGGCGGGGGAGGGGGCGTGG + Intergenic
1145066750 17:19766581-19766603 TCTTGCATGGGGAGGGGAGAAGG - Intergenic
1145127544 17:20314682-20314704 TTTTGGGGGGGGAGGGGGGAAGG - Exonic
1145367650 17:22278291-22278313 TTGTGGAAGGGCAGGGTGGGGGG + Intergenic
1145409222 17:22641742-22641764 TTTTGGAGGAGGAGGGGACAGGG + Intergenic
1145855851 17:28156564-28156586 TTGTGGGAGGGGGAGGGGGATGG + Intronic
1145904503 17:28508823-28508845 ATTTGGAAGGACAGAGGGGAGGG - Intronic
1145908988 17:28531945-28531967 TTCTGGAAGGGAAAGAGGGAGGG + Intronic
1145962490 17:28895718-28895740 ATTTGGATGGGGTCGGGGGATGG - Intronic
1146087153 17:29840036-29840058 CTTTGGAAAGGGTGGGGTGAGGG - Intronic
1146401982 17:32506871-32506893 TTTGGGAGGGTGAGGTGGGAGGG + Intronic
1146497759 17:33338072-33338094 TTCTGGCAGGGCAGGGAGGATGG + Intronic
1146497777 17:33338196-33338218 TTCTGGAAGGGAAAGGAGGATGG + Intronic
1146634181 17:34491899-34491921 TCTGGGAAGGGGAATGGGGATGG - Intergenic
1146944073 17:36862435-36862457 TTTAGGATGGGGAGGGAGGTGGG - Intergenic
1146953199 17:36920818-36920840 TGTTGGGAGGTGAGGGTGGAGGG + Intergenic
1146960066 17:36966761-36966783 TCTTGGCAGGGGAGGGGAGGAGG + Intronic
1147017765 17:37506268-37506290 TTTTGCAGGGGGACGGGGGCGGG - Intronic
1147062197 17:37889389-37889411 TTTGGGAGGCTGAGGGGGGACGG + Intergenic
1147153407 17:38531339-38531361 TTTTGGCGGGGGAGGGGGGCTGG - Exonic
1147475697 17:40709710-40709732 TTTGGGGAGGGGAGAGGGGCTGG + Intergenic
1147710854 17:42463248-42463270 TTTGGGAGGCTGAGGGGGGATGG - Intronic
1147933183 17:43995493-43995515 TTGTGGAAGGGCATGTGGGATGG - Intronic
1148003656 17:44407136-44407158 TTTTAAATTGGGAGGGGGGAAGG + Intronic
1148040393 17:44702198-44702220 TTTTGGCCGGGGCGGGGGGGTGG + Intergenic
1148079627 17:44960505-44960527 GATTGGAAGGGGGCGGGGGAGGG - Intronic
1148252192 17:46092711-46092733 TTTTTGGGGGGGGGGGGGGAGGG + Intronic
1148398543 17:47331737-47331759 GTTTGCCAGGGGATGGGGGAAGG - Intronic
1148523936 17:48311467-48311489 TTTTTGCGGGGGAGGAGGGAAGG + Intronic
1148548103 17:48532088-48532110 TTTTGGAAGGAGATGGAGGGTGG - Intergenic
1148616371 17:49003769-49003791 TTCCAGACGGGGAGGGGGGAGGG + Intronic
1148783446 17:50134140-50134162 TTTTGAAAGGGGAGGGGACCTGG + Exonic
1148821423 17:50361943-50361965 CTTGGGAAAGGGAGGGAGGATGG - Intronic
1148864954 17:50623640-50623662 TTTTGCAGGGGGTGGGGGGCAGG + Intronic
1148893980 17:50829334-50829356 ATTTGGCAGGGGTGGGGGGCTGG + Intergenic
1148927666 17:51101621-51101643 TTTTTGAGGGGGACAGGGGAGGG + Intronic
1149375266 17:56037565-56037587 TATTTAAAGGGTAGGGGGGAAGG + Intergenic
1149634622 17:58156928-58156950 TTTTTGTGGGGGAGGAGGGAGGG - Intergenic
1149866789 17:60155444-60155466 AGTGGGAAGGGGAGGGGTGATGG + Intronic
1149869390 17:60168529-60168551 TTTTGGGAGGGGGTGGGGAAGGG + Intronic
1150039342 17:61842271-61842293 GTTAGGAAGGGGTGAGGGGAGGG + Intronic
1150137114 17:62702109-62702131 ATTTGGCAGGGAAGGGGGAACGG + Intronic
1150255257 17:63739564-63739586 TAATGGAAGGGGAGGGCAGATGG + Intronic
1150693615 17:67385478-67385500 TGGGGGGAGGGGAGGGGGGAGGG - Intronic
1151167803 17:72219896-72219918 TTTGGGGAGGGGAGAGGGGAGGG - Intergenic
1151331820 17:73414579-73414601 TTCTGGAGGGGGTGGGGAGAGGG - Intronic
1151520977 17:74629318-74629340 GTGGGGAGGGGGAGGGGGGAGGG + Intergenic
1151538276 17:74750584-74750606 ATTGGCAAGGGGAGGGGGAAGGG + Intronic
1151547705 17:74803369-74803391 ATGTGGATGGGGAGAGGGGAAGG - Intronic
1151629767 17:75302475-75302497 CTATGGAAGAAGAGGGGGGAAGG + Intergenic
1151636735 17:75354261-75354283 TTTTGGGGGGGGGGGGGAGATGG + Intronic
1151889315 17:76942858-76942880 GTTTGCAAGGGGAGGGGAGAGGG - Intronic
1152080551 17:78184787-78184809 TGTTGCAACTGGAGGGGGGAGGG - Intronic
1152083563 17:78203778-78203800 CTTTGGAAGGGCAAGGCGGACGG + Intronic
1152230291 17:79110946-79110968 TTATGGAAGGGGTGAGGGGTAGG - Intronic
1152244759 17:79179534-79179556 TATTGTAAGGGGAGGGGAGGGGG - Intronic
1152350347 17:79780737-79780759 TATTGGAGGGGGTGGGGGTATGG + Intronic
1152467578 17:80474801-80474823 TTGTAAAAGGGGAGGGGGGGGGG - Intronic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1152835025 17:82524130-82524152 TTTGGGAAGCGGAGGCGGGACGG - Intronic
1153038810 18:791004-791026 TTTTGGAAGGCCAGGGCGGGTGG + Intronic
1153248059 18:3093034-3093056 TTTTGAAAGTGGAGAGGAGACGG + Intronic
1153498520 18:5723863-5723885 TTTTGGGCGGGGTGGGGGGGGGG + Intergenic
1153775479 18:8449889-8449911 TTTTGGAGGGGCATGGGCGAAGG + Intergenic
1153972927 18:10242737-10242759 TTTGGGAAGCTGAGGTGGGAGGG + Intergenic
1153985652 18:10348640-10348662 AGTGGGAAGGGGAGGGGAGAGGG + Intergenic
1154159060 18:11966813-11966835 CTTTGGGAGGTGAGGTGGGAGGG + Intergenic
1154347301 18:13552599-13552621 GTTAGGAAGTGGAGGGAGGAGGG - Intronic
1154409242 18:14127595-14127617 TTGGGCAAGGGGAGGTGGGAGGG + Intronic
1154460285 18:14576641-14576663 CTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1154461031 18:14586417-14586439 ATTAGGAAGGGTAGTGGGGAGGG + Intergenic
1155057121 18:22194703-22194725 TGTTGGGAGGGGGGGGCGGAGGG - Intronic
1155440650 18:25858405-25858427 GCTGGGAAGGGTAGGGGGGAGGG + Intergenic
1155746671 18:29362662-29362684 ATTTGGAAGGGGCCGGGGCAGGG + Intergenic
1156205556 18:34882296-34882318 TTTTGAAAAGGGAGGGTGGAAGG - Intronic
1156474707 18:37398186-37398208 TATTGAAAGGGAATGGGGGAAGG - Intronic
1156625160 18:38899880-38899902 TTTTGGAAGGGGCAGGGAGCAGG - Intergenic
1156665484 18:39400685-39400707 TGTGGGGTGGGGAGGGGGGAGGG + Intergenic
1156886575 18:42141856-42141878 TGGTGGCAGGGGAGGGGAGATGG + Intergenic
1156897737 18:42265808-42265830 GTGTGGTGGGGGAGGGGGGAGGG - Intergenic
1157215103 18:45775890-45775912 TTCTTGAAGGGGAGGGAGGGAGG + Intergenic
1157412315 18:47473433-47473455 TTTTGGAAGGGGATGAGGTTGGG + Intergenic
1157496207 18:48159140-48159162 TTCTGGAAGGGTAGGGGTCATGG + Intronic
1157640840 18:49212738-49212760 CTTTGGAAGGCCAGGGTGGATGG - Intronic
1157825378 18:50807368-50807390 ATTTGGCAGGGTAGGGGTGAGGG - Intronic
1158086740 18:53660361-53660383 TTTGGGAAGCTGAGGTGGGAGGG + Intergenic
1158221101 18:55151593-55151615 TTTTAGAAATGGAGTGGGGATGG + Intergenic
1158347610 18:56531785-56531807 TTTGGGAAGCTGAGGTGGGAAGG - Intergenic
1158368663 18:56771558-56771580 TTTTGGGGGGGGGTGGGGGAGGG - Intronic
1158603856 18:58877756-58877778 TGTTGGAAGGGGAGTGGAGTGGG + Intronic
1158977796 18:62727921-62727943 GATGGGAAGGGGAGGGGGGCTGG + Intronic
1159009798 18:63047754-63047776 TTTTGGAGGCTGAGGCGGGAGGG + Intergenic
1159080277 18:63728619-63728641 TTTTGGTGGGGGGCGGGGGATGG - Intergenic
1159179957 18:64890059-64890081 TTAAGGAAGGGGAAGGAGGAGGG + Intergenic
1159213600 18:65362337-65362359 TTTTTGTGGGGGAGGGGGGAGGG + Intergenic
1159502851 18:69296208-69296230 TTGTGGAAGGGTAGTGGGGATGG - Intergenic
1160025916 18:75215998-75216020 GGTTGGAAGGGGAGGGGGGCTGG + Intronic
1160377771 18:78426783-78426805 TCTGGGATGGGTAGGGGGGAGGG + Intergenic
1160519771 18:79498053-79498075 ATTTGGAGGGGGATGGGGGGGGG + Intronic
1160545057 18:79647413-79647435 GGGAGGAAGGGGAGGGGGGAGGG + Intergenic
1160678609 19:403422-403444 ACTTGGAAGTGGAGGGGGGAGGG + Intergenic
1160725970 19:617983-618005 TTTGGGGAGGGGCGGGGCGAGGG - Intronic
1160814041 19:1027159-1027181 CTTTGGGAGGGGAAGGGGCATGG + Intronic
1160938523 19:1609233-1609255 TTTAGGAAGGGAAGTGGGGGGGG - Intergenic
1161388483 19:4009137-4009159 ATGTGAAAGGGGATGGGGGAGGG - Intronic
1161550825 19:4911116-4911138 TGTTGGGGGGGGAGGTGGGAGGG - Intronic
1161629563 19:5345894-5345916 TTTGGGAGGGGGAGGTGGGAGGG - Intergenic
1161724060 19:5918390-5918412 GGTGGGGAGGGGAGGGGGGAGGG - Intronic
1161744710 19:6048877-6048899 GTTTGGGAGGGGACGGGGGCGGG - Intronic
1161821505 19:6533471-6533493 TTCTGGAGGGGGAGGGGAAAGGG - Intronic
1161821562 19:6533606-6533628 CTTTGGAGGGGGAGGGGGAAGGG - Intronic
1161821623 19:6533748-6533770 CTCTGGAGGGGGAGGGGGAAGGG - Intronic
1161927598 19:7312846-7312868 TTGTGGAAAGTGAGTGGGGATGG - Intergenic
1161997201 19:7720534-7720556 TTTGGGAGGTGGAGGTGGGAAGG - Intergenic
1162086520 19:8252816-8252838 TTTTGGAGGTGGAGGGCGGGAGG - Intronic
1162105489 19:8367288-8367310 TTCTGGAGGGTGACGGGGGAAGG + Intronic
1162549744 19:11351767-11351789 TTGTAGAAGGGGAGGGGAAAAGG + Intronic
1162570505 19:11469282-11469304 TTTTTGCGCGGGAGGGGGGACGG + Intronic
1162863443 19:13525456-13525478 TTTGGGAGGTGGAGGGGGGTGGG + Intronic
1162955114 19:14093043-14093065 TTTTGGTCGGGGGGGTGGGAGGG - Exonic
1163102857 19:15108284-15108306 TTTGGGAAGGCCTGGGGGGAAGG - Intronic
1163488525 19:17603809-17603831 TTTTGGTGGGGTAGAGGGGAGGG + Exonic
1163535398 19:17873749-17873771 TTTTTGGGGGGGAGGGGGGACGG - Intronic
1163921458 19:20293800-20293822 TTTGGGAAGTCGAGGTGGGAAGG + Intergenic
1164262351 19:23579122-23579144 TTTTGGCAGTGGGAGGGGGATGG + Intronic
1164399645 19:27893810-27893832 TGTTGGAAGAGAAGGGGAGAAGG - Intergenic
1164408868 19:27979941-27979963 TTTTGGCGGGGGGGGGGGGGGGG - Intergenic
1164463833 19:28470823-28470845 TTTGGGAAGCTGAGTGGGGAGGG + Intergenic
1164702695 19:30296939-30296961 TGTTGGCAGTGGAGAGGGGAAGG + Intronic
1165454608 19:35903482-35903504 TTTGGGGACGGGAGGTGGGATGG - Intronic
1165457476 19:35921628-35921650 TTTGGGAAGCTGAGGCGGGAGGG + Intergenic
1165736625 19:38180989-38181011 CTTTGGAAGGAGAGGAGAGAAGG - Intronic
1165817846 19:38653454-38653476 TTTTTGAAGGGCAGAAGGGAAGG + Intronic
1165881272 19:39045727-39045749 TTGTGGAATGTGAGGGAGGATGG - Intergenic
1166197306 19:41215600-41215622 TTTTGGGGGGGGAGGGGGGATGG + Intergenic
1166226600 19:41399529-41399551 TTTTTGGTGGGGAGTGGGGAGGG + Intronic
1166330829 19:42077051-42077073 TATTGGAAGGGGAGGAAGTAGGG + Intronic
1166459229 19:42971572-42971594 TCTTGGAAAGGGAGGGAGGAAGG - Intronic
1166476175 19:43126841-43126863 TCTTGGAAAGGGCGGGAGGAAGG - Intronic
1166547318 19:43640969-43640991 GTCTGGGCGGGGAGGGGGGAGGG - Intergenic
1166549062 19:43653053-43653075 TTTTGGAGGCGGAGGCGGGAGGG - Intronic
1166661131 19:44647845-44647867 TATTGGAAAGGGAGCTGGGAGGG + Intronic
1166975850 19:46604594-46604616 TTTGGGACGGGGATGGGGGTAGG + Intronic
1167055952 19:47111977-47111999 TCGGGGAAGGGGATGGGGGAGGG - Intronic
1167218433 19:48181028-48181050 TTTGGGAGGCTGAGGGGGGACGG - Intronic
1167284147 19:48589302-48589324 ACTGGGAAGGGGAGGAGGGAGGG + Intronic
1167338068 19:48898715-48898737 TGTTGGAAGTGGAGAGTGGAGGG - Exonic
1167389587 19:49185753-49185775 TTTTTTGGGGGGAGGGGGGATGG + Intronic
1167612375 19:50513724-50513746 TTTAGGAAGGGGTTTGGGGAAGG + Intronic
1167830317 19:52014709-52014731 TCCTGGAAGGGGAGGGGTGCTGG - Exonic
1168076468 19:53982990-53983012 CTTCGGAGGGGGAGGGGGGCGGG - Exonic
1168122307 19:54258508-54258530 TCATGGAAAGGGAGGGGGTAGGG + Intronic
1168464965 19:56594930-56594952 GGATGGAAGGGGAGGAGGGATGG - Intergenic
925151012 2:1614974-1614996 ATTTGGAAGGGGAGGGAGTGGGG + Intergenic
925297016 2:2784074-2784096 TTTTGGATGGGGGGAGGTGATGG - Intergenic
925420207 2:3704499-3704521 TAGGGGAGGGGGAGGGGGGAGGG + Intronic
925420296 2:3704697-3704719 TAGGGGAGGGGGAGGGGGGAGGG + Intronic
925440027 2:3877774-3877796 GTTTGGTTGGGGTGGGGGGAGGG - Intergenic
925519144 2:4722266-4722288 TTTCAGAAGGGGAGGGGAAAGGG - Intergenic
925556787 2:5139869-5139891 TGTTGGAAGGGGAGTTGGGGAGG + Intergenic
925755363 2:7128037-7128059 GGGAGGAAGGGGAGGGGGGAGGG - Intergenic
926026498 2:9549760-9549782 TTTTGGAAAGCTAAGGGGGAAGG - Intronic
926185253 2:10685492-10685514 TTTTGGCGGGGGGGGGGGGGGGG - Intronic
926259763 2:11248211-11248233 TTTTGGGGGGGGATGGGGGGAGG + Intronic
926430527 2:12780686-12780708 TGTGGGGTGGGGAGGGGGGAGGG + Intergenic
926856064 2:17257188-17257210 TTTTTAAAGGAGAGAGGGGAAGG + Intergenic
927035491 2:19170935-19170957 TTTGGGAAGGGTAGGTGGGAGGG - Intergenic
927284454 2:21341901-21341923 TTGGGGTGGGGGAGGGGGGAGGG + Intergenic
927411474 2:22831079-22831101 TTTTGGGGGGGGGTGGGGGACGG - Intergenic
927425701 2:22979021-22979043 TTTGGGAAGGGGAGAGGGACTGG + Intergenic
927482379 2:23464531-23464553 CTTAGGCAGGGGAGTGGGGACGG - Intronic
927518782 2:23687166-23687188 TCTTGTAAGGGGAGGGAGTAGGG + Intronic
927694763 2:25232234-25232256 TTTTATAATGGGAGGGGGGATGG - Exonic
927703217 2:25281002-25281024 ATTTGGAAGGGCAGGGCTGATGG + Intronic
927770547 2:25857078-25857100 TTTTGGGGGGGGCGGGGGGGGGG + Intronic
927910127 2:26891561-26891583 TTTTGAAAGGAGATGGGTGAGGG - Intronic
928261754 2:29774281-29774303 TCTTGGCAGGGGAGGGTGGTTGG - Intronic
928443132 2:31310600-31310622 TTTTGGCAGGGGTTGGGGGGTGG + Intergenic
928538001 2:32258517-32258539 TATTGATAGGGAAGGGGGGAAGG - Intronic
928624202 2:33122687-33122709 TTTCTGAAGGGGAGTAGGGATGG + Intronic
929095853 2:38262723-38262745 ATGTGGAGGGGGAGGGGGCAGGG - Intergenic
929103461 2:38340165-38340187 TTTTGGTGGGGGGGGGGGGGGGG + Intronic
929433538 2:41908951-41908973 TTTTGAAAGAGGAAGAGGGAAGG + Intergenic
929548939 2:42876853-42876875 TTTTTGGAGGGGAGGGGGGCAGG + Intergenic
929548940 2:42876854-42876876 TTTTGGAGGGGAGGGGGGCAGGG + Intergenic
929716441 2:44315485-44315507 TTTTGGCGGGGGTAGGGGGAAGG - Intronic
929748229 2:44681552-44681574 TTTTGGAGGGGGAGGGGAATGGG + Intronic
929776525 2:44934044-44934066 TTTAGGAGGGGGAGAGGGGCTGG + Intergenic
929879829 2:45825916-45825938 ATTTGGCAGGGACGGGGGGATGG + Intronic
930126487 2:47801810-47801832 TTTTGGTGGGGGAAGGGGGAAGG + Intronic
930226537 2:48799915-48799937 TTTTGGGAGGAGAGGGAGGCTGG + Intergenic
930269143 2:49235501-49235523 TTTTGGTGGGGGTCGGGGGATGG + Intergenic
930707719 2:54520981-54521003 TTTAGGAAGAGAAGGGAGGAAGG - Intronic
931667151 2:64617699-64617721 TTTTGGAAGGGGAGATTGGAGGG - Intergenic
931675020 2:64686102-64686124 CATTGGAAAGGGAGGGGGGATGG - Intronic
931762856 2:65432270-65432292 TTTGGGAAGGGGACGGCGGTGGG + Intronic
932116087 2:69049213-69049235 TTTTGGCAGGGGATGGGGATGGG - Intronic
932134519 2:69216702-69216724 TTTGGGAAGTGGAGGGGACAAGG - Intronic
932291758 2:70586786-70586808 GTCTGGAAGGGTAAGGGGGAAGG - Intergenic
932305212 2:70697140-70697162 TTTTGGGAGGGTGTGGGGGACGG - Intronic
932312895 2:70758428-70758450 TTTTGGAAGGGTTGGGAGGGTGG + Intronic
932565692 2:72906927-72906949 TTTTGGCGGGGGTGGGGGGCGGG + Intergenic
932605186 2:73160574-73160596 GGATGGAAGGGTAGGGGGGATGG + Intergenic
932647905 2:73523760-73523782 TTTTTGGTGGGGAAGGGGGAAGG - Intronic
932887197 2:75559154-75559176 TCTTGGAAGCGGAGTGGGGGAGG + Intronic
933154365 2:78955947-78955969 TATTGGGTGGGGAGAGGGGAGGG + Intergenic
933217777 2:79650169-79650191 TTTTCGGGGGGGGGGGGGGAGGG + Intronic
933321521 2:80781141-80781163 TTTGGGAAGGGGTGGGGGTGGGG + Intergenic
933400675 2:81793187-81793209 TTTGGGAAGGGGTGGCGCGAGGG - Intergenic
933522673 2:83392806-83392828 TTTTGGAGGGGGGCGGGGGAGGG + Intergenic
933943042 2:87260942-87260964 TGAAGGAAGGGGAGGGGTGAAGG + Intergenic
934130331 2:88942011-88942033 TTTTGGATTGAGATGGGGGAGGG + Intergenic
935178280 2:100668439-100668461 TTTGGGAAGAGGAGGGAGAATGG + Intergenic
935520361 2:104096756-104096778 TTTTGGCAGGGGTGGGAGGGTGG - Intergenic
935839965 2:107098450-107098472 TCTTGGCAGTGGTGGGGGGAAGG - Intergenic
935933116 2:108151726-108151748 TTTAGGAAGAGGAGAGGGAAAGG - Intergenic
935958306 2:108400122-108400144 AGCTGGAAGGGGAGGGGGTAAGG - Intergenic
935986168 2:108675316-108675338 TGGGGGAAGAGGAGGGGGGAAGG + Intronic
936138609 2:109918931-109918953 TGGGGGAAGAGGAGGGGGGAAGG + Intergenic
936206087 2:110452554-110452576 TGGGGGAAGAGGAGGGGGGAAGG - Intronic
936280070 2:111131207-111131229 TTTTGGCGGGGGATGGGGGCGGG + Intronic
936337171 2:111600620-111600642 TGAAGGAAGGGGAGGGGTGAAGG - Intergenic
936971126 2:118177281-118177303 TGGTGGAACGGGAGTGGGGAAGG - Intergenic
937358195 2:121211583-121211605 TTTGGGAATGGGGGGCGGGAGGG + Intergenic
937387945 2:121454145-121454167 TTTTGGAGGGGGGGGTGGGCAGG - Intronic
937542406 2:122974218-122974240 TGTGGGAGGGGGAGGGGGAAGGG - Intergenic
937542407 2:122974219-122974241 TTGTGGGAGGGGGAGGGGGAAGG - Intergenic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
937619428 2:123968553-123968575 TTTTAGTAGAGAAGGGGGGATGG + Intergenic
937892876 2:126952853-126952875 TATTGCAAGGGAAGGGGGAAAGG - Intergenic
937898010 2:126993275-126993297 TTTTGGTAGGAGAGGGGTCAAGG - Intergenic
938267590 2:129939524-129939546 TTTAGGAAGCTGAGGTGGGAAGG + Intergenic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
938872188 2:135490979-135491001 GTTGGGAAGGGTAGTGGGGAGGG + Intronic
938894625 2:135737949-135737971 TGTAGGAAGGGTAGGGGGGTGGG - Intergenic
938906190 2:135838170-135838192 TATAGGAAGAGGAGGGGGGAGGG - Intergenic
939139749 2:138340126-138340148 TTTTTTAAGGGGTGGGGGGCAGG - Intergenic
939330492 2:140753041-140753063 GTTTGCCAGGGGATGGGGGAAGG - Intronic
939549671 2:143598661-143598683 TTTGGGAAGCTGAGGCGGGAGGG + Intronic
939617405 2:144376843-144376865 TTTTGTAGGGGGAAGGGAGAAGG + Intergenic
939814755 2:146880145-146880167 TTTTGGGCGGGGGGGGGGGGGGG + Intergenic
940044671 2:149396889-149396911 TTTTGGTATGGGAGGGCAGAGGG - Intronic
940133045 2:150406050-150406072 TTTTTGGAGGGGGGCGGGGAAGG - Intergenic
940250215 2:151666802-151666824 TTTGGGAAGCTGAGGAGGGAGGG - Intronic
940638747 2:156327559-156327581 ATATGGAAGAGGAGGGGCGATGG + Intronic
940766805 2:157798518-157798540 TTTTGGAGGGGGTGGGGGGTGGG + Intronic
940919560 2:159292110-159292132 TTTTGGAAGAGCATGTGGGATGG - Intergenic
941079195 2:161040718-161040740 GTTTGGAGGGGTAGGGGGGCAGG + Intergenic
941294147 2:163715166-163715188 TTTGGGGAGGGGAGAGGAGAAGG + Intronic
941429865 2:165400986-165401008 TTTTGGAAGGCCAGGTGGGGAGG + Intergenic
941466067 2:165828674-165828696 TTTGGGAAGGTGAGGAAGGAGGG - Intergenic
941524858 2:166594678-166594700 CTTTGGAAGGCCAAGGGGGATGG + Intergenic
941966650 2:171307127-171307149 TTTGGGAAGCTGAGGTGGGAGGG - Intergenic
942271024 2:174275427-174275449 TTTTGTGGGGGGAGTGGGGAGGG - Intergenic
942368470 2:175255796-175255818 TATTGGTAGGGGTGGTGGGAAGG + Intergenic
942454305 2:176127717-176127739 TTTTGGAATGGAATGGGGGGGGG - Intergenic
942488619 2:176467024-176467046 TTTGGGTAGGGGAGGGGTTAGGG - Intergenic
942543038 2:177034670-177034692 TTGTGGGATGGGGGGGGGGAGGG - Intergenic
942891847 2:180999625-180999647 TTTTGGGAGGGGTGGAGGGCGGG - Intronic
942944012 2:181653742-181653764 ACTGGGAAGGGGAGGGGAGAAGG + Intronic
943247016 2:185467625-185467647 TTTTTGAGGGGGAGGGTGGCAGG + Intergenic
943365178 2:186961923-186961945 TCTCGAAAGGGGTGGGGGGAGGG - Intergenic
943419598 2:187654463-187654485 TTTTGGCAGGGGTGGGGTGGGGG + Intergenic
943608459 2:190004123-190004145 CTTAGAATGGGGAGGGGGGAGGG + Intronic
943928781 2:193822183-193822205 TGTTGGGGGGGGAGGGGGGAGGG + Intergenic
944402599 2:199345413-199345435 GTTTGTGGGGGGAGGGGGGAGGG - Intronic
944526435 2:200624473-200624495 GTTTGGAAAGGGAAAGGGGAGGG + Intronic
944532085 2:200677198-200677220 TTAGGGAAGGGGAGGAGAGAAGG + Intergenic
944783949 2:203048470-203048492 TTTTTGATGGGGAGGGAGGGAGG + Intronic
945095281 2:206213481-206213503 TTATGGAGGGGGGTGGGGGAAGG - Intronic
945098207 2:206239359-206239381 TATGTGGAGGGGAGGGGGGAAGG + Intergenic
945289035 2:208109841-208109863 CTTTGGAAGGCCAGGGTGGAAGG + Intergenic
945296357 2:208175035-208175057 TTTTGGAGGCCGAGGGGGGTGGG + Intronic
945445182 2:209928826-209928848 GCTAGGAAGGGGAGGCGGGAGGG - Intronic
945691413 2:213041336-213041358 TTTTGGGGGGGGTGGGAGGATGG + Intronic
945993174 2:216413140-216413162 TCGTGGTGGGGGAGGGGGGAGGG + Intronic
946127438 2:217575783-217575805 GCTAGGAAGGGGAGGGGGAAGGG + Intronic
946440297 2:219689396-219689418 TTGTGGAAGGAGAGGGAGGACGG - Intergenic
946474167 2:219991949-219991971 TTTTTAAAGTGTAGGGGGGAAGG - Intergenic
946643268 2:221806911-221806933 TTTGGGAAGGAGAGAGAGGAAGG - Intergenic
946728714 2:222688052-222688074 TTTTTGAAGGGGGAGGTGGAAGG - Intronic
946736757 2:222761567-222761589 TTTTGGAAGGCCAGGGTGGGAGG + Intergenic
946746840 2:222854697-222854719 TTTTGGGGGGGGGGAGGGGAGGG - Intergenic
947224444 2:227826429-227826451 TTATGGTAGGGCAGGGAGGAGGG - Intergenic
947285317 2:228507552-228507574 TTGTGGAAGGGGAGTGGGTAAGG + Intergenic
947293684 2:228606481-228606503 TGGTGTAGGGGGAGGGGGGAGGG - Intergenic
947659586 2:231856535-231856557 TTTGGGAAGATGAGGTGGGAGGG - Intergenic
947732186 2:232437406-232437428 GTGTGGAAGGGGAGGGGAGCTGG + Intergenic
947952184 2:234158014-234158036 CTTAGGGAGGGGATGGGGGAGGG - Intergenic
948013728 2:234671093-234671115 TTTGCAAAGGTGAGGGGGGAAGG + Intergenic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948796674 2:240406494-240406516 TTTTGGAGGGGGCAGGAGGAAGG - Intergenic
1168745568 20:236878-236900 TTTTGGTTGGGGAGGGGACAGGG - Intergenic
1168761869 20:354825-354847 TATTGAAAGGGAAGGTGGGATGG - Exonic
1168927911 20:1598159-1598181 ATGTGGCAGGGGAGGAGGGAAGG + Intronic
1169270056 20:4192349-4192371 TTTTGGAATGGGAGAATGGAGGG - Intergenic
1169437467 20:5605729-5605751 TTTTGGAGGGGGAGGCAGGTGGG - Intronic
1169469762 20:5874023-5874045 TCTGGGAAGGGGAGGGGAGCTGG + Intergenic
1169559115 20:6780347-6780369 TTTTAGAGGGGGTGGGGGAAAGG + Intergenic
1169669462 20:8080102-8080124 TTTTGTAAGTGGTGGGTGGAAGG + Intergenic
1169700469 20:8440634-8440656 CTTTGGAAGGGTTGGGGGAAGGG + Intronic
1169703941 20:8481105-8481127 TTTTGGGAGGGTGGGGGGTAGGG - Intronic
1169737682 20:8854549-8854571 TTTTGCAAGGGGAGGGGAGTAGG + Intronic
1169836089 20:9880844-9880866 GCTTGGAAGGGTAGGGGGTAGGG - Intergenic
1170209619 20:13835587-13835609 TTCAGGAAGGGGAGAGGGGCTGG + Intergenic
1170432868 20:16293298-16293320 TTTTGGTAGGGGAGGAGGAAGGG + Intronic
1171434776 20:25112814-25112836 TGTTGTCGGGGGAGGGGGGAGGG + Intergenic
1171500656 20:25590456-25590478 TATTGGAATGGGAGGGAAGAAGG - Intergenic
1171771430 20:29325675-29325697 CCTTGGAAGGGAAGGAGGGAGGG + Intergenic
1171913661 20:30991304-30991326 TTTTGGGGGGGGAGGGGGGAGGG + Intergenic
1172259561 20:33550863-33550885 TTTGGGAAGCCGAGAGGGGACGG - Intronic
1172265080 20:33604818-33604840 TTCTGGAAGGGTAGGGGAGAAGG - Intronic
1172301380 20:33852875-33852897 TTGTGCGAGGGGATGGGGGAAGG - Intronic
1172369683 20:34379194-34379216 TTTTGGAAGGGAATGGAGAATGG + Intronic
1172389556 20:34557927-34557949 TTTTTTTGGGGGAGGGGGGAGGG - Intronic
1172479781 20:35264216-35264238 GTGTGGAAGGGGAGGGGTAAAGG - Intronic
1172497079 20:35395200-35395222 TTTTGGAAGGGGAGAGGGGCTGG - Intronic
1173020417 20:39262922-39262944 GTTGGGAAGGGTAGTGGGGAGGG + Intergenic
1173375228 20:42476985-42477007 TGGTGGAAGGAGAAGGGGGAAGG - Intronic
1173772209 20:45670503-45670525 TTTTTGCGGGGCAGGGGGGAGGG - Intergenic
1173952225 20:47002350-47002372 TTAGGGAAGGGTAGGGGAGAGGG - Intronic
1173986584 20:47266270-47266292 TTTTTGGGGGGGAGGGGGGCGGG + Intronic
1174230947 20:49045247-49045269 TTATGGATGGGGAGGAGGGCAGG + Intergenic
1174348183 20:49947218-49947240 TTTTGGGGGGGGGGGGGGGGGGG - Intronic
1174573998 20:51524109-51524131 TTCTGGAAAGAGAAGGGGGAAGG + Exonic
1174616340 20:51838391-51838413 TTTTTGGGGGGGCGGGGGGAGGG + Intergenic
1175215118 20:57388216-57388238 TTTGGGAGGCGGAGGTGGGAGGG + Intergenic
1175359109 20:58393545-58393567 TCATGGAAGGGGAGGGAGAAGGG - Intronic
1175395649 20:58658828-58658850 TCTTTTAAGGGGAGGGGGAAGGG - Intronic
1175414366 20:58792182-58792204 GTTTGGAGTGGGAGAGGGGAAGG - Intergenic
1175454825 20:59104577-59104599 TTTAGGAAGAGGAAGTGGGAGGG - Intergenic
1175554997 20:59845318-59845340 TTGTGGCGGGGGACGGGGGAAGG - Intronic
1175639813 20:60619572-60619594 TGTTGGAAGGGCATGTGGGAGGG + Intergenic
1176159270 20:63640382-63640404 TGTTGGAAGGGCAGCGGGTAAGG - Exonic
1176350359 21:5789478-5789500 TGTTGGGGGGGGAGGGGGGAGGG + Intergenic
1176357173 21:5910062-5910084 TGTTGGGGGGGGAGGGGGGAGGG + Intergenic
1176429523 21:6567337-6567359 ACTTGGAGGGGGTGGGGGGAGGG + Intergenic
1176544680 21:8187548-8187570 TGTTGGGGGGGGAGGGGGGAGGG + Intergenic
1176563631 21:8370593-8370615 TGTTGGGGGGGGAGGGGGGAGGG + Intergenic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1176736411 21:10551286-10551308 TTGGGTAGGGGGAGGGGGGAGGG + Intronic
1176813471 21:13571423-13571445 ATTAGGAAGGGTAGTGGGGAGGG - Intergenic
1176863981 21:14032294-14032316 TTGGGCAAGGGGAGGTGGGAGGG - Intergenic
1176876685 21:14136483-14136505 TTTGGAAAGGGGAGGGAAGAGGG + Intronic
1177156942 21:17510373-17510395 TTTAGGAGGAGGAGGGGGGGGGG - Intergenic
1177240122 21:18444849-18444871 GTTTGGAAGGAGAGGAGGTAAGG - Intronic
1178058732 21:28828706-28828728 TTTTGGAAGGTGAGCTGGCATGG - Intergenic
1178282288 21:31293941-31293963 TGTTGGGAGGGGAGGGAGGGTGG - Intronic
1178384457 21:32138063-32138085 TTTTGATACGGGAGGGGGGCAGG + Intergenic
1178503762 21:33146773-33146795 CATTGGTAGGGGAGTGGGGAAGG - Intergenic
1178524998 21:33320247-33320269 TTTTTGGTGGGGAGGGGAGAGGG - Intergenic
1179046128 21:37846882-37846904 TCAGGGAAGAGGAGGGGGGAAGG - Intronic
1179201624 21:39228297-39228319 TCTTGGTAGGGGCCGGGGGACGG - Intronic
1179413892 21:41182516-41182538 ATTCTAAAGGGGAGGGGGGAAGG + Intronic
1179515120 21:41900851-41900873 TTTTGGAAGGCCAAGGTGGATGG + Intronic
1179704917 21:43174799-43174821 ACTTGGAGGGGGTGGGGGGAGGG + Intergenic
1180474289 22:15688830-15688852 TTGTGTGGGGGGAGGGGGGAGGG - Intergenic
1181013159 22:20053998-20054020 CTTTGGAGGGGGAGGAGGGCAGG - Intronic
1181236669 22:21451124-21451146 ACCTCGAAGGGGAGGGGGGAGGG + Exonic
1181375176 22:22452383-22452405 ATGTGGAAGGGGAGAGGGTAAGG - Intergenic
1181389565 22:22570547-22570569 TGTTGTGGGGGGAGGGGGGAGGG - Intergenic
1181778774 22:25178330-25178352 TGTTGGAAGGGCAGTGGGTAAGG - Intronic
1181815482 22:25433600-25433622 TGTCGGAAGGGGAAGGGGAAGGG + Intergenic
1182253165 22:29018071-29018093 GTGTGGGAGGGGAGGGCGGACGG + Intronic
1182424957 22:30266919-30266941 GTGGGGATGGGGAGGGGGGAGGG + Intergenic
1182427742 22:30283797-30283819 TTTTGTTGGGGGAGGGGGGTTGG - Intergenic
1182554195 22:31120242-31120264 TCTTGGTGGGGGAGGGGGGTGGG - Intergenic
1182739512 22:32557297-32557319 ATTCACAAGGGGAGGGGGGATGG + Intronic
1182950781 22:34373739-34373761 ATATGGCTGGGGAGGGGGGAAGG + Intergenic
1183069778 22:35387896-35387918 TTCTGAAGGGGGAGGGTGGAAGG - Intronic
1183112650 22:35662161-35662183 CTTTGGAAGGGAAGGGAGGTGGG + Exonic
1183231744 22:36586639-36586661 GTTGGGAAGGGGAGGTGGCAGGG + Intronic
1183252107 22:36737461-36737483 TTGTGGAGGGGAAGGGGGTAAGG + Intergenic
1183520232 22:38292673-38292695 TTGGGGAAGGGGAGGCGGCAGGG - Intronic
1183528909 22:38341748-38341770 TTTGGGAAGCTGAGGGGGGCAGG - Intronic
1183532732 22:38371424-38371446 TTGAGTAGGGGGAGGGGGGAGGG - Intronic
1183655699 22:39183469-39183491 TTTTGGCGGGGGAATGGGGATGG + Intergenic
1183790566 22:40065104-40065126 TTTTGGAGGGTGGGGGTGGAGGG + Intronic
1183914853 22:41109719-41109741 TTTTGGCAGGGGGAGGAGGACGG + Intronic
1184031199 22:41895841-41895863 TGTTGAAAGGGGATGGGGGCTGG + Intronic
1184313765 22:43666220-43666242 TTCTGGCTGGGGAGGGGAGAGGG + Intronic
1184468030 22:44680382-44680404 TAGTGGAAGGAAAGGGGGGATGG + Intronic
1184966165 22:47973743-47973765 GTTTGGCAGGGGGTGGGGGAAGG + Intergenic
1185009351 22:48304647-48304669 TTTTGATGGGGGAAGGGGGATGG - Intergenic
1185093453 22:48790772-48790794 GATTGGAAGGGGAGGGAGGAGGG - Intronic
1203249548 22_KI270733v1_random:103785-103807 TGTTGGGGGGGGAGGGGGGAGGG + Intergenic
949491212 3:4590874-4590896 TTGTGGAGGGGGAGGGTGGAAGG - Intronic
949507872 3:4743732-4743754 TTGTTGAGGGGGAAGGGGGAGGG + Intronic
949775328 3:7626185-7626207 TTCTGGGAGGGGAGGGACGAGGG - Intronic
949785374 3:7734235-7734257 CTTTGGCAGGGGCGGGGGGGGGG + Intronic
950047395 3:9957635-9957657 TTGTGGGAGGGGAGGGAGCAGGG - Intergenic
950143745 3:10633283-10633305 TTTTGGAAGCGGAGGCAGGGTGG - Intronic
950490068 3:13299227-13299249 TTTTTTGAGGGGTGGGGGGATGG - Intergenic
950499466 3:13354561-13354583 TTTGGGAAGGTGAGGGCAGAGGG - Intronic
950633820 3:14301417-14301439 TTTTTGAAAGGCATGGGGGAAGG - Intergenic
950718344 3:14865244-14865266 GCTTGGAAGGGGAGGGATGATGG - Intronic
950766604 3:15277720-15277742 TTTAGAAAGGGGAGTGGGGAAGG - Intronic
950791117 3:15473257-15473279 CTTAGGAAGGTGAGGCGGGAGGG - Intronic
950825059 3:15809964-15809986 TTGTGGATGAGGAGGTGGGAGGG - Intronic
952107551 3:30087617-30087639 AGGTGGAGGGGGAGGGGGGAGGG - Intergenic
952136969 3:30433466-30433488 TCGGGGGAGGGGAGGGGGGAGGG + Intergenic
952249524 3:31637853-31637875 TTTTGGAAGGGATTTGGGGAGGG + Intergenic
952385703 3:32840222-32840244 CTTTGGAAGGGAAGGGGGGTGGG - Intronic
952576844 3:34784518-34784540 TTTTGGAGGGGGTGTGAGGAAGG - Intergenic
952603226 3:35109772-35109794 GTGGGGAAGAGGAGGGGGGAGGG + Intergenic
952767560 3:36968150-36968172 ATGGGGTAGGGGAGGGGGGAGGG - Intergenic
952784245 3:37136953-37136975 TTTTGGGGGGGGTGGGGGGGTGG + Intronic
952880148 3:37980143-37980165 TTTAGGCAGAGGAGTGGGGAGGG - Intronic
952899623 3:38101125-38101147 TTTGGGAAGGAGTGGGGAGAAGG - Intronic
953136889 3:40189493-40189515 GCCTGGAAGGGGAGGGGAGAGGG - Intronic
953169413 3:40493777-40493799 TCTGGGAAGGGGAGAGGGGCTGG + Intergenic
953309464 3:41863181-41863203 TTTGGAAAGGGGAAGGAGGAAGG - Intronic
953799657 3:46012707-46012729 TTTTGGTGGGGGGAGGGGGATGG + Intergenic
953933022 3:47015969-47015991 TTTTGGGGGGGGGTGGGGGAGGG - Intergenic
954033973 3:47840526-47840548 CTTTGGAAGTTGAGGTGGGAGGG + Intronic
954175293 3:48840245-48840267 TTTGGGAAGTCGAGGCGGGACGG + Intronic
954254649 3:49395834-49395856 TAATGGAAGGGGAGGTGGAATGG + Intronic
954347407 3:50012092-50012114 TTTGGGAAGGTGAGGCAGGAAGG - Intronic
954489938 3:50893973-50893995 TTAGGTGAGGGGAGGGGGGAGGG + Intronic
954723025 3:52581998-52582020 TTTGGGAAGGTGAGGTGGGTGGG + Intronic
954881654 3:53840054-53840076 TTCAGGAAGGGAAGGGAGGATGG + Intronic
954900617 3:54016185-54016207 TGTGGGCAGGGGAGGGGAGAAGG + Intergenic
954996724 3:54888473-54888495 TTTCTGAAGTGGAGGGTGGAGGG + Intronic
955116960 3:56015357-56015379 TGTTGGAAGGGGTCGGGGGAGGG - Intronic
955300854 3:57777099-57777121 TTTTTTGGGGGGAGGGGGGAGGG + Intronic
955596321 3:60594615-60594637 TGTTGGAAGGGGAGAGGAGAGGG - Intronic
955850892 3:63218653-63218675 TTTTGGAGGCTGAGGCGGGACGG - Intergenic
955895039 3:63689890-63689912 TTGGGTGAGGGGAGGGGGGAGGG + Intergenic
956096175 3:65718889-65718911 TTTTTGAAAGGAAGGGAGGAAGG - Intronic
956413656 3:69004714-69004736 TTGGGGAATGGGTGGGGGGATGG - Intronic
956418093 3:69054271-69054293 TTTGGGAAGCCGAGGGGGGCGGG + Intergenic
956511019 3:69993607-69993629 TTTTGGAAGTTGAGGAAGGAGGG - Intergenic
956541564 3:70345642-70345664 TTTTGGAGGGGATGAGGGGAGGG - Intergenic
956683980 3:71807303-71807325 TTTTGGAGGCCGAGGAGGGAGGG - Intergenic
957219814 3:77367375-77367397 GTTGGGAAGGGGAGAGTGGAAGG - Intronic
957325955 3:78695112-78695134 TTTAGGCTGGGGTGGGGGGAGGG + Intronic
957377149 3:79372583-79372605 TTTCTGAGGGGTAGGGGGGAAGG - Intronic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
957619574 3:82578006-82578028 TTTTGGAAGCTGAGGTGGGCGGG + Intergenic
958018644 3:87971009-87971031 CTGTGGAAGGGGAGGAGGCAGGG - Intergenic
958669936 3:97190717-97190739 TTTGTGGAGGGGAGCGGGGAGGG + Intronic
958691404 3:97472143-97472165 TTTTTTGAGGGGAGGGGGAAAGG + Intronic
958914304 3:100031396-100031418 TTTGGGAAGTGGAGTGAGGAAGG + Intronic
959250662 3:103939442-103939464 TTTTGGAAGGGTAGGGAGGAGGG - Intergenic
959618569 3:108375328-108375350 GTGGGGTAGGGGAGGGGGGAGGG + Intronic
959981333 3:112521264-112521286 TCTGGGAAGGGTAGTGGGGAAGG - Intergenic
960089506 3:113625139-113625161 TTTTTGGGGGGGCGGGGGGACGG + Intronic
960616829 3:119603588-119603610 TGTTGGTGGGGGAGGGGAGAAGG - Intronic
960780904 3:121315483-121315505 TGTGGGGTGGGGAGGGGGGAGGG + Intronic
961387252 3:126529746-126529768 TGATGGGAGGGGAGGAGGGATGG - Intronic
961507311 3:127378578-127378600 TTCTGGAAGGGGTGGGGGTGAGG - Intergenic
961522743 3:127476671-127476693 GGTGGGAAGGGGAGGGGGAAGGG + Intergenic
961531652 3:127543846-127543868 TTTTGGAGGTGGAGGTGGCAGGG + Intergenic
962018895 3:131475415-131475437 TTTGGGAAGTTGAGGTGGGAGGG + Intronic
962073527 3:132056610-132056632 TTGGGTGAGGGGAGGGGGGAGGG - Intronic
962517716 3:136169225-136169247 TTTTGGCGGGGGGGGGGGGGGGG + Intronic
963001628 3:140687115-140687137 TTTTGAAAGGAGTGGGGGAAAGG + Intronic
963034093 3:141010131-141010153 TTTGGGAAGGTGAGGCAGGAGGG + Intergenic
963100245 3:141595133-141595155 TTTGGGAGGAGGAGAGGGGATGG - Intronic
963498210 3:146095897-146095919 CTGTGGAGGGAGAGGGGGGAGGG - Intronic
963579560 3:147108474-147108496 TGTGGGTGGGGGAGGGGGGAGGG - Intergenic
963923166 3:150925146-150925168 TATTGGAAGGGGAGAGGGTGAGG + Intronic
964412048 3:156408031-156408053 TTGTGGAAGGTGACGGGGGAGGG + Intronic
964445783 3:156755843-156755865 TTTGGGGGTGGGAGGGGGGATGG + Intergenic
964528229 3:157638804-157638826 TTTTGGCAGGGTATGTGGGAGGG - Intronic
964678872 3:159315916-159315938 TTTTTGTCGGGGAGGGGGTAGGG + Intronic
964790112 3:160446050-160446072 TTTGGGAGGCTGAGGGGGGAAGG - Intronic
964966292 3:162497158-162497180 TGGTGGAAGGGGAAGGGGAAGGG + Intergenic
964976535 3:162627616-162627638 TTTGGGAGGCGGAGGGGGGCTGG + Intergenic
965065613 3:163843675-163843697 TTTTGAAAGGTGAAAGGGGAGGG - Intergenic
965825752 3:172727861-172727883 TTTGGGAAGCTGAGGCGGGAGGG - Intergenic
966133173 3:176667526-176667548 GTTGGGAAGGGTAGTGGGGAGGG - Intergenic
966183114 3:177204508-177204530 TTTGGGAAGCTGAGGTGGGAGGG - Intergenic
966310105 3:178584428-178584450 TTTTGGAGAGGGAGGGAGGGAGG - Intronic
966601768 3:181782390-181782412 TGTTGGAAGGAGAGGGGGACAGG - Intergenic
966690340 3:182734906-182734928 TTTTGGAGGGGGACAGGGGATGG + Intergenic
967628255 3:191711429-191711451 TTTAGGATGGGGAGGCGGGAGGG + Intergenic
967681391 3:192368091-192368113 TTTTGGAAGGGGAGGGAGGTGGG - Intronic
967976778 3:195039926-195039948 TTTTGATGGGGGATGGGGGATGG + Intergenic
968215187 3:196883392-196883414 TTATGGAAGCTGAGTGGGGAAGG + Intronic
968426309 4:525838-525860 GTGAGGAAGCGGAGGGGGGACGG + Intronic
968605797 4:1534744-1534766 TCTTGGTATGGGCGGGGGGAGGG - Intergenic
968700659 4:2056315-2056337 TTTTGGAGGCTGAGGTGGGAGGG + Intergenic
968940745 4:3636320-3636342 TCTAGGAAGGGGAGATGGGAGGG - Intergenic
969207670 4:5659491-5659513 TGTTGGGACGGGAGGGAGGATGG + Intronic
969289144 4:6227574-6227596 CTTTTGAAGGGGAGGGAGAAAGG - Intergenic
969437033 4:7194152-7194174 ATTTGTATGGGGAGGGGAGATGG + Intronic
969503752 4:7570819-7570841 TATTGGCAGGGGATGGGGGTGGG + Intronic
969842789 4:9895137-9895159 CTTTGGAAAGGGTGGGGTGAGGG + Intronic
969976912 4:11112668-11112690 TTTGGGAAGGGGAGTTGGGAAGG - Intergenic
970247165 4:14075639-14075661 TTTTGGATGGGGTGGGGTTAGGG - Intergenic
970265950 4:14286517-14286539 TTTTGGGGGGGGAGGGGTGGAGG - Intergenic
970305556 4:14728189-14728211 TGGGGGAGGGGGAGGGGGGAGGG + Intergenic
970538012 4:17049607-17049629 TTTTGGGGGGGGGGGGGGAATGG + Intergenic
970911614 4:21283643-21283665 TATTTCATGGGGAGGGGGGAGGG + Intronic
971004913 4:22362516-22362538 TTTTTGAAAGGGAGGGAGGAGGG - Intronic
971195329 4:24467870-24467892 TTTGGGAAGTGGTGGGGGCAGGG + Intergenic
971323800 4:25627602-25627624 TCTTGGAGGAGGTGGGGGGAGGG - Intergenic
971447882 4:26771638-26771660 TGTTGCCAGGGGATGGGGGAGGG + Intergenic
971466535 4:26969253-26969275 TTGTGGAAGGGGATGGAGGCGGG + Intronic
972115497 4:35628342-35628364 TTTTGGATGGGAAAGGAGGAAGG - Intergenic
972241971 4:37203388-37203410 ATTTGGGAGGGGAGGGGCCAGGG - Intergenic
972271017 4:37510934-37510956 TTGTGAAAGGGGAGGGAAGAAGG - Intronic
972619921 4:40737214-40737236 TTTTGCCAGGGGTGGGGGGAAGG + Intergenic
973980417 4:56304099-56304121 TGTTGGCAGGGGAGGGCAGAGGG - Intronic
974121070 4:57640000-57640022 TTTTGATATGGGAGGGGGGCAGG + Intergenic
974140728 4:57883207-57883229 TTTTTACAGGGGAGGGTGGATGG + Intergenic
974331133 4:60480688-60480710 TTGTGGGGGAGGAGGGGGGAGGG - Intergenic
974403658 4:61437842-61437864 TGTTGCAAGGGGAGGGAGGGAGG - Intronic
974758720 4:66247634-66247656 TATTGGAAGGTGAATGGGGAGGG + Intergenic
974885915 4:67816902-67816924 TTTTGGCGGGGGGGAGGGGAGGG + Intergenic
974887618 4:67839972-67839994 TGTTGTCGGGGGAGGGGGGAGGG - Intronic
974920446 4:68232850-68232872 TTTGTAAGGGGGAGGGGGGAGGG - Intronic
975143101 4:70938316-70938338 TTTTGGGGGGGGGGGGGGGCGGG - Intronic
975327846 4:73080102-73080124 TTTGGGAGGGGGAGGGGGGATGG - Intronic
976003416 4:80399690-80399712 TTGAGGTGGGGGAGGGGGGAGGG + Intronic
976240673 4:82953229-82953251 TTTGGGAAGCTGAGGTGGGAGGG - Intronic
976392135 4:84516714-84516736 TTTTTGAAGGTGAGGAGTGAGGG - Intergenic
976571541 4:86617566-86617588 TGCTGGAAGGGGAAGGGGGAGGG - Intronic
976666159 4:87594906-87594928 TTCTGGAGGTGGAGGAGGGAGGG + Intergenic
977027445 4:91836802-91836824 TTTGGGGAAGGGAGGGAGGATGG + Intergenic
977202493 4:94133124-94133146 TTTTGTTGGGGGGGGGGGGATGG + Intergenic
977310295 4:95377976-95377998 TATTGGAAGGAGGGTGGGGAAGG - Intronic
977469704 4:97427707-97427729 TTGTGTGGGGGGAGGGGGGAGGG - Intronic
977903862 4:102453980-102454002 TTCAGGAAGGGGAGCAGGGAGGG + Intergenic
977942969 4:102878128-102878150 TTTTTGGGGGGGCGGGGGGAAGG + Intronic
978229440 4:106381012-106381034 GTTTGGAAAGGTAGGGGAGAGGG + Intergenic
978351221 4:107822934-107822956 GCTGGGAAGGGTAGGGGGGATGG - Intergenic
978364867 4:107970700-107970722 TTTTAGATGGGGCGGGGGGGGGG + Intergenic
978525750 4:109663474-109663496 TTGTGGAAGGGGAGAGAGGCAGG - Intronic
978701442 4:111651286-111651308 TTTTGGAGGGAGTGAGGGGAGGG + Intergenic
978703313 4:111675193-111675215 TTTTGATATGGGAGGGGGGCAGG + Intergenic
979116678 4:116832893-116832915 TTTTGGGGGGGGTGGGGGGTGGG + Intergenic
979231800 4:118354919-118354941 TGTGGGAAGGGGAGGGAGCAGGG - Intergenic
979436154 4:120694172-120694194 TTATGGAAGGAGAGGGGAAAGGG + Exonic
979796566 4:124853948-124853970 TTTTTGCCGGGGAGGGGGGGGGG - Intergenic
979986964 4:127327128-127327150 TTGTGTGTGGGGAGGGGGGAGGG + Intergenic
980220628 4:129909216-129909238 TTTTGAAAGGGTAGGGAGGTAGG + Intergenic
980478633 4:133355821-133355843 TTCTGGAAGGGGTGGGGGAAGGG - Intergenic
980590768 4:134885135-134885157 TTTTGGCAGGGTAGGGTGGGGGG - Intergenic
980790142 4:137609810-137609832 GCTTTGAAGAGGAGGGGGGAAGG + Intergenic
980902160 4:138915301-138915323 TTTTGGCGGGGGAGGGGTGTTGG + Intergenic
981055936 4:140361418-140361440 TTTTGGAAGGCCAGGGTGGGAGG + Intronic
981282024 4:142969431-142969453 TATTGGAAGGAGAGGGGGATGGG - Intergenic
981504849 4:145488286-145488308 TTTGGGAAGAGGAGGAGAGAGGG + Intronic
981696762 4:147566724-147566746 TTTGGGAAGCAGAGGTGGGAGGG - Intergenic
981716740 4:147759578-147759600 TTTTTAAAGGGGGGGGGGGGCGG - Intronic
981829963 4:148988062-148988084 AGTTGGAAGGGGTGGGTGGAAGG + Intergenic
982335260 4:154229406-154229428 TTTTGTAAGGGGAATTGGGATGG + Intergenic
982336899 4:154250115-154250137 TTTTGGATGGGGGAGTGGGAGGG + Intronic
982442453 4:155452900-155452922 TTTTTGAGGGTGAGGGGGCAGGG + Intergenic
983019371 4:162656222-162656244 TCTTCAGAGGGGAGGGGGGAGGG - Intergenic
983117053 4:163831339-163831361 TTTGGGAAATGGAGGTGGGAGGG + Intronic
983247005 4:165298937-165298959 TTCTGGGGGGGGAGGGGGGGCGG - Intronic
983296538 4:165874339-165874361 TTTTGCTGGGGGAGGGGAGAGGG - Intronic
983302012 4:165937845-165937867 TTTTGGGGGGGGGGTGGGGAAGG - Intronic
983393467 4:167163576-167163598 GTTGGGAAGGGTAGTGGGGAGGG - Intronic
983519549 4:168693010-168693032 ATTTGGATGAGGAGGGAGGAAGG + Intronic
983713488 4:170749208-170749230 ACTTGGAGGGAGAGGGGGGAAGG - Intergenic
983939552 4:173525585-173525607 TTTTGGAAGGGGGTGGGAGGAGG - Intronic
984033556 4:174636192-174636214 TTTTGGAGGCCGAGGGGGGGCGG + Intergenic
984206438 4:176792720-176792742 TCGGGGAAGGGGAGGGAGGAGGG - Exonic
984216737 4:176922578-176922600 TTATTGAAGGGTAGGGAGGACGG - Intergenic
984310383 4:178051003-178051025 TGGTGTAAGGGGATGGGGGAGGG - Intergenic
984563671 4:181301578-181301600 TTTGGGAAGGGAAGGAAGGACGG + Intergenic
984668331 4:182452323-182452345 TTTTGGCAGGGGACGGGGGGCGG + Intronic
984778842 4:183505810-183505832 CTTTGGAACGTGCGGGGGGAGGG + Intronic
985898135 5:2762812-2762834 TTTTGGAAGGTGAGGGCTAAGGG + Intergenic
986198587 5:5560662-5560684 TTTGCGGGGGGGAGGGGGGAGGG - Intergenic
986387497 5:7248892-7248914 TACTGGAAGGTGAGGGGGGCTGG - Intergenic
986521040 5:8618706-8618728 TTTTTGAGGGTGAGGGGGCAGGG - Intergenic
986860062 5:11916871-11916893 TTTTGAGAGGGGAGTAGGGAAGG + Intergenic
987015227 5:13811076-13811098 GCTAGGAAGGGGAGTGGGGAGGG + Intronic
987351467 5:17025896-17025918 TTGGGGGAGGGGAGGGGAGAGGG + Intergenic
987374274 5:17218747-17218769 TTCTGGAAATGGAGGGGGGACGG - Intronic
987456438 5:18152534-18152556 TTTGCGGGGGGGAGGGGGGATGG - Intergenic
987593494 5:19964335-19964357 TTTTGGAAGGCCAAGGTGGAAGG + Intronic
987955249 5:24730211-24730233 TTGTTGAAAGGGCGGGGGGAGGG + Intergenic
987971072 5:24945305-24945327 ATTTGGCAGGGGAGGGTGGCGGG - Intergenic
988297932 5:29390527-29390549 TTCAGGAAGGGGAGGGTGGCCGG - Intergenic
988706430 5:33730368-33730390 TTTTGGAAGAGGATGGGTGGGGG + Intronic
988948666 5:36234867-36234889 TTTGGGAAGGGTAGGGATGAAGG - Intronic
989203808 5:38791977-38791999 TTTGGGAAGAGGAGGGGGGCAGG - Intergenic
989744918 5:44817628-44817650 TTTTGGAAGGTGACTGGAGAGGG + Intronic
990011182 5:51000245-51000267 ATTGGGAATGGGAGGGTGGATGG + Intergenic
990337955 5:54793660-54793682 TTGGGCAAGGGGAGGGGAGATGG - Intergenic
990475544 5:56158697-56158719 TTTTTGGAGGGGAGGGGGACAGG + Intronic
990539807 5:56760936-56760958 TTTGGGACGGGGAGGAGGGTGGG - Intergenic
990604954 5:57399859-57399881 GTTAGGAAGGGTAGGGGGAAGGG - Intergenic
990759946 5:59117819-59117841 TTTTGTGAGGGGTGGTGGGATGG + Intronic
990893937 5:60676761-60676783 TTATGGAACGGGAGGGGGATGGG - Intronic
990951876 5:61306417-61306439 TTTTAGAAGTTGAGGGTGGAAGG + Intergenic
991264548 5:64701528-64701550 TTTTAGAAGGGGCTGGGGGAAGG + Intronic
991410257 5:66338664-66338686 ATTTGGAAGAGGAGGTGGGTGGG + Intergenic
991563693 5:67982525-67982547 TGTGGTAAGGGGAGGGAGGAGGG + Intergenic
992022740 5:72640431-72640453 TTTTGGTAGGGGGCAGGGGAGGG - Intergenic
992087470 5:73290927-73290949 TTTTGGTAGGGGATGGGGCCAGG + Intergenic
992171031 5:74102269-74102291 TGAAGGAAGGGGAGGGGGGGAGG - Intergenic
992652412 5:78872665-78872687 GTGGGGAGGGGGAGGGGGGAGGG + Intronic
992858274 5:80886592-80886614 TTTGGGAAGCTGAGGTGGGAGGG - Intergenic
992995644 5:82329687-82329709 CTTTGGCAGGGGTCGGGGGAGGG + Intronic
993007281 5:82442209-82442231 TATTGGGAGGGGAGATGGGAAGG + Intergenic
993061753 5:83047054-83047076 CTTTGGAAGGCCAAGGGGGATGG - Intergenic
993069882 5:83147179-83147201 TTTGGGAAGCTGAGGTGGGAGGG + Intronic
993374625 5:87135639-87135661 GTTTAGGAGGGGAGAGGGGAGGG + Intergenic
993396067 5:87390427-87390449 TTTTGAAAGCTGCGGGGGGAGGG - Intronic
993588186 5:89759095-89759117 ATTTGGATGAGGAGGTGGGAAGG - Intergenic
993621768 5:90177097-90177119 TTTTTGGTGGGGAGGGGAGATGG - Intergenic
993657182 5:90592445-90592467 TTTTGGAAAGGGTGGTAGGAGGG + Intronic
993833144 5:92784522-92784544 TTTTGGAAGGCAAAGTGGGAAGG + Intergenic
993841140 5:92880250-92880272 TTTTTAAAGGGGTTGGGGGATGG + Intergenic
993978107 5:94507445-94507467 TTTTGGGGGGGGCGGGGGGACGG - Intronic
994107610 5:95963783-95963805 ATTTGGGAGGTGAGGGGGAAGGG + Intergenic
994297698 5:98110872-98110894 TGTTGGGCGGGGTGGGGGGAGGG + Intergenic
994387777 5:99152204-99152226 TGTGGGGCGGGGAGGGGGGAGGG + Intergenic
994475268 5:100260405-100260427 TTTGGTAAGGGGAGGGGTGGGGG + Intergenic
994576861 5:101589309-101589331 GTTGGGGTGGGGAGGGGGGAGGG + Intergenic
994615800 5:102102456-102102478 TTTTGGAAAGGCAGGGAGAATGG - Intergenic
994915290 5:105968882-105968904 TTTTGTAAGGTAAGGGGGAAAGG + Intergenic
994988996 5:106974658-106974680 TTCTGCAAGGAGAGGGGGGATGG + Intergenic
995096599 5:108242462-108242484 TTTTGGAGGCTGAGGTGGGAGGG - Intronic
995245202 5:109927622-109927644 TGTTGGAGGGGGAGGGGAGGTGG - Intergenic
995327548 5:110908086-110908108 ATGGGGTAGGGGAGGGGGGAGGG + Intergenic
995649175 5:114348272-114348294 ATTACGAGGGGGAGGGGGGAGGG + Intergenic
996147911 5:119997845-119997867 TGTGGGCGGGGGAGGGGGGAGGG - Intergenic
996206502 5:120744391-120744413 GGTTGGAAGGGGATTGGGGAAGG + Intergenic
996360617 5:122641438-122641460 TGTGGGGAGGGGAGGGGGGCGGG - Intergenic
996403606 5:123087265-123087287 TCTGGGAAGCGGAGGAGGGAGGG - Intergenic
996630601 5:125626782-125626804 TGGGGTAAGGGGAGGGGGGAGGG + Intergenic
996778706 5:127160312-127160334 GTTTGGGAGGGGAATGGGGATGG - Intergenic
997131337 5:131279448-131279470 TTCTGAAAGGGGGGGGGGGAGGG - Intronic
997164097 5:131640092-131640114 TTTTGGGGGGGGGGCGGGGAGGG + Intronic
997600747 5:135136796-135136818 TGTGGGCGGGGGAGGGGGGAGGG - Intronic
998094341 5:139388756-139388778 TCTGGGATGGGGATGGGGGATGG + Intronic
998127715 5:139635586-139635608 TGTTTGAAGGGGAAGGGAGAGGG + Intergenic
998173994 5:139889643-139889665 GTTTGTAATGGGAAGGGGGAGGG - Intronic
998309764 5:141117003-141117025 TTTTGGAAGGCCAAGGTGGAAGG + Intronic
998353478 5:141515876-141515898 TTATGGAGGGGAAAGGGGGAAGG + Exonic
998500614 5:142629405-142629427 ATTTGGAAGGCCAGGGTGGAAGG - Intronic
998585638 5:143423932-143423954 TCTGGGAAGGGTAGTGGGGAGGG + Intronic
998605389 5:143628341-143628363 GGTTGGGGGGGGAGGGGGGAGGG + Intergenic
998825620 5:146098433-146098455 TGATGGAGGGGGAGGAGGGAGGG - Intronic
998940820 5:147280403-147280425 TGTTGGCGGGGGAGGGGGGTTGG + Intronic
999129819 5:149273755-149273777 AGTGTGAAGGGGAGGGGGGATGG - Intronic
999158906 5:149478745-149478767 TTTGGGAAGTTGAGGTGGGAGGG - Intergenic
999842071 5:155438430-155438452 TTTGGGCAGGGGAGGGGCAAGGG + Intergenic
1000881114 5:166698664-166698686 TTTTTAAAGGGCAGGGGGGATGG - Intergenic
1001569426 5:172720374-172720396 TTGTGGAAGGGAGGGAGGGAAGG + Intergenic
1002058882 5:176614466-176614488 TGTGGGGGGGGGAGGGGGGAGGG + Intergenic
1002157957 5:177297656-177297678 ATTTGGGGGGGGCGGGGGGAGGG + Exonic
1002176521 5:177404173-177404195 GTTAGGAAGTGGGGGGGGGAAGG - Intronic
1002278132 5:178116146-178116168 ATTTGGTGGGGGAGGAGGGAGGG - Intronic
1002309917 5:178308167-178308189 TAAGGGAAGGGGAGGAGGGAGGG + Intronic
1002338751 5:178500343-178500365 TTTGGGAAGCCGAGGCGGGAGGG + Intronic
1002355186 5:178622275-178622297 TTATATAAGGGGAAGGGGGAAGG - Intronic
1002606285 5:180384979-180385001 TTTTTGTGGGGGCGGGGGGAGGG - Intergenic
1002839987 6:897184-897206 TTTTGCAGGGTGAGGGGGGTGGG - Intergenic
1003053137 6:2797628-2797650 TTCTGGGAGGGGAGCAGGGAGGG - Intergenic
1003406978 6:5833950-5833972 TTTTGGAAGAGGGGAGGGGGTGG + Intergenic
1003683814 6:8281309-8281331 TTTTGGGGGGGGGGGGGGCATGG - Intergenic
1003851457 6:10227005-10227027 TTTTGGAAGGCCAAGGTGGAAGG + Intergenic
1004274409 6:14222699-14222721 TTATGGAAGGGGCAGGGAGATGG + Intergenic
1004275754 6:14233777-14233799 ATTTGGAAGGGCTGGGAGGATGG + Intergenic
1004327644 6:14690207-14690229 TTTTGGCGGGGGGGGGGGGGCGG - Intergenic
1004557641 6:16715024-16715046 TTAGGGAAGGAGAGGGGAGAGGG - Intronic
1004845177 6:19633896-19633918 GTGTGGAAAGGGAGGTGGGATGG + Intergenic
1004924616 6:20404170-20404192 TGCTGGAGGGGGAGGGGGGTGGG + Intronic
1005229258 6:23681342-23681364 TTATAGAAGAGGAAGGGGGATGG - Intergenic
1005399240 6:25414760-25414782 ATGTGGAAGGGGATGGGGGTTGG - Intronic
1005401770 6:25441526-25441548 TTTTAGAAGGGAAGGAGAGAGGG - Intronic
1005492971 6:26363719-26363741 TTGGGGAGGGGGAAGGGGGAGGG + Intergenic
1005694532 6:28339299-28339321 TTTTGGCAGGGGAGTGGGGAAGG + Intronic
1005941900 6:30566748-30566770 TTTTGGGGGGGGAGAGGGGGTGG + Intergenic
1006004096 6:30988780-30988802 GTGTGGGGGGGGAGGGGGGAGGG + Exonic
1006228066 6:32557701-32557723 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006230657 6:32583850-32583872 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006282102 6:33061296-33061318 TTTGGGTGGGGGAGGGGGGCGGG - Intergenic
1006367066 6:33621946-33621968 CTTTGGAGGGGGCGGAGGGACGG + Intronic
1006485269 6:34334696-34334718 TTTGGGAAGCTGAGGGAGGAGGG + Intronic
1006734725 6:36265096-36265118 TTTGGGAAGCTGAGGGGGGCGGG + Intronic
1006856402 6:37136496-37136518 GTTTGGAAAGGGAGGGAGGAGGG + Intergenic
1006934078 6:37705391-37705413 TATTGGAAGGGGAGGGGCCGGGG + Intergenic
1006936024 6:37718814-37718836 TTTGGGAAGCCGAGGGAGGAAGG + Intergenic
1007381388 6:41492497-41492519 ATTTGGAAGGGATCGGGGGAGGG + Intergenic
1007412981 6:41675407-41675429 TCTTGGTGGGGGAGGGGGCAAGG + Intergenic
1007449851 6:41934538-41934560 TTTTGGAAGTGGACGTCGGAAGG - Intergenic
1007459923 6:42010431-42010453 AGTTGGAAGGAGAGGAGGGAGGG + Intronic
1007491218 6:42223595-42223617 TTTTGGAGGGTGGGGGGGGTGGG - Intergenic
1007586550 6:42993856-42993878 TTTGGTGAGGGGAGGGGGTAGGG + Intronic
1008541386 6:52549270-52549292 TTTTGGAAGGAAGGGAGGGAGGG - Intronic
1008558832 6:52703460-52703482 ATTTGTAAAGGGAGGAGGGAAGG - Intergenic
1008941925 6:57056552-57056574 TTTTTGGATGGGAGAGGGGAGGG + Intergenic
1009437649 6:63636195-63636217 GTGTGGAAGGGGATGGGGGAGGG - Intronic
1009497328 6:64367490-64367512 TTTTGGAAAGAGAGGGAGGATGG + Intronic
1009689718 6:67013292-67013314 TTTGGGAAGCTGAGGTGGGAGGG - Intergenic
1009708837 6:67291084-67291106 TTTGGGAGGTGGAGGTGGGAGGG + Intergenic
1009826308 6:68869759-68869781 TATTTGCAGGGGAGGGGGGCGGG + Intronic
1010151011 6:72732310-72732332 ATTAGGAAGGGGAGGGGAGGTGG + Intronic
1010211011 6:73363025-73363047 TCTTGGGAGGGGAAGGTGGAAGG - Intronic
1010248828 6:73687441-73687463 GTAGGGAAGGGGAGGGGGAAAGG - Intergenic
1010344035 6:74790464-74790486 TGTGGTCAGGGGAGGGGGGAAGG + Intergenic
1010507566 6:76679034-76679056 TTCTGTAGGGGGAGGGGGGAAGG + Intergenic
1011179049 6:84598651-84598673 ATTTGGAAGGGGAGAGAAGATGG + Intergenic
1011243528 6:85298067-85298089 TTTTGGAAGGAGCTGGGGGCAGG - Intergenic
1011408660 6:87042817-87042839 GTTGGGAAGGGTAGGGGGTAGGG + Intergenic
1011423653 6:87202737-87202759 TCATGGATGGGGCGGGGGGAAGG - Intronic
1011428135 6:87253154-87253176 TTTGGGAAGGCAAGGTGGGAGGG - Intronic
1011626793 6:89289677-89289699 ATCTGGAAGGGGAAGGGGAAGGG + Intronic
1011632331 6:89339533-89339555 AGTGGGGAGGGGAGGGGGGAAGG + Intronic
1011975707 6:93295002-93295024 TTTTTGAAACTGAGGGGGGAAGG + Intronic
1012831133 6:104204691-104204713 TTTTGGAAGGAGGGAGGGGCTGG - Intergenic
1013314658 6:108929953-108929975 TTTTGGCAGGGGTTGGGGGTGGG - Intronic
1013536422 6:111066901-111066923 TTTAGGCAGGGAAAGGGGGAAGG + Intergenic
1013604229 6:111732963-111732985 CTTTGGGAGGAGATGGGGGAGGG + Intronic
1013653874 6:112224964-112224986 TTTTGGCAGGGGACGGGGAAGGG + Intronic
1013735426 6:113221865-113221887 TGTTAGCAGGGGAGGGGAGAGGG + Intergenic
1013822849 6:114176157-114176179 TTTTGGAAAGGGGTGGGGGTGGG - Intronic
1013869784 6:114743156-114743178 GTGTGGAGGGGGAGTGGGGAGGG - Intergenic
1014060451 6:117065352-117065374 TTTTGAAATGTGTGGGGGGAGGG - Intergenic
1014726744 6:124980368-124980390 TCTGGGAAGGGGAGGGTGGTAGG - Intronic
1014953860 6:127592933-127592955 CTTTGAAGGGGGAGGGGGAATGG + Intergenic
1015575348 6:134665427-134665449 TGTTAGAAGGGGGAGGGGGAAGG + Intergenic
1015594086 6:134849624-134849646 TTGTTGGGGGGGAGGGGGGAGGG + Intergenic
1015616955 6:135087509-135087531 GTTGGGAAGGGGAAGGGGAAGGG - Intronic
1015638850 6:135308477-135308499 TTTTGGGAGGCCAGGGTGGATGG - Intronic
1015691214 6:135926082-135926104 TTTTGGGGGGGGGGGGGGGAGGG + Intronic
1015725529 6:136295738-136295760 TTTAGGAAGGTGAGGGTGGGAGG - Intergenic
1015799585 6:137046599-137046621 CTTTATAATGGGAGGGGGGAAGG + Intergenic
1015878405 6:137846866-137846888 TCATGGCAGGGGAGGGTGGAGGG + Intergenic
1015974182 6:138772976-138772998 TGTTGGAGTGGGAGGTGGGAAGG - Intronic
1016068452 6:139708336-139708358 TTTTGGAATGGGATGGTGGTAGG + Intergenic
1016074319 6:139778001-139778023 TAATGGAAGGGGAGGGGGCAAGG + Intergenic
1016294439 6:142559846-142559868 TTGTGTGGGGGGAGGGGGGAGGG - Intergenic
1016315827 6:142785550-142785572 TTCTGGAAGGGAAGGGAGGTTGG - Intronic
1016932899 6:149427306-149427328 TTTTGGCAGGGGATGGGGGTTGG + Intergenic
1017163913 6:151390767-151390789 TTGGGGGAGGGGAGGGAGGAGGG - Intronic
1017227096 6:152034140-152034162 GTGTGGTTGGGGAGGGGGGAGGG + Intronic
1017311075 6:152978374-152978396 TTTTGGGGGGGGGGGGGGGGCGG + Intronic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1017754549 6:157518381-157518403 ATAGGGAAGGGGTGGGGGGAGGG + Intronic
1017845782 6:158257188-158257210 TTTGGGAGGGAGAGGGGGCAGGG - Intronic
1018096683 6:160393430-160393452 TGTGGTAGGGGGAGGGGGGAGGG - Intronic
1018420775 6:163639141-163639163 TTTTGCAAGTGGTGGGGGCAAGG + Intergenic
1018466924 6:164056455-164056477 TTATGGAGGGGCAGGGGAGAAGG - Intergenic
1018734340 6:166676071-166676093 TTTGGGAGGCCGAGGGGGGATGG + Intronic
1018865998 6:167747628-167747650 CTGTGGAAGGGAGGGGGGGAGGG + Intergenic
1019115423 6:169757295-169757317 TTTTGAAAGGGAAGGTGGGAAGG - Intronic
1019168081 6:170112305-170112327 TTTTGGGAGGGGTAGGAGGAAGG - Intergenic
1019220758 6:170470731-170470753 TTCAGGAAGGAGAGGGGAGAGGG + Intergenic
1019853941 7:3585693-3585715 GTTTGGTAGGGGAGGGAAGAAGG + Intronic
1020092891 7:5351180-5351202 TTCTGGGTGGGGAGGAGGGAGGG + Intronic
1020260914 7:6530514-6530536 TTTGGGAGGGCGAGGGGGGTGGG - Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020376841 7:7497016-7497038 TTTTGGAAAGAGAGGAAGGAAGG + Intronic
1020389424 7:7642399-7642421 TTTGGGAGGGAGACGGGGGAGGG - Intronic
1020461092 7:8431036-8431058 TTTTGGCAGGGGAGAGGGAAGGG - Intergenic
1020571042 7:9861794-9861816 ATTGGGAAGGGTAGTGGGGAGGG + Intergenic
1020979988 7:15054794-15054816 TTTAGGAAGGGGAGCGGGTGGGG - Intergenic
1021086708 7:16429234-16429256 TTTTCGTGGGGGAGGAGGGAGGG - Intergenic
1021316269 7:19151228-19151250 TCTTGGAAGGGTAGTGGGAAGGG - Intergenic
1021640695 7:22733709-22733731 TTTAGGTCGGGGAGGGGAGAGGG - Intergenic
1021838633 7:24704929-24704951 TTTTGGGAGGGTAAGGTGGAAGG - Intronic
1022093392 7:27122910-27122932 TTTTGGCGGGGGAGTGGGGAAGG + Intronic
1022103188 7:27181078-27181100 TTTTTGGGGGGGTGGGGGGAGGG + Intergenic
1022274404 7:28841756-28841778 TTCTGGGAGGGAAGGAGGGATGG + Intergenic
1022398252 7:30010284-30010306 TTTTCGAGGGGGAGGAGGGAGGG - Intergenic
1022645433 7:32224927-32224949 CTCTGGAAGGGGATGGGAGAAGG + Intronic
1022684608 7:32584772-32584794 TTTTGGGGGGGGGGGGGGGGCGG + Exonic
1022778366 7:33552382-33552404 TGTTGGAAGGTGAGGTGGGGAGG - Intronic
1022851665 7:34269237-34269259 ATTTGGAAAGGGAGTGAGGAAGG + Intergenic
1023045050 7:36203364-36203386 TGTTAGAAAGGGAGGGGGAAAGG - Intronic
1023663311 7:42493459-42493481 TTTTGGAAAGGGAGGAGGCCGGG + Intergenic
1023720416 7:43087959-43087981 TTTGGGAAGCTGAGGTGGGAGGG + Intergenic
1023897444 7:44445607-44445629 TTTTTGGAGGGGAGGAGGGGTGG + Intronic
1023939201 7:44759361-44759383 GGTAGGAAGGGGAGGGGGCAGGG - Exonic
1024128558 7:46326155-46326177 TTTTGGGGGGGGTGGGGGGACGG - Intergenic
1024437787 7:49379768-49379790 TTGTGGTGGGGGAGGGGGAAGGG - Intergenic
1024519675 7:50294078-50294100 TTTCAGAAGGGGAGGGAAGAGGG - Intergenic
1024616338 7:51117074-51117096 TTGTGCAGGGGGAGGGGGGAGGG - Intronic
1024620254 7:51150965-51150987 TTTGGGGCGGGGAGGGGGGCAGG - Intronic
1025193328 7:56912925-56912947 GGTGGGAAGGGGAGGGGGTAAGG - Intergenic
1025678613 7:63663999-63664021 GGTGGGAAGGGGAGGGGGTAAGG + Intergenic
1025818765 7:64944460-64944482 TTTTCGGGGGGGCGGGGGGATGG - Intergenic
1026079852 7:67208083-67208105 TTTGGGAGGTGGAGGTGGGAGGG + Intronic
1026163815 7:67892472-67892494 CTTTAGAATGAGAGGGGGGAGGG - Intergenic
1026232259 7:68495639-68495661 TTTTGCAGGGGGAGGTGGGTAGG + Intergenic
1026290569 7:69002193-69002215 TATTGGAAGTGGAGAGTGGATGG + Intergenic
1026308739 7:69166085-69166107 GTGGGGGAGGGGAGGGGGGAGGG + Intergenic
1026643464 7:72147943-72147965 TGTTGTGGGGGGAGGGGGGAGGG + Intronic
1026739094 7:72967243-72967265 TTTTGGGGGGGGTGGGGGGCTGG + Intronic
1026955098 7:74372095-74372117 TCTTGGAAGGGAAGCTGGGAGGG - Intronic
1027104637 7:75397830-75397852 TTTTGGGGGGGGTGGGGGGCTGG - Intronic
1027240859 7:76327671-76327693 ATTTGGGGGGGGAGGGGGGGGGG - Exonic
1027359017 7:77389429-77389451 TGTTGGGTGGGGAGGGGGGGAGG - Intronic
1027577680 7:79951085-79951107 TATTTCAAGGGAAGGGGGGAAGG + Intergenic
1028112450 7:86958242-86958264 TTTTATAAAGGGAGGGGGAAAGG + Intronic
1028775361 7:94669822-94669844 TGTTGGAAGGGTAGGGAGGTAGG + Intergenic
1028950205 7:96626147-96626169 GTTTGGAAGGGGAGGTGGGATGG - Intronic
1029005979 7:97210204-97210226 TGTTGGAGGGGGTGGGGGGTGGG - Intergenic
1029440341 7:100583744-100583766 TTCTGGAGAGGGTGGGGGGATGG + Intronic
1029457007 7:100676394-100676416 TGTTGGTGGGGGAAGGGGGAGGG + Intronic
1029483598 7:100826819-100826841 TGCTGGAACGGGAGGGGGGCGGG - Intronic
1029791223 7:102845136-102845158 TTTGGGAAGGGGAGAGGGGCTGG - Intronic
1029967604 7:104756059-104756081 GTTGGGATGGGGAGTGGGGATGG + Intronic
1030314104 7:108096687-108096709 TTTGGGAAGGTGAGGCGGAAGGG + Intronic
1030377800 7:108773671-108773693 GTTGGGAAGGGAAGGAGGGAGGG - Intergenic
1030537260 7:110784371-110784393 ATGTGGAAGGGGAGGGGAGGAGG - Intronic
1030682602 7:112449822-112449844 TTTTTGGGGGGGGGGGGGGATGG + Intronic
1030693774 7:112561383-112561405 ATTTGGAAGGGAAGGTGGGGTGG + Intergenic
1030863409 7:114667178-114667200 TTTTGGGAGGGGAGGGCAGGAGG + Intronic
1030913702 7:115285404-115285426 TTTTTGAAGGGGAGAAAGGAAGG + Intergenic
1030953134 7:115817579-115817601 TATTGTAAGAGGAGGAGGGAAGG - Intergenic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031705155 7:124971488-124971510 TTTTGGCGGGGGAGAGGGAAGGG - Intergenic
1032053715 7:128667722-128667744 CTTAGGACGGGGAGGGGGCAGGG - Intergenic
1032337263 7:131037091-131037113 TTTTTGTAGGGGCGGGGGGGGGG - Intergenic
1032506098 7:132435767-132435789 TGTAGGAAGGGGAAGGGAGATGG - Intronic
1032553615 7:132808876-132808898 TTTCGTGGGGGGAGGGGGGAGGG - Intronic
1032692399 7:134301910-134301932 TTTTGAAAGAGAAGAGGGGAGGG - Intronic
1032982824 7:137304437-137304459 TTTTTGATGGGGAGGGGGAGCGG - Intronic
1033167054 7:139048910-139048932 TTTGGGAAGGGGAGTGGGATTGG - Intronic
1033201909 7:139380349-139380371 TTTGGGAGGCCGAGGGGGGATGG + Intronic
1033217447 7:139503598-139503620 GTCTGGAATGGGAGGGGGCATGG + Intergenic
1033453552 7:141482546-141482568 TTGTGGAGGTGGATGGGGGAAGG - Intergenic
1034034706 7:147806839-147806861 TTTAGGAAGGGTAGTGGGGAAGG + Intronic
1034191148 7:149214404-149214426 TATTTGGTGGGGAGGGGGGAAGG + Intronic
1034346462 7:150388335-150388357 TTATGGGATGGGAGGGGGGCTGG + Intronic
1034412095 7:150947123-150947145 AAGGGGAAGGGGAGGGGGGAGGG + Intronic
1034510437 7:151530066-151530088 TTCTGGAAGCTGAGGTGGGAGGG - Intergenic
1034582685 7:152059342-152059364 TTTTGGAGGTGGAGGTGGGAGGG - Intronic
1034629879 7:152522672-152522694 GTTTTGTGGGGGAGGGGGGAGGG + Intergenic
1034838023 7:154370374-154370396 TTTTTGGGGGGGAGGGGGGATGG + Intronic
1035025071 7:155819908-155819930 TTGGGTAAGGGGAGGGAGGAGGG + Intergenic
1035062157 7:156077369-156077391 TTTTGGAAGGGGAGCCTGGTGGG - Intergenic
1035345436 7:158193976-158193998 TTTGGGAAGTGGAGGCAGGAGGG + Intronic
1035553298 8:545445-545467 TCTGGGAAAGGGTGGGGGGAGGG - Intronic
1036238296 8:7061422-7061444 TTTTGGGGGGGGTGGGGGTATGG - Intergenic
1036470403 8:9047737-9047759 TGTTGGAAGGGGAGAGGGGAGGG - Intronic
1036504249 8:9340940-9340962 TTGGGGAAGGGGAGGGAGAAAGG + Intergenic
1036617001 8:10396042-10396064 TGTGGGAAGGGGAGAAGGGAGGG - Intronic
1036798702 8:11773909-11773931 TCTTGGAAGGGGAGAGTAGAAGG - Intronic
1037004300 8:13758570-13758592 TTTTTGTAGGGGAGAGAGGATGG + Intergenic
1037229350 8:16636619-16636641 GATGGGAAGGGGAGAGGGGAGGG - Intergenic
1037552200 8:19985485-19985507 TTTTGGTAGGGCAGGGGCCAGGG - Intergenic
1037595887 8:20353789-20353811 TTTGGGATGGGGTGGGGTGAGGG + Intergenic
1037732507 8:21539535-21539557 TGTTGGAGGGGGAGGGGGGAGGG + Intergenic
1037811755 8:22090485-22090507 TTTTGACTGGGGATGGGGGAAGG - Intronic
1038159597 8:25024078-25024100 TTTTGAAAGAGAAGGGGGGCCGG + Intergenic
1038165956 8:25085280-25085302 TTTGGGTGGGGGAGGGGGGAAGG - Intergenic
1038258511 8:25972402-25972424 TTTTGGAGGGGGATGGGGTGTGG + Intronic
1038321849 8:26534400-26534422 TTTTGGGAGGGTAAGGGGGGTGG - Intronic
1038374540 8:27025703-27025725 TTTAGCAAGCGGAGGGAGGAGGG - Intergenic
1038426162 8:27465261-27465283 AATTAGAAGGGGAGGGAGGATGG - Intronic
1038659380 8:29483500-29483522 TTTTGGCTGAGGAGGGAGGATGG + Intergenic
1038695909 8:29806076-29806098 TCAGGGAAGGGGAGAGGGGATGG - Intergenic
1039306689 8:36270932-36270954 TTTTGCAAAGGCAGTGGGGAGGG - Intergenic
1039459810 8:37734821-37734843 TGTGGGAAGGGGAGGGGAGACGG + Exonic
1039577652 8:38637066-38637088 TTTTTCGAGGGGAGGGGAGATGG + Intergenic
1039949121 8:42153670-42153692 TTTTGGAGGTGGAGGGGGCGGGG + Intronic
1040067912 8:43163342-43163364 TGTTGGAAAGCGAGGGGGCAAGG - Intronic
1040563947 8:48549376-48549398 TTTTGGGAGGGGAAGGAGGGGGG + Intergenic
1040565311 8:48560970-48560992 TTTTGGAGGGAGAGGGGACAGGG + Intergenic
1040611316 8:48984973-48984995 CTTGGGAAGGAGAGTGGGGAAGG + Intergenic
1040777448 8:51063011-51063033 TGGGGGAGGGGGAGGGGGGAGGG + Intergenic
1040851265 8:51902381-51902403 TTTTTGCAGGGGGAGGGGGATGG - Intergenic
1041152308 8:54948063-54948085 TTTGGGAAGCTGAGGCGGGACGG + Intergenic
1041204559 8:55485612-55485634 TTTTGGAGGCTGAGGGGGGCAGG - Intronic
1041205778 8:55496646-55496668 TTTTTGCAGGGGAGTTGGGAGGG - Intronic
1041502543 8:58553847-58553869 TTTTGGAAGGGGGTGGGGAGAGG + Intronic
1041595623 8:59647484-59647506 TTTTGGGGGGGGTGGGGGGTTGG + Intergenic
1041746367 8:61212570-61212592 TTTTGGAGGAAGAGGGAGGAAGG + Intronic
1042083170 8:65078048-65078070 CTTTGGTAGGGGAGAGAGGAGGG + Intergenic
1042333406 8:67606181-67606203 TTGGGGTGGGGGAGGGGGGAGGG + Intronic
1042455464 8:68997250-68997272 TTTTGGAAGGCCATGGCGGATGG + Intergenic
1042589713 8:70385668-70385690 TTTTGGAAGGCCAAGGTGGAAGG - Intronic
1042590913 8:70397968-70397990 TTTTGGTTGGGGAGGTGGGAGGG - Intronic
1042784060 8:72527032-72527054 TTTTGGAAGGGGAGATGGGAAGG + Intergenic
1042844213 8:73154175-73154197 TTTTAGAAGGGGTGAGGAGAGGG + Intergenic
1043053132 8:75406930-75406952 TCTGGGAAGAGGAGGGGGAATGG - Intergenic
1043155274 8:76770991-76771013 TTTTGAAAGTGAAGGGGTGATGG + Intronic
1043292880 8:78625903-78625925 GCTTGGAAGGGTAGTGGGGAGGG - Intergenic
1043394326 8:79822010-79822032 TTTTGGAAGAGCAGAGTGGAGGG - Intergenic
1043511608 8:80955526-80955548 GTGGGGTAGGGGAGGGGGGAGGG + Intergenic
1043654605 8:82646408-82646430 TTTGGGAAGCTGAGGTGGGAGGG + Intergenic
1043759031 8:84042196-84042218 TTAGGGCAGGGCAGGGGGGAAGG + Intergenic
1044111617 8:88282079-88282101 TTTTGGGGGGGGGGGGGCGACGG + Intronic
1044589804 8:93903270-93903292 TTTTGCAAGGGAAGGAGAGAAGG - Intronic
1044768509 8:95603853-95603875 TTAGGGATGGGGAGGGAGGAAGG - Intergenic
1044843033 8:96354279-96354301 TTTTGGTAGGGGAGGGGAAGGGG + Intergenic
1044898990 8:96924155-96924177 TTTTGGTTGGGGTGGGGGTAGGG + Intronic
1045132972 8:99178298-99178320 CATTTCAAGGGGAGGGGGGAGGG - Intronic
1045281126 8:100750554-100750576 TTTAGGAAGAGGAGGGAAGAGGG + Intergenic
1045491780 8:102675691-102675713 TTTTGGAAGCCGAGGTGGGTAGG - Intergenic
1045527263 8:102951780-102951802 ATTGGGAAGGGGAAGGGAGAGGG - Intronic
1045752165 8:105497942-105497964 TTTGGGAGGGTGAGGTGGGAGGG + Intronic
1045816257 8:106280558-106280580 GTTTGCAAGGGGATGGGTGATGG + Intronic
1045947794 8:107816449-107816471 GTGGGGTAGGGGAGGGGGGAGGG - Intergenic
1045960150 8:107958001-107958023 TTTTGGAAGGGAAGGTGGTTAGG + Intronic
1045978793 8:108159806-108159828 TTGGGTAGGGGGAGGGGGGAGGG + Intergenic
1046327656 8:112671201-112671223 TCTAGGAAAGGGAGGTGGGAAGG - Intronic
1046529464 8:115424953-115424975 TTTTGGAGGGGAAGAGGGGAGGG - Intronic
1046767044 8:118080953-118080975 TTTTGGAGGGCTAGGGGGGAGGG + Intronic
1046958172 8:120083036-120083058 CTTAGGAAAGGGAGGGAGGAAGG + Intronic
1046993358 8:120486649-120486671 TATTGGAAGCCGAGGGAGGAGGG + Intronic
1047381938 8:124372330-124372352 TTTTGGAAAGGAAGTGGGGACGG - Exonic
1047492847 8:125388671-125388693 TCGGGGAAGGGGTGGGGGGAGGG - Intergenic
1047633307 8:126731786-126731808 TTGAGGTGGGGGAGGGGGGAGGG - Intergenic
1047703696 8:127475956-127475978 TGTGGGGTGGGGAGGGGGGAGGG - Intergenic
1048486949 8:134857186-134857208 TTTTGGCCGGGGCGGGGGTAGGG + Intergenic
1048586821 8:135781872-135781894 TTGGGGATAGGGAGGGGGGAAGG - Intergenic
1049093182 8:140532326-140532348 TTCTGGAAGGGGAAGGGGCAGGG - Intronic
1049153822 8:141055137-141055159 TGGTGGAAGGGGAGTGTGGAAGG - Intergenic
1049194063 8:141306012-141306034 TATTGGAGGGGGGTGGGGGAGGG - Intronic
1049368265 8:142251324-142251346 TTTTGTGGGGGGAGGGGGGCGGG - Intronic
1049455895 8:142687160-142687182 TTTGGGAAGCCAAGGGGGGACGG + Intergenic
1049459600 8:142719043-142719065 TTTGGGAGGGTGAGGTGGGAAGG + Intergenic
1049519340 8:143080278-143080300 ATTTGGAAGCAGACGGGGGAGGG - Intergenic
1049533168 8:143166602-143166624 TCTAGGAAGTGGAGAGGGGAAGG + Intergenic
1049628035 8:143635418-143635440 TTTTGGTGGGGGGGGGGGGCAGG + Intergenic
1049987172 9:962351-962373 TTTTGGAAGGTGAGGAGTGAGGG + Intronic
1050018332 9:1259326-1259348 ATTTGGTAGGGGATGAGGGAGGG - Intergenic
1050189013 9:3005599-3005621 TTTTGGAATGTGAGGGGAGCAGG - Intergenic
1051041782 9:12820496-12820518 TTTTGGGGGGGGGGGGGGGACGG - Intronic
1051289012 9:15526949-15526971 TTTTGGGCGGGGGGGGGGGGGGG + Intergenic
1051302026 9:15662276-15662298 TTTTTGGGGGGGAGGGGGGATGG - Intronic
1051718255 9:20008271-20008293 TTTGGGAAGAGGAGCTGGGAGGG + Intergenic
1051720019 9:20027647-20027669 TTTTTGAAGGGAAGGAGGGATGG + Intergenic
1051735113 9:20189924-20189946 TGCTGGGAGGGGAGGGGAGATGG + Intergenic
1051778229 9:20659219-20659241 TTTTGTGTGGGGCGGGGGGAGGG - Intronic
1051828296 9:21246898-21246920 TGTGGGCGGGGGAGGGGGGAGGG - Intergenic
1051920571 9:22259215-22259237 TGTTGGCAGGGGTGAGGGGATGG - Intergenic
1052335201 9:27312140-27312162 TTTGGGCAGGGGACGGGGGTGGG + Intergenic
1052400818 9:27997951-27997973 TTTTGGGGTGGGAGGGGGGGAGG + Intronic
1052917548 9:33935151-33935173 TGTTGGAAGTGGCGGGGGGGGGG + Intronic
1053350652 9:37411398-37411420 TTCAGGGAGGGGAGGAGGGAAGG + Intergenic
1053650294 9:40161916-40161938 TGTTGGGATGGGAGGTGGGATGG - Intergenic
1053755443 9:41302010-41302032 TGTTGGGATGGGAGGTGGGATGG + Intergenic
1054330801 9:63753691-63753713 TGTTGGGATGGGAGGTGGGATGG - Intergenic
1054534287 9:66214287-66214309 TGTTGGGATGGGAGGTGGGATGG + Intergenic
1054754922 9:68947973-68947995 TTTTGTAAGGGCATGGGTGATGG - Intronic
1054785941 9:69210282-69210304 TTTTTGGGGGGGGGGGGGGACGG - Intronic
1054791350 9:69259655-69259677 TTTTGGAAGGCTGAGGGGGAAGG + Intergenic
1054896600 9:70320393-70320415 TTTAGGCAGGGCAGGGAGGAGGG + Intronic
1054978109 9:71171873-71171895 TTTTGGAGGGGGAGGGTGTTAGG + Intronic
1055479157 9:76692980-76693002 TTTTGGAGGGGGGGAGGGGGTGG - Intronic
1055503557 9:76925839-76925861 TTTTTTGCGGGGAGGGGGGAGGG - Intergenic
1055653967 9:78435523-78435545 GGTTGGCAGGGGAGGTGGGATGG + Intergenic
1055757835 9:79573415-79573437 CTTTGGCCGGGGAGGGGAGACGG + Intronic
1055758001 9:79574725-79574747 TTATGGAAAGGGAAGGGGAAAGG - Intronic
1055814865 9:80193056-80193078 TTTTTGATGGGGAGAAGGGATGG - Intergenic
1056097217 9:83267299-83267321 CATTGGGAGGGGAGGAGGGAGGG + Intronic
1056143490 9:83707407-83707429 TTTTGGAAGGGCCTGGGAGAGGG - Intronic
1056177316 9:84048110-84048132 TTTTCTGGGGGGAGGGGGGAGGG + Intergenic
1056213023 9:84382605-84382627 ATTTTGGAGGGGAGGGGGGAGGG - Intergenic
1056427252 9:86489618-86489640 TTTTGGAAGGAGATGGAGAAGGG - Intergenic
1056622698 9:88227272-88227294 TTTTGGCAGGGGTTGGGGGTGGG - Intergenic
1056633467 9:88312820-88312842 TTTGAGAAGCGGAGGTGGGAGGG + Intergenic
1056791747 9:89630236-89630258 TTCTGGAAAAGGAGGAGGGATGG - Intergenic
1056795432 9:89655649-89655671 TCTTGGAAGGCGAGGAGGGCAGG + Intergenic
1057083431 9:92189194-92189216 TTTTAGAAGGTGAGAGGGGGTGG + Intergenic
1057219400 9:93247868-93247890 TTTTTGCAGGGTAGGTGGGAGGG - Intronic
1057388596 9:94625225-94625247 TCTTGGAATGGCAGTGGGGAGGG - Intronic
1057550361 9:96047632-96047654 TTTTGCAGGGGGAAGGGTGAGGG - Intergenic
1057709088 9:97420887-97420909 TTTTGGAAGGCCAGGGCGGGTGG + Intronic
1057826968 9:98378726-98378748 TTTGGCAAGGGGAGGAGGGTTGG + Intronic
1058268895 9:102943944-102943966 GTTTGGTAGGGGAGGTGGGAAGG + Intergenic
1058447055 9:105063915-105063937 TTTATGAAGGGAATGGGGGAAGG - Intergenic
1058876998 9:109252925-109252947 TTTGGAAAGGGGAAGGGGGCAGG + Intronic
1058951295 9:109906201-109906223 TTTTGCGGGGGTAGGGGGGATGG + Intronic
1059438919 9:114291860-114291882 TTGTGGGAGAGGAGAGGGGAAGG + Intronic
1059603192 9:115803773-115803795 TGTGGGGTGGGGAGGGGGGAGGG + Intergenic
1059745821 9:117200222-117200244 TTGGGTAGGGGGAGGGGGGAGGG - Intronic
1060149029 9:121275605-121275627 TGGTGGGAGGGGAGGTGGGAGGG - Intronic
1060176922 9:121503905-121503927 ATTTGGAAGGGGTGCGGGGCAGG + Intergenic
1060205972 9:121683076-121683098 TCCTGGAAGGGAAGGAGGGAAGG + Intronic
1060493646 9:124102455-124102477 TTATTGAAGGGAAGGGTGGATGG - Intergenic
1060515439 9:124262831-124262853 TTTGGACAGGGGAAGGGGGAGGG + Intronic
1060866124 9:126999017-126999039 GTTGGGTGGGGGAGGGGGGAGGG + Intronic
1061140453 9:128763149-128763171 TTTGGGTAGGGGAGGGGAGAAGG - Intronic
1061233473 9:129328444-129328466 CCCTGGAAGGGGAGGGAGGAAGG + Intergenic
1061692087 9:132341449-132341471 TTTAGGAAGGGGAGGGGTAGTGG - Intronic
1061782881 9:133006225-133006247 TTTTGGCGGGGGCGGGGGGAGGG - Intergenic
1061951967 9:133941604-133941626 TTTTTGGGGGGGGGGGGGGACGG + Intronic
1062502275 9:136856658-136856680 CTCTGGAGGGGGAGGGGAGAAGG + Intronic
1062597176 9:137304609-137304631 TTGAGGATGGGAAGGGGGGAGGG + Intergenic
1202798187 9_KI270719v1_random:146602-146624 TGTTGGGATGGGAGGTGGGATGG - Intergenic
1203465942 Un_GL000220v1:87046-87068 TGTTGGGGGGGGAGGGGGGAGGG + Intergenic
1203406188 Un_KI270538v1:15766-15788 TTGTGGGGGGGGAGGGGTGAGGG + Intergenic
1185756923 X:2659753-2659775 AGGGGGAAGGGGAGGGGGGAGGG - Intergenic
1185772611 X:2776245-2776267 TTTAGGAAGGGGAGGGCTGGGGG + Intronic
1185785902 X:2890648-2890670 TTTAGGAAGGGGAGGGCGGGGGG + Intergenic
1185864627 X:3612542-3612564 TTTAAGAAGGTGAGGCGGGAGGG + Intronic
1186185808 X:7018706-7018728 TCTTGGAAAGGGAGGGAGGAAGG - Intergenic
1186293219 X:8121840-8121862 TGGGGGAGGGGGAGGGGGGAGGG - Intergenic
1186340987 X:8646034-8646056 TTTGGGAGGCTGAGGGGGGAGGG - Intronic
1186514489 X:10156444-10156466 ATTTGAAAGGCGAGGGTGGAGGG + Intergenic
1186535408 X:10342036-10342058 TTTTGGTGGGGGAGGAGGGAAGG + Intergenic
1186550338 X:10498078-10498100 TATTTGAGGGGGAGGGAGGAAGG + Intronic
1186721682 X:12311096-12311118 TTTTGGCGGGGCAGGGGGAAAGG + Intronic
1186892423 X:13972177-13972199 TGTAGGGTGGGGAGGGGGGAGGG - Intergenic
1187047356 X:15660323-15660345 TTTTTGGAAGGGAGGAGGGATGG + Intronic
1187214305 X:17261327-17261349 TTTTGGAAGGGGAAGGGTACAGG + Intergenic
1187489236 X:19735718-19735740 TTTTGGCGGGGGGGGGGGGTGGG + Intronic
1187627264 X:21129971-21129993 TTTTTTGGGGGGAGGGGGGAGGG - Intergenic
1187650432 X:21397575-21397597 GATGGGAAGGGGAGTGGGGATGG + Intronic
1187805030 X:23110432-23110454 TTGTGGGAGGGAAAGGGGGAGGG - Intergenic
1187828316 X:23355025-23355047 TTTTTTGGGGGGAGGGGGGAGGG + Intronic
1187830289 X:23374246-23374268 TGTTGAAAAGGGAGGAGGGAAGG - Intronic
1187841166 X:23490059-23490081 GCTGGGAAGGGGAGGGGGGAGGG + Intergenic
1187852208 X:23602203-23602225 TTGTGAAAGGGGATGGAGGAAGG - Intergenic
1187882887 X:23862878-23862900 GGATGGAAGGGGAGGGAGGAGGG + Intronic
1187975711 X:24702747-24702769 TTTTGGAAGGGGATGGATGAGGG + Intronic
1188110053 X:26186194-26186216 TGGGGTAAGGGGAGGGGGGAGGG + Intergenic
1188208300 X:27387226-27387248 TTTTGGCGGGGGAGGGGACAGGG - Intergenic
1188221883 X:27550680-27550702 GATGGGAAGGGGAGAGGGGAGGG - Intergenic
1188328094 X:28832249-28832271 GTTGGGAAGGGTAGGAGGGAGGG - Intronic
1188360912 X:29252115-29252137 TGGGGTAAGGGGAGGGGGGAGGG + Intronic
1188774704 X:34199977-34199999 TCTAGGAAGGGTAGTGGGGAGGG + Intergenic
1188839018 X:34991966-34991988 TGGGGTAAGGGGAGGGGGGAGGG + Intergenic
1189319798 X:40080865-40080887 TTTTGGGAGGGAAGGGGTGGAGG + Intronic
1189363295 X:40369631-40369653 TTGGGGCAGGGGAGTGGGGAGGG + Intergenic
1189623703 X:42872280-42872302 TTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1189843894 X:45114157-45114179 TTTTGTGGGGGGAGGGGAGAGGG + Intergenic
1190305157 X:49077808-49077830 TGTTGGCAGGGGAGGGGCAATGG - Intronic
1190498771 X:51054528-51054550 TTTAGGCAGGGTAGGGGGAAGGG + Intergenic
1190712008 X:53078214-53078236 ACTTGGAAGGGGAGGGTGCATGG - Exonic
1190948071 X:55115276-55115298 TTTTGGGGGGGGTAGGGGGATGG - Intronic
1191039844 X:56067729-56067751 TGTAGGAGGGGGACGGGGGAAGG - Intergenic
1191138767 X:57093991-57094013 TTTTGATTGGGGTGGGGGGAGGG + Intergenic
1192291708 X:69803809-69803831 GCTGGGAAGGGGAGGGGGAAGGG - Intronic
1192525325 X:71838073-71838095 TTGTGGGGTGGGAGGGGGGAGGG - Intergenic
1192810712 X:74544808-74544830 TTTGGGAAGGAGAGAGGGGCTGG + Intergenic
1192921913 X:75715789-75715811 TTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1192959237 X:76109801-76109823 TTTTGGCGGGGGGGGGGGGGCGG + Intergenic
1193085783 X:77447212-77447234 TTTTGGGAGAGGGGGGTGGAGGG - Intergenic
1193089264 X:77476613-77476635 TTGGGTAGGGGGAGGGGGGAGGG + Intergenic
1193136653 X:77979073-77979095 CTTTGGAAGGTGAAGGGGGGCGG - Intronic
1193738654 X:85190969-85190991 TGGTGTAGGGGGAGGGGGGAGGG + Intergenic
1194213245 X:91095133-91095155 TTTTTGCAGGGGAGGTGGAAAGG + Intergenic
1194348513 X:92796029-92796051 AGGGGGAAGGGGAGGGGGGAAGG + Intergenic
1194449246 X:94022832-94022854 TCCTGGAAGGAGAGTGGGGAGGG + Intergenic
1194517112 X:94868237-94868259 GTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1194629131 X:96261714-96261736 TGTTGTGGGGGGAGGGGGGAGGG + Intergenic
1194763646 X:97824005-97824027 TTTTTTAAGGGGATGGGGGAGGG - Intergenic
1195110143 X:101639950-101639972 TTTAGGAGAGGGAGGAGGGAAGG + Intergenic
1195316934 X:103688163-103688185 ATCAGAAAGGGGAGGGGGGAGGG - Intergenic
1195318714 X:103703685-103703707 CTTTGGAAGGCCAAGGGGGAAGG + Intergenic
1195521151 X:105830829-105830851 TTGTGTAGGGGGAGGGGGGAGGG + Intronic
1195598704 X:106722131-106722153 GTTTGGAAGAGGAGGGTGGAAGG + Intronic
1195715265 X:107812302-107812324 TTTTTGAGGGGTTGGGGGGATGG - Intergenic
1195778992 X:108439912-108439934 TTTGGGGAGGGGAGGGGGGAAGG + Exonic
1195957733 X:110350722-110350744 TTTGGGAGGGTGAGGTGGGAGGG + Intronic
1196087862 X:111705905-111705927 TTGAGGAAGGGAATGGGGGAAGG - Intronic
1196771167 X:119295453-119295475 TGTTGGAGGGGAAGAGGGGATGG - Intergenic
1196898072 X:120357675-120357697 TTTTGGGAGTGGAGGGTGTAGGG - Intergenic
1197342898 X:125294794-125294816 TCTTGGAAGGGGAAGGGAAAGGG - Intergenic
1197668280 X:129246839-129246861 TGGTGGGGGGGGAGGGGGGAGGG + Intergenic
1197691045 X:129501607-129501629 TTTTGGGGGGGGAGGTGGGGTGG + Intronic
1197845818 X:130801260-130801282 TTATGGTGGGGGAAGGGGGAAGG + Intronic
1197884087 X:131200114-131200136 TTGTGAAAGGAGAGGGGAGAAGG + Intergenic
1198075906 X:133192699-133192721 TTTGGGAAGCTGAGGCGGGAGGG + Intergenic
1198117333 X:133556765-133556787 TTTTTGGGGGGGTGGGGGGAGGG + Intronic
1198244952 X:134821519-134821541 CTTTGGAAGAGGAGGGGGTGGGG - Intronic
1198255093 X:134917380-134917402 GCTGGGAAGGGGAGGGGAGAAGG + Intergenic
1198472492 X:136960561-136960583 GTTTGGTTGGGGAGGTGGGATGG + Intergenic
1198545176 X:137684752-137684774 TGTTGGAAGGGTAGAGAGGAGGG + Intergenic
1198756654 X:139989145-139989167 TTGGGTGAGGGGAGGGGGGAGGG - Intergenic
1198806434 X:140499730-140499752 TTTGGGATGGGGAGGGGGCAGGG - Intergenic
1199263529 X:145803576-145803598 TTTTGGTAGGGGTGTGGGGTTGG - Intergenic
1199728401 X:150606961-150606983 TTTTGGGAGGGGAGGGGAGGGGG - Intronic
1199763790 X:150925919-150925941 TTTGGGGGGGGGCGGGGGGACGG - Intergenic
1199825742 X:151497922-151497944 TTGGGGAAGAGGATGGGGGAGGG - Intergenic
1199841917 X:151657926-151657948 TTTTGGAAGTGGTGGGGGAAAGG - Intronic
1200176513 X:154120932-154120954 TTTTTTAGGGGGAGGGGGGAAGG + Intergenic
1200216252 X:154369421-154369443 TTTTGGGAGGGGGATGGGGACGG - Intronic
1200223044 X:154401409-154401431 TTCTAGAAGGGGTGGGGGCATGG - Exonic
1201319651 Y:12683761-12683783 TCTTGGGGGGCGAGGGGGGAGGG + Intergenic
1201695113 Y:16816205-16816227 TTTGGGTGGGGGAAGGGGGAAGG + Intergenic
1201721065 Y:17097926-17097948 GTGTGGTGGGGGAGGGGGGAGGG - Intergenic
1202594686 Y:26524454-26524476 TTTGGTAGGGGGAGGGGGGAGGG + Intergenic