ID: 905943793

View in Genome Browser
Species Human (GRCh38)
Location 1:41885048-41885070
Sequence GTGCAGAGCTTGTATAATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905943793 Original CRISPR GTGCAGAGCTTGTATAATAA GGG (reversed) Intronic
905943793 1:41885048-41885070 GTGCAGAGCTTGTATAATAAGGG - Intronic
912426836 1:109601082-109601104 GATCATAGCTTGTATAGTAAGGG + Exonic
913658472 1:120984172-120984194 GTACATAGTTTGTATAAAAAAGG + Intergenic
914009839 1:143767281-143767303 GTACATAGTTTGTATAAAAAAGG + Intergenic
914648459 1:149675942-149675964 GTACATAGTTTGTATAAAAAAGG + Intergenic
916344557 1:163773240-163773262 TTGCAGAGCTTTTATAAAGACGG - Intergenic
1063360156 10:5447064-5447086 GTACACAGCTTTTATAAAAAAGG + Intronic
1067839125 10:49662226-49662248 GTGCAGAGCTTGGAGACTACCGG - Intronic
1068457391 10:57274485-57274507 GTTGAGAGTTTTTATAATAAAGG - Intergenic
1068847109 10:61689590-61689612 CTACAGAGCATGTATAATAATGG - Intronic
1069695821 10:70384579-70384601 GTGCAGAGATGATAGAATAATGG - Intergenic
1070427090 10:76299526-76299548 GAGCAGAGCAAGTATAAAAAGGG - Intronic
1071839174 10:89451261-89451283 GTGAAGAGCTTGGAGAAGAAGGG + Intronic
1083146173 11:60760710-60760732 TTGATGAGCTTGTTTAATAATGG - Intronic
1083334565 11:61915161-61915183 GTGCTGAGCTCATATCATAATGG - Intronic
1085680067 11:78564975-78564997 TTGCAGAGGTTGTGTAATAGTGG - Intronic
1086186093 11:84018408-84018430 TTGTAGAGCTTATATAAGAAAGG - Intronic
1089133073 11:116227344-116227366 GTGCTTAGCTTGCATAATCAGGG - Intergenic
1091043481 11:132304120-132304142 GTGGAGGGCTTTGATAATAAGGG + Intronic
1093103898 12:15062238-15062260 GTTGAGAGTTTGTATCATAAAGG + Intergenic
1095318771 12:40799651-40799673 GTACAGAGCTTGCATAAAATTGG - Intronic
1098841773 12:75486008-75486030 GTGCAGTGCTTTTGTAAGAAAGG + Intronic
1101246823 12:102891553-102891575 GAGCAGAGCATGTTTAATTAAGG - Intronic
1102067533 12:109989777-109989799 GTTGAGACCTTGTATAATAACGG - Exonic
1105308919 13:19189267-19189289 GTGCAGAGCTTGGATTTTACAGG + Intergenic
1105528680 13:21198884-21198906 GTGCAGAGCTTGGATTTTACAGG - Intergenic
1108698188 13:52921145-52921167 GTGCAGAGCTTCTATAGAAGGGG + Intergenic
1109106755 13:58262413-58262435 GTTGAGAGTTTGTATCATAAAGG - Intergenic
1109204958 13:59472363-59472385 GTTGAGAGCTTTTATCATAAAGG - Intergenic
1111623853 13:90757933-90757955 TTGCAGAGCCTCTATTATAATGG - Intergenic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1116076412 14:40116878-40116900 GTGGAGGGCTTTTATTATAAAGG + Intergenic
1116353580 14:43898410-43898432 TTACAGATATTGTATAATAAAGG - Intergenic
1116730741 14:48619015-48619037 GTGCAGAGCTCCTGAAATAATGG - Intergenic
1116917446 14:50538718-50538740 CTGCAGAGCAAGGATAATAATGG + Intronic
1121287458 14:92747660-92747682 GAGCAGAGATTGTTTCATAAAGG - Intronic
1122523111 14:102360724-102360746 GGGCAGAGCTTGGATAGTAGAGG - Intronic
1124828178 15:33120851-33120873 CTGGAGAGCTTGTAAAAAAATGG - Intronic
1132623182 16:877838-877860 GTGCAGAGGTTGTCTGAGAAAGG + Intronic
1136669257 16:31840755-31840777 GTTGAGAGCTTTTATCATAAAGG - Intergenic
1141055388 16:80808989-80809011 ATGCAAAGCATCTATAATAAGGG + Intergenic
1141862979 16:86730559-86730581 CTGCTGAGCTTGTACAAAAAAGG + Intergenic
1156923819 18:42554359-42554381 GAGCAGAGCTTTTATTAAAAAGG + Intergenic
1156992070 18:43420892-43420914 GTGCAAAGCATGGATAATAGGGG + Intergenic
1158408499 18:57182616-57182638 GTTGAGAGTTTTTATAATAAAGG + Intergenic
1160306651 18:77746281-77746303 GTCCTCAGCTTGTATAAAAAAGG + Intergenic
1163402248 19:17101226-17101248 GAGCACAGCTGGTATAATCATGG + Intronic
1164566956 19:29332818-29332840 TTGCAGAGCTTGTAAAATTCAGG - Intergenic
928265885 2:29811489-29811511 ATGCAGAGCTTTTAGAATCAGGG - Intronic
929044758 2:37778558-37778580 GTGCTGAGCATGTAGAAGAAGGG - Intergenic
929951909 2:46418067-46418089 GTTGAGAGTTTTTATAATAAAGG - Intergenic
932149466 2:69356394-69356416 GGGCAGAGCCTTTATAATAAAGG + Intronic
939317539 2:140570969-140570991 GTTGAGAGCTTTTATAATGAAGG - Intronic
939807024 2:146786626-146786648 TTACAGAGCTTCTACAATAAAGG - Intergenic
941354143 2:164467908-164467930 GAGCAGAGCTTGGATCATAGAGG + Intergenic
941753462 2:169159510-169159532 GTTAAGAGCTCCTATAATAAAGG - Intronic
943138146 2:183941837-183941859 GTTGAGAGCTTTTATTATAAAGG - Intergenic
945869954 2:215216631-215216653 GTACTTAGCATGTATAATAAGGG - Intergenic
946090668 2:217220068-217220090 GTGCAGAGTGTGTATAAAATGGG - Intergenic
947297244 2:228644810-228644832 GTTCAGACTTTGTAAAATAAAGG - Intergenic
1174240331 20:49128621-49128643 GTGCAAAGGTTATTTAATAAAGG + Intronic
1176408124 21:6432755-6432777 GTGCAGAGCTAGTCTATTAGTGG - Intergenic
1181989571 22:26827169-26827191 GAGCAGAGCTTGTTTAACATGGG - Intergenic
949472520 3:4411670-4411692 GTGCAGAGTTTTTATAAAAGGGG + Intronic
956800581 3:72754335-72754357 TTGCAGAGCCTGTATATTCATGG - Intronic
963234545 3:142944127-142944149 GTACAAAGGTTGCATAATAAGGG - Intergenic
964879130 3:161404233-161404255 GTGCAGAGCTTCACTTATAAGGG - Intergenic
967148942 3:186630601-186630623 ATGGAGAGCTTGAATAAAAAAGG - Intergenic
967216781 3:187217985-187218007 GGGAGGAGCTGGTATAATAAAGG + Intronic
967566146 3:190975639-190975661 GTGCAGGGTTTCTATAAGAAAGG + Intergenic
978286020 4:107077558-107077580 CTGCATAGCTTGTAAAATTAAGG + Intronic
978870441 4:113569675-113569697 GGGAAGATCTTGTATGATAATGG - Intronic
983449293 4:167890747-167890769 GTGAAGAAGTTGTATAATAAAGG + Intergenic
986945059 5:13007660-13007682 GTTCACAGTTTGTATGATAAAGG - Intergenic
987211198 5:15685324-15685346 GTATAGAGGGTGTATAATAAAGG + Intronic
990174450 5:53091565-53091587 GTAGAGGGCTTCTATAATAATGG - Exonic
992392726 5:76344072-76344094 GGGCAGAGGTTGGATGATAATGG - Intronic
994800298 5:104365461-104365483 GTGCAGAGCTTCCATAATAATGG - Intergenic
996787235 5:127252750-127252772 ATACACATCTTGTATAATAAAGG + Intergenic
998024233 5:138800268-138800290 GTGCAGGGCTGCTATAAGAAAGG + Intronic
1005271488 6:24169157-24169179 GTGCAGAATTTTTATTATAAAGG - Intergenic
1008105895 6:47440782-47440804 GTGTAGAGCTTGTATAAAGGAGG - Intergenic
1008810786 6:55495620-55495642 GTGAAGTGCTAGTAAAATAATGG + Intronic
1010062341 6:71637578-71637600 GTGCAGAGTTTTTATCATAAAGG - Intergenic
1010615010 6:78002068-78002090 GCCCATAGCTTGTATAATCATGG + Intergenic
1011872763 6:91917108-91917130 GTCCAAAGGTTTTATAATAATGG - Intergenic
1013107713 6:107039848-107039870 GTACAGAGTTTGTATGATGAAGG - Exonic
1013841443 6:114400092-114400114 GTGCAATTCTTGTATAACAAAGG - Intergenic
1014478510 6:121905405-121905427 GTGCAGAGTTTGGATAGGAAGGG + Intergenic
1015121849 6:129708672-129708694 GTCCTGAGCTTGTATAATTTTGG + Intronic
1016417175 6:143844967-143844989 GAGCAAATCTTGTAGAATAATGG + Intronic
1016638997 6:146327258-146327280 ATGGAAAGTTTGTATAATAAGGG + Intronic
1018460015 6:163989170-163989192 GTGGAGATCATGTAGAATAAAGG + Intergenic
1021753608 7:23829313-23829335 GTTGAGAGCTTTTATCATAAAGG + Intronic
1023810006 7:43904948-43904970 GTGCATGACTTGTATACTAAAGG + Intronic
1025811103 7:64876115-64876137 GTGCAAAGCTTGTGCAATGAAGG - Intronic
1026123443 7:67557964-67557986 GTGCAGAATTTGTGTACTAAAGG + Intergenic
1031889396 7:127276594-127276616 GTGCAGGATTTCTATAATAAAGG + Intergenic
1040461164 8:47649910-47649932 GTGGAGAGTTTTTATCATAAAGG - Intronic
1043943291 8:86221035-86221057 GTGCAAAATTTGTGTAATAAGGG - Intronic
1050951014 9:11593487-11593509 GTGTAGAGTTTGTATAATTAAGG - Intergenic
1052710406 9:32048861-32048883 ATGGAGAGCTTGTATAAGATAGG - Intergenic
1052753934 9:32521960-32521982 GTCCAGAGCTTGTTTATTTAGGG + Intronic
1058813600 9:108664166-108664188 GTGCAGAGCTTGTTAAAACATGG - Intergenic
1058926478 9:109668809-109668831 GTGCAGACCTTGTCTAACCAAGG - Intronic
1060175059 9:121491548-121491570 GTGCAGAGCGTGTATAACAGGGG - Intergenic
1190567039 X:51741728-51741750 GTACAGAGCTAGTATAATAGTGG + Intergenic
1192635931 X:72817589-72817611 CTGCAGAGTTTTTATAATGAAGG + Intronic
1192645783 X:72903214-72903236 CTGCAGAGTTTTTATAATGAAGG - Intronic
1193288408 X:79741130-79741152 TTGTAGAGATTGAATAATAATGG - Intergenic
1194106125 X:89769185-89769207 TTGCAAAGTTTGTATAAAAATGG - Intergenic
1195026398 X:100881978-100882000 TTACAAAGTTTGTATAATAATGG - Intergenic
1196179432 X:112673601-112673623 GGGCAGAGCACATATAATAATGG - Intronic
1197665454 X:129218308-129218330 AAGCAGGGCTTGTGTAATAAAGG - Intergenic
1199034064 X:143031202-143031224 TTGAATAGATTGTATAATAAAGG + Intronic
1199093354 X:143715323-143715345 CTGAATAGGTTGTATAATAAAGG - Intronic
1200458081 Y:3417044-3417066 TTGCAAAGTTTGTATAAAAATGG - Intergenic
1200923837 Y:8636753-8636775 GTGGACAGCTTGTGCAATAAAGG - Intergenic