ID: 905944476

View in Genome Browser
Species Human (GRCh38)
Location 1:41890187-41890209
Sequence AAATTACTTAGAACCAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 545
Summary {0: 1, 1: 0, 2: 6, 3: 52, 4: 486}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905944475_905944476 18 Left 905944475 1:41890146-41890168 CCTCATGGGTTGCTGTGTGGTTT 0: 1
1: 0
2: 4
3: 38
4: 235
Right 905944476 1:41890187-41890209 AAATTACTTAGAACCAAGCCTGG 0: 1
1: 0
2: 6
3: 52
4: 486
905944472_905944476 23 Left 905944472 1:41890141-41890163 CCCTACCTCATGGGTTGCTGTGT 0: 1
1: 0
2: 0
3: 9
4: 189
Right 905944476 1:41890187-41890209 AAATTACTTAGAACCAAGCCTGG 0: 1
1: 0
2: 6
3: 52
4: 486
905944473_905944476 22 Left 905944473 1:41890142-41890164 CCTACCTCATGGGTTGCTGTGTG 0: 1
1: 0
2: 6
3: 39
4: 381
Right 905944476 1:41890187-41890209 AAATTACTTAGAACCAAGCCTGG 0: 1
1: 0
2: 6
3: 52
4: 486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905944476 Original CRISPR AAATTACTTAGAACCAAGCC TGG Intronic
900787999 1:4661309-4661331 AGATCACTTAGCACAAAGCCTGG - Intronic
901010277 1:6197323-6197345 AAGTTACCCAGAAACAAGCCAGG - Intronic
901577948 1:10216007-10216029 AAAGTGCTTAGAAAAAAGCCTGG - Intronic
901656003 1:10769844-10769866 AAAATACTTAGCACTGAGCCTGG - Intronic
902096683 1:13951384-13951406 AAAGCACTTAGACCCATGCCTGG + Intergenic
902861573 1:19250662-19250684 AAATTACTTAGCACAATGCCTGG - Intronic
902871799 1:19318079-19318101 CAAGTGCTTAGAAGCAAGCCAGG - Intronic
903567219 1:24277152-24277174 AAAGCACTTAGAACACAGCCTGG - Intergenic
904287805 1:29463319-29463341 AAAATGCTTAGAACAGAGCCAGG + Intergenic
904431379 1:30466697-30466719 AAAGTACTTAGAACAGAGCCTGG + Intergenic
905237412 1:36559692-36559714 AAAGCACTTAGAATCAAGCCTGG - Intergenic
905260297 1:36712605-36712627 AAAGTTCTAAGAACCATGCCTGG + Intergenic
905335945 1:37244593-37244615 AAATTTCTGAGAACAGAGCCTGG + Intergenic
905853613 1:41292495-41292517 AAAGCACTTAGAACAATGCCTGG + Intergenic
905944476 1:41890187-41890209 AAATTACTTAGAACCAAGCCTGG + Intronic
906812750 1:48845902-48845924 AAAGTACTTAGAACAGTGCCTGG + Intronic
908036532 1:60060371-60060393 AAAATATTGAGCACCAAGCCTGG + Intronic
908070247 1:60452637-60452659 AAATTACTTAGCACCATGATTGG - Intergenic
908709629 1:67000654-67000676 AAACTACTTAGCACAATGCCTGG - Exonic
908757276 1:67480445-67480467 AAAGTACTTAGAACAATGCCTGG - Intergenic
909124216 1:71644722-71644744 AAATTACATAACAGCAAGCCTGG + Intronic
909155520 1:72069987-72070009 ACATCACTAAGAACCATGCCTGG - Intronic
910185419 1:84534376-84534398 AAAATACTTAGAATAATGCCTGG - Intergenic
910254980 1:85238998-85239020 AAATAACTTAGAAACTAGCCAGG + Intergenic
910552321 1:88489600-88489622 AAAATCCTTAGAACTATGCCTGG - Intergenic
911721168 1:101192711-101192733 AAAGTACTTAGAATTAAGCCTGG - Intergenic
912267321 1:108171753-108171775 GAAATACTTAGAACAATGCCTGG - Intronic
912558144 1:110530966-110530988 AAAACACTTAGAACAATGCCTGG + Intergenic
912586437 1:110771251-110771273 AAAGTACTCAGAACCCAGGCTGG + Intergenic
912906390 1:113712513-113712535 AAAGTACTCAGAACAATGCCTGG + Intronic
912945950 1:114084307-114084329 AAAGCACTTAGAACAATGCCTGG + Intergenic
913202600 1:116507487-116507509 TAATTACATACAACCATGCCCGG - Intergenic
914226360 1:145722231-145722253 AAATTACTTAGCACAGTGCCTGG - Intronic
914406699 1:147381757-147381779 AAAGTACTTAGCATGAAGCCTGG + Intergenic
916228442 1:162514457-162514479 ACATTTCCTAGAACCATGCCTGG + Intronic
916567321 1:165992360-165992382 AAATTACTTAGAACAGTTCCTGG + Intergenic
916913192 1:169374377-169374399 AAATTAGTTAAAACAAAGCATGG - Intronic
917087423 1:171318018-171318040 AAAATACTTGGGACCAGGCCGGG + Intronic
917199827 1:172502664-172502686 AAACTACTTAGAACAGTGCCTGG + Intergenic
917815838 1:178709176-178709198 AAAATACTTAGAAACTAGCTGGG + Intergenic
918049003 1:180958223-180958245 AAAGTACTTAGAACAGTGCCTGG + Intergenic
918568484 1:185958619-185958641 AAAACACTTAGAACAATGCCTGG - Intronic
918666844 1:187161989-187162011 AAAGCACTTAAAACCATGCCTGG - Intergenic
919966216 1:202528284-202528306 AAACTACGTAGAACCATGCCTGG + Intronic
922178113 1:223212928-223212950 AAAATGCTTAGAACCACACCTGG - Intergenic
922238747 1:223741228-223741250 AAAATATTTTGAACCAAGCTGGG - Intronic
922276582 1:224084582-224084604 AAAGTACTTAGAACCATGCCTGG - Intergenic
922454837 1:225766305-225766327 CAATTACTTAGAACTGTGCCTGG - Intergenic
922581228 1:226699587-226699609 AAACCACTTAGAACAATGCCTGG + Intronic
922772180 1:228191743-228191765 AAATTACCTTGTACCAGGCCAGG - Intergenic
923000119 1:230000096-230000118 ACTTTAATTAGAAACAAGCCTGG - Intergenic
923608780 1:235470294-235470316 AAATTACTGAGAAATAGGCCAGG + Intronic
923681671 1:236123665-236123687 AAAGTACATAGAACAGAGCCTGG + Intergenic
923758566 1:236817496-236817518 AAAGCACTTAGAACAGAGCCTGG - Intronic
924148615 1:241103574-241103596 AAATTAAATAAAACCAGGCCAGG + Intronic
924574041 1:245262958-245262980 AAAGCACTTAGAACCATACCTGG + Intronic
1063783851 10:9357365-9357387 AAAGAACTTAGAGCCCAGCCAGG - Intergenic
1064045671 10:12012420-12012442 AAAGTTCTGAGAAACAAGCCAGG + Intronic
1064512135 10:16106903-16106925 AAACTGCTTAGCACCACGCCAGG - Intergenic
1065126190 10:22576669-22576691 AAAGTTTTTAGAACAAAGCCTGG + Intronic
1065766897 10:29038706-29038728 AAAATTCTTAGGACCATGCCTGG - Intergenic
1065992763 10:31029282-31029304 AAAGTACTTAAAACCCTGCCTGG + Intronic
1067123617 10:43496401-43496423 AAATGACTTAGGACTCAGCCAGG - Intergenic
1067424313 10:46192826-46192848 ATATTACTTAGAAACAGCCCCGG - Intergenic
1067662315 10:48245626-48245648 AAAAGACTTAGAACAAGGCCTGG - Intronic
1067701111 10:48573035-48573057 AAAACACTTAGAACAGAGCCTGG + Intronic
1068758413 10:60680937-60680959 AAATCACTTAGAACAGTGCCTGG + Intronic
1068920017 10:62473651-62473673 AAAGCTCTTAGAACCATGCCTGG + Intronic
1069627849 10:69879318-69879340 AAAGTACTTAAAACAATGCCTGG - Intronic
1070529508 10:77324379-77324401 AAAGTACCCAGTACCAAGCCTGG + Intronic
1070764871 10:79050556-79050578 AAATTAATCAGACCCAAGCAGGG - Intergenic
1070860730 10:79658237-79658259 ATATTACTTAGAAACAGCCCTGG - Intergenic
1070876531 10:79817335-79817357 ATATTACTTAGAAACAGCCCTGG + Intergenic
1071643462 10:87339514-87339536 ATATTACTTAGAAACAGCCCTGG + Intergenic
1072451015 10:95539757-95539779 AAATTCCTTTTATCCAAGCCTGG + Intronic
1072655826 10:97329842-97329864 AAAGTGCTTAGAACACAGCCTGG + Intergenic
1073278825 10:102336479-102336501 AAATTGCTTAATACCATGCCTGG + Intronic
1074319182 10:112385138-112385160 AAAGTGCTTAGAACCATGGCTGG - Intronic
1074383344 10:112997701-112997723 AAATTACTCAGAAGGAAGGCAGG - Intronic
1074423658 10:113331603-113331625 AAAACACTTAGAACCATGCCTGG - Intergenic
1074736687 10:116441860-116441882 AAAGTGCTTAGAACAATGCCTGG + Intronic
1074779975 10:116795381-116795403 AAATTACTTAGTAAGAGGCCAGG + Intergenic
1075367332 10:121903868-121903890 AAAATACTTAGAAAAAAACCTGG + Intronic
1075624653 10:123953443-123953465 AAATTACTAAGAAGAAGGCCGGG + Intergenic
1076321727 10:129587929-129587951 AAATAACCTAGCACCCAGCCAGG - Intronic
1078045542 11:7911228-7911250 AAAGTACTTAGAGCTATGCCTGG - Intergenic
1078348644 11:10574020-10574042 AAATGACTGAGGCCCAAGCCAGG - Exonic
1078662942 11:13301759-13301781 AAAGCTCTTAGAACCATGCCTGG - Intronic
1078792121 11:14554778-14554800 GAAGTACTTAGAACAATGCCTGG - Intronic
1078849887 11:15154049-15154071 AACTTACTTTGAGCCAAGCCTGG + Intronic
1079000800 11:16753666-16753688 AAAATCCTTAGAAACAGGCCAGG - Intronic
1079221275 11:18563293-18563315 AAATTATGTACAACCAGGCCGGG + Intronic
1080311738 11:30901923-30901945 ATATAACTTAGAACAATGCCTGG - Intronic
1080683696 11:34498220-34498242 AAAGTACTTAGAACAGGGCCAGG + Intronic
1081417825 11:42836848-42836870 AAAGCATTTAGAACCATGCCTGG + Intergenic
1081545248 11:44066900-44066922 AAAGTACTTAGAACAAATCCTGG - Intronic
1081730310 11:45367482-45367504 AAATTACTTAGTACAGTGCCTGG + Intergenic
1082740106 11:56901326-56901348 AAAGTGCTTAGAACAATGCCTGG + Intergenic
1082769681 11:57197509-57197531 AAAGTACTTAGAACAGTGCCTGG + Intergenic
1084865107 11:72049375-72049397 AAATTACTGAGAACCAAGCTAGG + Intronic
1085715559 11:78870171-78870193 AATTTGCTTAGAACTATGCCTGG + Intronic
1086846849 11:91761000-91761022 AAACTGCTTAGAACTATGCCTGG + Intergenic
1087191801 11:95262481-95262503 GAAGCACTTAGAACCATGCCCGG + Intergenic
1087402822 11:97689133-97689155 AATGTACACAGAACCAAGCCTGG - Intergenic
1087767547 11:102172653-102172675 TCATAACTTAGAACCATGCCTGG - Intronic
1087890311 11:103530767-103530789 AAAGCACTTAGAACAGAGCCTGG + Intergenic
1087933489 11:104004743-104004765 AAATTGCTTAGAACAATGCCAGG - Intronic
1089299272 11:117488819-117488841 AAAGTACTTAGAATCCTGCCAGG - Intronic
1089548753 11:119253270-119253292 AAAGTACTTAGAATAATGCCTGG + Intronic
1090979079 11:131701330-131701352 AAATCGCCTAGAACCATGCCTGG + Intronic
1091758757 12:3073456-3073478 AAAGTACTTAGAACTGTGCCTGG + Intergenic
1091957067 12:4654570-4654592 AAATTACATACATCCAAGACAGG - Intronic
1092373782 12:7938792-7938814 AAATTGCATACAGCCAAGCCTGG + Intergenic
1092699199 12:11208579-11208601 AAATCACTTAGAACAGTGCCTGG - Intergenic
1093067001 12:14668592-14668614 AAATTATTTAGAGCCAAGCGTGG - Intronic
1093067470 12:14673527-14673549 AAATCACTTAGCACAGAGCCTGG - Intronic
1093897880 12:24595573-24595595 AAATTACTAAGAAACAACACAGG + Intergenic
1095508991 12:42928872-42928894 ACAGAACTTAGAACCATGCCTGG - Intergenic
1095812952 12:46390595-46390617 GAAGCACTTAGAACCATGCCTGG + Intergenic
1096539652 12:52298558-52298580 AAATCACTGAGAACTAAGCCTGG - Intronic
1097720411 12:63013828-63013850 AAAATGCTTAGAACTATGCCTGG - Intergenic
1097793271 12:63837764-63837786 AAAGCACTTAGCACCAAGTCTGG - Intergenic
1097832250 12:64237879-64237901 AAAATGCCTAGAACCAAGTCTGG - Intergenic
1097987712 12:65801916-65801938 AAAATGCTTAGAACCATGCCTGG - Intergenic
1098455081 12:70663424-70663446 AAAGTACTTAGGATAAAGCCAGG + Intronic
1098720446 12:73890979-73891001 AAATTACATAGCCCCAAACCTGG - Intergenic
1098791896 12:74834933-74834955 AAACTACATAGAACAATGCCTGG + Intergenic
1098892601 12:76024547-76024569 AAATTACTTAGAGCAGTGCCTGG - Intergenic
1099420418 12:82451500-82451522 AAAGTACTTACAACAATGCCTGG + Intronic
1100189073 12:92171255-92171277 AAATTAAGTAGAACTAAGCATGG - Intergenic
1100219213 12:92485782-92485804 AAAATACAGAGAAACAAGCCAGG + Intergenic
1100245088 12:92749664-92749686 AAAGTGCTTAGAACAGAGCCTGG - Intronic
1100813887 12:98366897-98366919 AAAAGACTTAGAACAAAGCCTGG + Intergenic
1100880084 12:99006779-99006801 AAAGTACTTAGAACAGTGCCTGG - Intronic
1100945547 12:99778864-99778886 AAATGAATTAAAACCAAGTCAGG - Intronic
1101591145 12:106126568-106126590 AAATTACTCAGCACAGAGCCTGG + Intronic
1101752190 12:107591023-107591045 AAAGTGCTTAGGACAAAGCCAGG + Intronic
1101811830 12:108113978-108114000 ACAGTTCTTAGAACAAAGCCTGG + Intergenic
1101873224 12:108582270-108582292 AAAGTGCTTAGTACCATGCCTGG + Intergenic
1102422224 12:112812991-112813013 AAAGTGCTTAGAACAATGCCTGG - Intronic
1102759595 12:115374162-115374184 ACAATATGTAGAACCAAGCCTGG - Intergenic
1103187684 12:118974900-118974922 AAAGTACTTAGAAAAATGCCTGG + Intergenic
1103691276 12:122776127-122776149 AAAGTACTGAGCACAAAGCCTGG - Intronic
1104071825 12:125352593-125352615 AAAGTTCTTAGAACAATGCCTGG + Intronic
1104076715 12:125396428-125396450 AAAGTGCTTAGAACAGAGCCTGG - Intronic
1106381336 13:29242792-29242814 AATGTACTTAGAACCATACCTGG - Intronic
1106567038 13:30895243-30895265 AAAGCACTGAGAACCAAGACTGG - Intergenic
1106812219 13:33370162-33370184 AAAGTACTTAGAACAGGGCCTGG + Intergenic
1107092547 13:36497882-36497904 AAAGTTCTTAGAACAATGCCTGG + Intergenic
1107296439 13:38914168-38914190 AAATTAAATAGAACAAAGCCAGG + Intergenic
1107364863 13:39659556-39659578 AAAATACTTAGCACAGAGCCAGG - Intronic
1107632813 13:42359636-42359658 AAATCCCTTAGAACAATGCCTGG + Intergenic
1107640909 13:42442280-42442302 AAATCACTTAGCACCAAGCCTGG - Intergenic
1108007400 13:45963581-45963603 AAATTACTTATTAACAGGCCAGG - Exonic
1108316244 13:49240475-49240497 AAAGTACCTAGAACAGAGCCTGG + Intergenic
1108343261 13:49518558-49518580 AAAGCACTTAGAACTATGCCTGG - Intronic
1108739510 13:53320863-53320885 AAAATACTTAGCACAGAGCCTGG - Intergenic
1109574656 13:64238637-64238659 AAACTACTTAGAAACATGTCTGG - Intergenic
1110835704 13:80079639-80079661 ACAGTACTTAGAAACATGCCTGG - Intergenic
1110960695 13:81620509-81620531 AGATTACTGAGAATCAAGACAGG - Intergenic
1111156005 13:84327008-84327030 AAAATACTTAAAACCAAAACTGG - Intergenic
1112459888 13:99594603-99594625 ATATTACTTACAAGCAAACCTGG + Intergenic
1113041129 13:106104907-106104929 AAATTGCTTAGAACAATGGCTGG - Intergenic
1114563693 14:23612207-23612229 AAAGTACTTAGAACAGTGCCTGG + Intergenic
1114775181 14:25473554-25473576 AAATTACTTTGTGCCAAGCTTGG + Intergenic
1115453173 14:33572416-33572438 AAAGTACTTAGAACAGTGCCTGG - Intronic
1116133808 14:40894501-40894523 GCATCACTTAGAACCAAGCTAGG + Intergenic
1116507831 14:45706908-45706930 AATTTATTTAAAACCAGGCCAGG + Intergenic
1117511298 14:56454283-56454305 AAAGTGCTTAGAACCATGCCTGG + Intergenic
1117511306 14:56454426-56454448 AAAGTGTTTAGAACCATGCCTGG - Intergenic
1117670349 14:58099973-58099995 AAGGTACTTAAAACTAAGCCTGG + Intronic
1117695270 14:58355616-58355638 TAAATGCTTAGAACCATGCCTGG + Intronic
1118376905 14:65185339-65185361 AAATAACTTAAAACTTAGCCTGG - Intergenic
1120141612 14:80935820-80935842 AAAGTGCTTAGAACAGAGCCTGG - Intronic
1120254701 14:82104310-82104332 AAATTATTTATAAGAAAGCCTGG + Intergenic
1120394894 14:83956342-83956364 AAATTACATAGAGCCAAATCAGG - Intergenic
1121080675 14:91105475-91105497 AAAAAACTTAGTACCAGGCCTGG - Intronic
1121087312 14:91156407-91156429 AAATGATTTAGAAACAGGCCGGG - Intronic
1121807661 14:96844840-96844862 AAAGTACTTAGAAGAAGGCCTGG - Intronic
1122633702 14:103120195-103120217 AAAACACTTAGAACAACGCCTGG + Intergenic
1122729319 14:103783845-103783867 GAATTATTTAAAACAAAGCCTGG - Intronic
1124809219 15:32917533-32917555 AAAACACTTAGAACAATGCCTGG - Intronic
1124970937 15:34489508-34489530 AAATTCCTGAAAAGCAAGCCGGG - Intergenic
1125224880 15:37384569-37384591 AAAGTACTTAGAACAATGCCTGG + Intergenic
1125598382 15:40901921-40901943 AAAGTACTTAGAACACTGCCTGG + Intronic
1125963334 15:43851524-43851546 AAAGTACTTAGAAGAGAGCCTGG + Intronic
1126325746 15:47475251-47475273 AAATGACTTAGCACAATGCCTGG - Intronic
1127006558 15:54577370-54577392 AATTTACCTAGCACAAAGCCTGG - Intronic
1128168648 15:65490560-65490582 AAAGCACTTAGAACAAAGCCTGG + Intronic
1128218174 15:65948658-65948680 AAAATATTTAGAACAAAGCCTGG - Intronic
1128399248 15:67260800-67260822 GAATGCCTTAGAACCAGGCCAGG + Intronic
1130566634 15:85001875-85001897 AAAGTACTTAGAACAGTGCCTGG - Intronic
1130718711 15:86364298-86364320 AAATCACTTAGCACAATGCCTGG - Intronic
1131304009 15:91225036-91225058 AAAGTACTTAGAATCGTGCCTGG - Intronic
1131592771 15:93767719-93767741 AAGCTACTTAGAACAATGCCTGG - Intergenic
1131743021 15:95414724-95414746 AAAGCACTTAGAACACAGCCTGG - Intergenic
1132154221 15:99484364-99484386 AAATTAATTAGAACAGTGCCTGG + Intergenic
1132293092 15:100716696-100716718 AATTAACATAGAACCAGGCCTGG + Intergenic
1132918189 16:2366217-2366239 AAAGTGCTTAGAACAAAGCCTGG + Intergenic
1133345436 16:5066587-5066609 AATTTATTTAAAACAAAGCCTGG - Intronic
1134068408 16:11245208-11245230 AAAGTGCTTAGAAGCATGCCTGG - Intergenic
1134114209 16:11535993-11536015 AAAGTACTGAGTAACAAGCCAGG + Intergenic
1134250739 16:12572171-12572193 TAATTTCTTAGAACCATGGCAGG + Exonic
1134540483 16:15060298-15060320 AAATTACTTTCCACCAAACCCGG + Exonic
1134635951 16:15792018-15792040 AAAATGCTTAGAACAATGCCTGG + Intronic
1134680491 16:16121721-16121743 AAACTGCTTAGAACGATGCCTGG + Intronic
1135269159 16:21054073-21054095 CAATCACTTAGCACAAAGCCTGG + Intronic
1135465693 16:22682950-22682972 AAATTGCTTAGAACAGAGCCTGG + Intergenic
1136181185 16:28553569-28553591 AAATTAATTAAAAACAGGCCGGG - Intergenic
1136512124 16:30744529-30744551 AAAGTGCTTAGAACACAGCCTGG - Intronic
1136595528 16:31246645-31246667 TAATCACTTAGAACCATGTCTGG + Intergenic
1137311241 16:47261407-47261429 AAGTTACTTAGAACAACTCCTGG + Intronic
1137880032 16:52036407-52036429 AAACTGCTTAGAACTATGCCTGG + Intronic
1139007628 16:62592931-62592953 AAAGTGCTTAGAGCCAAGCTAGG + Intergenic
1139333968 16:66217877-66217899 AAATCACTTAGAACATTGCCTGG + Intergenic
1139925652 16:70484578-70484600 GAAATGCTTAGAACAAAGCCAGG - Intronic
1140213190 16:72986848-72986870 AAAAAACATAGAACCCAGCCAGG + Intronic
1143398227 17:6620058-6620080 AAAATACTTAGAACCCAGCAGGG + Intronic
1144826961 17:18110663-18110685 AAAGCATTTAGTACCAAGCCTGG + Intronic
1146270865 17:31484809-31484831 AAAATACATAGAACAGAGCCTGG - Intronic
1146701418 17:34963807-34963829 AAAGCACTTAGAACCATGCCTGG - Intronic
1147957259 17:44142893-44142915 AAAATCCTTAGGCCCAAGCCAGG + Intronic
1148518567 17:48246075-48246097 AAATCACTTAGAACAGAGCCTGG + Intronic
1149852622 17:60048931-60048953 TAATTACTTAGCACACAGCCTGG - Intronic
1149852872 17:60051298-60051320 AAAATACTTAGAGCAATGCCTGG - Intronic
1150183831 17:63158305-63158327 AATTTACTTAGCACAATGCCTGG + Intronic
1150425294 17:65072723-65072745 AAAGGACTTAGAAACCAGCCAGG + Intergenic
1150988869 17:70231908-70231930 AAATTGCTTAGAACAGTGCCTGG + Intergenic
1151688424 17:75664097-75664119 AAAGCACTTAGCACGAAGCCTGG + Intronic
1151804112 17:76395169-76395191 AAATTACTTTGAAATAGGCCGGG - Intronic
1153521593 18:5959369-5959391 AAAATGCTTAGCACCATGCCTGG + Intronic
1153561289 18:6374331-6374353 AAAGGGCTTAGGACCAAGCCTGG + Intronic
1153956237 18:10098793-10098815 CAAATACTTAAAACCAGGCCGGG + Intergenic
1154482540 18:14847867-14847889 AAACTACCTAAGACCAAGCCAGG - Intronic
1155316905 18:24580965-24580987 AAAGTATTTAGAACAATGCCTGG + Intergenic
1157129173 18:44987564-44987586 AAATCACTTGGAGCCAAGTCTGG + Intronic
1158281416 18:55832543-55832565 AAAGTGCTTAGAACAATGCCTGG + Intergenic
1159131348 18:64283390-64283412 AAATTACTGAGATATAAGCCTGG - Intergenic
1159178606 18:64871596-64871618 AAAGTACTTAGTACAATGCCTGG - Intergenic
1159593490 18:70360219-70360241 AAAGTACTTAGAACAGTGCCTGG + Intergenic
1161556148 19:4943944-4943966 AAATTCATTCGAACTAAGCCAGG - Intronic
1161623626 19:5312739-5312761 AAAAGACTTTGAACCATGCCTGG - Intronic
1161761267 19:6174461-6174483 AAAATGCTTAGAACAATGCCTGG + Intronic
1162869747 19:13576755-13576777 AAATTACTTAGAACAGTGCTTGG - Intronic
1163155202 19:15436508-15436530 AAAGTGCTTAGAACGATGCCTGG + Intronic
1163513814 19:17751246-17751268 AAATAACTGAGCACCAACCCTGG - Intronic
1164451110 19:28365765-28365787 AAACTGCTTAGAGCCATGCCTGG - Intergenic
1164647121 19:29867159-29867181 AAAGTACTTAGAACCTTGGCTGG - Intergenic
1164829659 19:31310814-31310836 AAAGCACTTAGCACCATGCCTGG + Intronic
1167015362 19:46837892-46837914 CAATTGCTTAGAACAATGCCTGG + Intergenic
1167585350 19:50371739-50371761 AAATAAATAAGAACAAAGCCGGG + Intronic
1167637442 19:50662989-50663011 AAAGCACTTAGAACAATGCCTGG - Intronic
1168556814 19:57350358-57350380 AAAGTACTTAACACCAGGCCTGG - Intergenic
925243694 2:2359444-2359466 AAAGTACTTAGCACCATTCCTGG - Intergenic
925613938 2:5727278-5727300 AAAGTACTTAGAACACTGCCTGG - Intergenic
927292357 2:21417207-21417229 AAATGTCTTAAAACCCAGCCGGG + Intergenic
927507300 2:23622792-23622814 AAAGGACTTAGAACCATGCCTGG - Intronic
927629545 2:24760701-24760723 AAATTACTTAGAACCAGTGGTGG - Intronic
928469205 2:31556916-31556938 AAAGTACTTAGAACATTGCCTGG - Intronic
929742717 2:44620960-44620982 AAAATTCTTAGAACAGAGCCTGG + Intronic
929870879 2:45758292-45758314 AAAGTATTTAGAACCATGCCTGG + Intronic
930465192 2:51738857-51738879 AAATTACTTAAAACCTAGCTGGG + Intergenic
931369005 2:61644649-61644671 AAATTAAAGAGAAACAAGCCAGG + Intergenic
931562893 2:63582098-63582120 AAATTAACTAAAACCAACCCAGG + Intronic
931691852 2:64840436-64840458 AAATCACTTAGCACAATGCCTGG + Intergenic
932311008 2:70740993-70741015 AAATTTCTTAGACCAAGGCCGGG - Intronic
932629413 2:73325657-73325679 AAAGTACTTAGAACAATGTCTGG - Intergenic
933065540 2:77790088-77790110 AATGTTCTTAGAACCATGCCTGG - Intergenic
934087050 2:88518409-88518431 CAATTACTTAGCACCTAGTCTGG - Intergenic
934664625 2:96161437-96161459 AAAATACTTAGAAACAGGCTGGG + Intergenic
934741635 2:96728033-96728055 AAAGTGCTTAGAACAATGCCTGG + Intronic
936892988 2:117393753-117393775 AAAATACTTAGAACAAAGTAGGG + Intergenic
937682826 2:124662994-124663016 AAAATACTTACCACAAAGCCTGG - Intronic
938761400 2:134429591-134429613 AAAGTGCTTAGAACAGAGCCTGG + Intronic
940096963 2:149987839-149987861 AAATTACTTAGAAACGACACTGG + Intergenic
940234051 2:151490614-151490636 AAAGTACTTAAAACCATGCTTGG - Intronic
940503308 2:154521461-154521483 AAATGACTTATATCCAAGACAGG - Intergenic
940539032 2:154986948-154986970 AAAGCACTTAGAACAATGCCTGG + Intergenic
940904699 2:159158473-159158495 AAAGAACTTAGAATGAAGCCTGG + Intronic
941204608 2:162556248-162556270 AAAGCACTTAGAACAGAGCCTGG - Intronic
941845115 2:170124658-170124680 AAACTACTTAGAAAAAAACCTGG - Intergenic
941957094 2:171215972-171215994 AAAGTCCTTAGAACAACGCCTGG - Intronic
942124163 2:172806492-172806514 AAAGCACTTAGTACAAAGCCTGG + Intronic
942826011 2:180177872-180177894 AACTTACTTAGAACCAACACAGG + Intergenic
943587006 2:189752596-189752618 ACATTACTTAAGACAAAGCCTGG - Intronic
944891690 2:204123985-204124007 AAGTCATTTAGAACCAAGCAGGG - Intergenic
945127618 2:206530102-206530124 AAAATACATAAAACAAAGCCGGG - Intronic
945180862 2:207089786-207089808 ATATTAATTAGAACAATGCCTGG + Intronic
945532689 2:210975755-210975777 ACAATACTTAGAACCAAAGCAGG - Intergenic
945604813 2:211915884-211915906 AAATTACTTAGCATAAATCCTGG - Intronic
948280094 2:236740498-236740520 AAATTACTTTGAGACAGGCCTGG + Intergenic
948498183 2:238368566-238368588 AACTTACATAGAGCAAAGCCTGG - Intronic
1169690869 20:8330193-8330215 AAAGTACTAAGAACAAGGCCCGG - Intronic
1170134944 20:13062222-13062244 AAGATATTTAGATCCAAGCCTGG - Intronic
1170738603 20:19032875-19032897 AAATGACTTTGAACAAAGCAAGG + Intergenic
1170762134 20:19260373-19260395 AAAGTACTCAAAACCATGCCCGG + Intronic
1170838080 20:19902061-19902083 AAAGTGCTTAGAACAATGCCTGG - Intronic
1170848416 20:19981824-19981846 ACAATACTTAAAACCAACCCAGG + Intronic
1172591336 20:36120158-36120180 GAATCACTTATAACCACGCCTGG - Intronic
1172810194 20:37641880-37641902 AAAGTGCTTAGAACAATGCCCGG + Intergenic
1172840428 20:37899942-37899964 AAAGCACTTAGAACAATGCCAGG - Intergenic
1174346524 20:49934502-49934524 AAAATACTCAGAAACAGGCCAGG + Intergenic
1174558120 20:51411054-51411076 AGATTGCTTAGAACAAGGCCTGG - Intronic
1174735685 20:52963695-52963717 CATTTACTTACAACCAACCCAGG - Intergenic
1176798060 21:13388761-13388783 AAACTACCTAAGACCAAGCCAGG + Intergenic
1176964883 21:15201408-15201430 AAAGTACTTAGAACAGTGCCTGG + Intergenic
1178048400 21:28721685-28721707 AAAGTACTTAGAACAGTGCCTGG - Intergenic
1178499097 21:33110923-33110945 AAAGGACTTAGAACCCTGCCTGG - Intergenic
1179173888 21:38993240-38993262 AAATTTCTTAAAACCAAACCGGG - Intergenic
1179969595 21:44827353-44827375 AAATTGCTTAAGACCAAGCGTGG + Intergenic
1182207495 22:28643841-28643863 AAAGTACTTAGAACTGTGCCAGG - Intronic
1182304817 22:29360582-29360604 AAAGCTCTTAGCACCAAGCCTGG - Intronic
1182740586 22:32564445-32564467 AAGTTACTTAGAACAATGCCTGG - Intronic
1183055235 22:35300855-35300877 GAAATACTTAGAACAATGCCTGG + Intronic
1183118694 22:35712719-35712741 AAATTAAATAGAAAAAAGCCAGG + Intergenic
1183970253 22:41472012-41472034 AAAGTATTTAGAACCCTGCCTGG + Intronic
1184022146 22:41827961-41827983 AACTTTCTAAGAACCAGGCCTGG + Intergenic
949092826 3:49714-49736 AAAATACTTAGAAGAGAGCCCGG + Intergenic
950284942 3:11737203-11737225 AAATTACTTAAGATTAAGCCAGG - Intergenic
950873449 3:16249156-16249178 AAAGCACTTAGAACAAGGCCTGG - Intergenic
951685596 3:25340569-25340591 ACATTACTTAGAAGCAAGTGAGG + Intronic
952982364 3:38747449-38747471 AAAATGCTTAGAACCACGACTGG - Intronic
956230671 3:67012553-67012575 AAATTCATTAGAACTAAACCTGG - Intergenic
956239205 3:67110152-67110174 AAATTACTTGTAACTAAGCAAGG - Intergenic
956251152 3:67235670-67235692 TAAGCACTTAGAACAAAGCCTGG + Intergenic
956951094 3:74283335-74283357 AAATTACTTAGAACCATGACCGG + Intronic
956978408 3:74609371-74609393 GAAGTACTTAAAACCCAGCCTGG + Intergenic
957007692 3:74969610-74969632 AAATTACTTAGAATAGGGCCTGG + Intergenic
957033092 3:75265800-75265822 AAAATACTTAGAAGAGAGCCCGG + Intergenic
957316055 3:78578304-78578326 ACATTGCCTAGAACAAAGCCTGG - Intergenic
957530149 3:81430531-81430553 AGAATACTTTGAACCATGCCTGG - Intergenic
957569340 3:81926203-81926225 AAATTAGTAAGAACCAGGACTGG - Intergenic
957885085 3:86276926-86276948 AAAGTACATAGAACAATGCCTGG - Intergenic
959656923 3:108817689-108817711 AAATTACTTAGAACAGTGTCTGG - Intergenic
959821824 3:110744348-110744370 ACATTATTTAGAACAATGCCTGG + Intergenic
960025961 3:113009785-113009807 AAAGCACTTAGAACAATGCCTGG + Intronic
960840813 3:121956720-121956742 AAAATGCTTAGCACAAAGCCTGG + Intergenic
960853743 3:122081699-122081721 TAATTACTTAAAACCAATACAGG + Intronic
961204654 3:125072268-125072290 AAATCATTTGGAACCAAGCCTGG - Intergenic
961676083 3:128567634-128567656 AAATTGCTTAGCACCATGCCTGG + Intergenic
962155396 3:132942900-132942922 AAATTTCTGAGACCCAGGCCAGG - Intergenic
963857106 3:150266273-150266295 AAATTATTTATAATCATGCCAGG + Intergenic
964070534 3:152626630-152626652 AAATTGCTTACAACAATGCCTGG + Intergenic
964425911 3:156553853-156553875 AAATTAATTATAGCTAAGCCTGG + Intronic
964656880 3:159076958-159076980 AAAGTACTTAGAACAGTGCCTGG + Intronic
964865021 3:161248079-161248101 AAATTATTTAAAATGAAGCCAGG - Intronic
965326953 3:167318346-167318368 AAATTAGTTAGAATGGAGCCTGG - Intronic
965433389 3:168617141-168617163 AATTTACTTTGAATCACGCCAGG - Intergenic
965633748 3:170759852-170759874 AAACTGCTGAGAACCATGCCTGG - Intronic
966005384 3:175005130-175005152 AAATTACTTAGAACAATGCCGGG - Intronic
966323783 3:178731606-178731628 AAAATAATTAAAACCTAGCCGGG + Intronic
966339948 3:178914610-178914632 AAAGTGCTTAGAACTATGCCTGG - Intergenic
966956297 3:184883766-184883788 ATAGTACTTAGTACCAGGCCAGG + Intronic
967520864 3:190431288-190431310 AAAGTACTTAAAACAAGGCCTGG + Intronic
967544488 3:190708387-190708409 AAAGTACTTAGAATCATGCCTGG - Intergenic
967761594 3:193232069-193232091 TAAATACTTAGAACAATGCCTGG - Intergenic
967978903 3:195053505-195053527 AAATTACTTAGAACTTACACTGG + Intergenic
967999517 3:195195246-195195268 AAAGCACTTAGAACAATGCCTGG + Intronic
969336058 4:6511181-6511203 AAAATGCTTAGAACGATGCCTGG + Intronic
969858689 4:10019446-10019468 AAAGTGCTTAGAATCACGCCTGG - Intronic
970492352 4:16587263-16587285 AAAGCACTTAGAACAATGCCTGG - Intronic
971629393 4:28970238-28970260 AAATTACTTTGAGACCAGCCTGG - Intergenic
971693197 4:29864571-29864593 AAATTACTGAAAACTAAGCTGGG + Intergenic
971768696 4:30868212-30868234 AAAACACTTAGCACCATGCCTGG - Intronic
971832734 4:31718590-31718612 AAAGTACCTACAACAAAGCCAGG - Intergenic
972040835 4:34595932-34595954 AATTTATTTAGAACCAAACAGGG - Intergenic
972715845 4:41644999-41645021 AAAGTACTTAGAACAATGCCTGG - Intronic
973327611 4:48879351-48879373 AAATTACTTAGAATAGTGCCTGG - Intergenic
974157608 4:58094330-58094352 AAAGTACTTAGAATCGGGCCTGG - Intergenic
974578342 4:63759956-63759978 AAATAACTTAGAACAATGCCTGG + Intergenic
974927357 4:68316710-68316732 AAAGTGCTTAGAACAATGCCTGG - Intronic
975864445 4:78712497-78712519 AAATTATCTAGAACCAAGGTGGG - Intergenic
976097216 4:81521616-81521638 AAATTACTTAGAACAGTGGCAGG + Intronic
976108620 4:81646110-81646132 AGATTACTTGGCACAAAGCCTGG - Intronic
976788906 4:88854928-88854950 AAATCTCTTGGAACCATGCCTGG - Intronic
977327995 4:95601694-95601716 AAAGTTCTTAGAACGATGCCTGG - Intergenic
978168608 4:105640600-105640622 AAATGAGTTAGAACCAACACAGG - Intronic
978749994 4:112235544-112235566 AAAGTACTTAGAACAGTGCCTGG - Intronic
978783668 4:112584047-112584069 ATATCACTTAAAACCATGCCAGG + Exonic
978858405 4:113419823-113419845 AAGTTATTAAGAACCAAGCCAGG + Intergenic
978986524 4:115020088-115020110 AAGTAACTTAGAAAAAAGCCTGG + Intronic
980905415 4:138943939-138943961 AAAGTGCTTAGAACAACGCCAGG + Intergenic
980955459 4:139423977-139423999 AAAGCACTTAGAACCAAACCTGG - Intergenic
981870346 4:149478078-149478100 AAATTACTTAGAATACTGCCAGG + Intergenic
982165179 4:152607720-152607742 AAATTACTTAGAACGTTACCTGG + Intergenic
982548525 4:156765886-156765908 AAAACACTTAGAATTAAGCCTGG - Intronic
982791414 4:159595995-159596017 AAATCACTTAGAACAGCGCCTGG + Intergenic
983226733 4:165092457-165092479 AAAATACTTAGAACAGTGCCTGG + Intronic
983442207 4:167801189-167801211 AAAGTGCCTAGAACAAAGCCTGG + Intergenic
984018513 4:174455147-174455169 TAATTACATAGAGCCAAGCAAGG + Intergenic
984229681 4:177079718-177079740 AAATCACTTAGAACAATGTCTGG + Intergenic
984730388 4:183063034-183063056 AAAGCACTTAGAACAGAGCCTGG - Intergenic
984825046 4:183916528-183916550 AAAGCTCTTAGAACCAAGCTTGG + Intronic
987037581 5:14033471-14033493 ACAGTACCTAGAACCATGCCTGG + Intergenic
988816697 5:34841327-34841349 AAGGTACTTAGAACAGAGCCTGG - Intronic
989488029 5:42014642-42014664 AAATTACTTAGCTCAATGCCTGG + Intergenic
989782623 5:45287499-45287521 GAATTACTTAGCACAATGCCTGG + Intronic
990430920 5:55734811-55734833 ATTTTACTTAGCACCTAGCCTGG + Intronic
990571210 5:57080827-57080849 AAATTACAGAAAATCAAGCCAGG - Intergenic
990624917 5:57599838-57599860 AAAGTGCTTAAAACCATGCCAGG + Intergenic
992804815 5:80326307-80326329 AAACTAATCAGAAGCAAGCCTGG + Intergenic
993289774 5:86051777-86051799 AAATTACTTAGAACAATTCCTGG - Intergenic
993369143 5:87070723-87070745 AAAATACTTAGAACAACCCCTGG - Intergenic
993956702 5:94243155-94243177 AAAACACTTAGAACAATGCCTGG + Intronic
994005977 5:94837580-94837602 AGAGTCCTTAGAACAAAGCCTGG + Intronic
994040314 5:95251737-95251759 AAACTGCTTAGAACAGAGCCAGG - Intronic
994128014 5:96191337-96191359 AAAGTACTTAGAACAATGCCTGG - Intergenic
994265393 5:97710111-97710133 AAATGACTTATATCCAAGACAGG + Intergenic
994957183 5:106546946-106546968 AAACTAATTAAAAGCAAGCCAGG + Intergenic
995205934 5:109481724-109481746 AAATTTCTGAGAAACATGCCGGG + Intergenic
995651451 5:114373659-114373681 AAATTACTTGGAACACTGCCTGG + Intronic
995753013 5:115473116-115473138 AAATAACCTAGAGCCAAGCCTGG - Intergenic
996741114 5:126799872-126799894 AAATTACTTTGCACCAAGGGCGG + Intronic
997944418 5:138186603-138186625 AAATTACTTAGCACAGTGCCTGG - Intronic
999298219 5:150473877-150473899 AAATTGCTTAGCACTATGCCTGG - Intergenic
1000966621 5:167665242-167665264 AAATTACTTAGCACAAGGCTTGG + Intronic
1001196115 5:169675023-169675045 AAAACACTTAGCACCAAGCCTGG - Intronic
1002694712 5:181078020-181078042 AAATTACTTATAAACTAGCCAGG + Intergenic
1002843617 6:926742-926764 AAAATACTTAGAACACTGCCAGG - Intergenic
1004150476 6:13114904-13114926 AGTTTACTTAGCACCAAGTCTGG - Intronic
1004314437 6:14573558-14573580 AAAGTGCTTAGAACCATGCCAGG - Intergenic
1004634197 6:17451171-17451193 AAATGACTGAGGACCAAGCAGGG + Intronic
1005088125 6:22027829-22027851 AAAGTACTTAGAAGCGTGCCTGG + Intergenic
1007162735 6:39805365-39805387 AAAATACTTAGAACAGTGCCTGG + Intronic
1007248554 6:40480086-40480108 AAAGTTCTTAGAAGAAAGCCTGG - Intronic
1007382306 6:41498528-41498550 AGAGTACTTAGAACCATTCCTGG + Intergenic
1007784851 6:44273694-44273716 AAAATACTTAGAGCAGAGCCTGG - Intronic
1007912127 6:45526324-45526346 AAATTACATAAAACCATGCAAGG - Intronic
1008384598 6:50874430-50874452 AAATCACTTAGCATAAAGCCTGG + Intergenic
1010265189 6:73857743-73857765 AAAGAACTTAGAACAATGCCGGG - Intergenic
1010422862 6:75693959-75693981 TAAAAACTTAGAACCAGGCCAGG + Intronic
1011035463 6:82969312-82969334 AAAATACTTAGAAAGAGGCCAGG + Intronic
1011610665 6:89146886-89146908 AAAGAACTTACACCCAAGCCTGG + Intronic
1012329184 6:97962903-97962925 AAATTATTTAGAAACAAGATAGG + Intergenic
1012684726 6:102231752-102231774 AAAAAACTTGGAACTAAGCCAGG + Intergenic
1013968614 6:115987171-115987193 AAACTGCTTAGAACATAGCCTGG - Intronic
1014803062 6:125798425-125798447 AAAGTACTTGGAACCTTGCCTGG + Intronic
1016359116 6:143249339-143249361 AAAGGACTTAAAACCCAGCCTGG - Intronic
1016375553 6:143417043-143417065 AAAGTCCTTAGAGCCATGCCTGG + Intergenic
1016597789 6:145820991-145821013 AAAGTACTTAGAACAGTGCCTGG + Intergenic
1016933701 6:149432985-149433007 AAATTACTGAAAAGCAGGCCAGG + Intergenic
1018976275 6:168569737-168569759 AAATTACTTAGGTCCAGGTCAGG - Intronic
1019111650 6:169722117-169722139 AAAGTACTTAGAACAAGGACTGG + Intronic
1022120954 7:27307544-27307566 AAAATACTTAAAGCAAAGCCTGG - Intergenic
1022331332 7:29382114-29382136 AAAGTGCTTAGAACAATGCCTGG + Intronic
1023106731 7:36770317-36770339 AAATTACCTAGAACAGTGCCTGG - Intergenic
1024376184 7:48641437-48641459 AAATTACTTGGAACAATGTCTGG - Intronic
1024578934 7:50786230-50786252 AAAATACAGAGAACCAATCCAGG + Intronic
1024722161 7:52149425-52149447 AAAATACTTAGAACAAAGCCTGG + Intergenic
1026229947 7:68473961-68473983 AAAGCACTTAGAACCACTCCTGG + Intergenic
1026257892 7:68728524-68728546 AAAGCACTTAGAACAATGCCTGG - Intergenic
1026395029 7:69943267-69943289 AAAGTTCTTAGAACAAGGCCTGG + Intronic
1026552649 7:71381254-71381276 AAAATCCCTAGGACCAAGCCAGG - Intronic
1026861372 7:73792155-73792177 AAATTACTTGAAACCAAGGAGGG - Intergenic
1026871405 7:73854859-73854881 AAAATACTTAGAACCAGGCAGGG - Intergenic
1027481907 7:78708523-78708545 AAAATACTTAGAAGAATGCCTGG - Intronic
1027759521 7:82260249-82260271 AAAACACTTAGAACAATGCCTGG + Intronic
1027817545 7:82995811-82995833 AAAGTACTTAGATCCATGCACGG + Intronic
1027972379 7:85101769-85101791 AAAGTTCTTAGAACCATGCTTGG + Intronic
1028272015 7:88803386-88803408 AAATTACTAAGAAACAGTCCAGG + Intronic
1029951032 7:104585798-104585820 AAATTACTTAAAATCATGCAGGG + Intronic
1029969410 7:104774305-104774327 AGAAGACTTAGAACCATGCCTGG - Intronic
1030964587 7:115974913-115974935 AAAGCACTTAGAAGCATGCCTGG - Intronic
1030984550 7:116226012-116226034 AAAATACTTAGAACCCTGCATGG + Intronic
1031678999 7:124647366-124647388 AAATTATTTAGAACAATGTCTGG + Intergenic
1032157402 7:129479910-129479932 AAATTAATTTGAAGCAAGACAGG - Intronic
1032317644 7:130854768-130854790 AAAGTGCTTAGCACCATGCCTGG + Intergenic
1032349815 7:131150568-131150590 AAAATACTTAGCACAAAGCTTGG + Intronic
1032455596 7:132071064-132071086 AAAGTACTTAGCACCATGTCTGG + Intergenic
1033329000 7:140402840-140402862 AAATTACTTACAATCTGGCCAGG + Intronic
1033718012 7:144022950-144022972 AAAGTACTTAGACCCATGCTTGG + Intergenic
1036788301 8:11702236-11702258 AATTTTCTTAGCAACAAGCCAGG - Intronic
1036973505 8:13382167-13382189 AAATTACCTTTAACCAAGCCTGG - Intronic
1037035188 8:14158069-14158091 AAATAACTTAGGACCAAAGCTGG - Intronic
1038398332 8:27263497-27263519 AAATCACTTAGAACATTGCCTGG + Intergenic
1040394462 8:46983552-46983574 AAATTAGTTTGAAATAAGCCAGG - Intergenic
1040841502 8:51790144-51790166 AAATTAATTAGACACAGGCCTGG + Intronic
1041184319 8:55283247-55283269 AAAGCACTTAGCACCATGCCAGG - Intronic
1041608288 8:59811918-59811940 AAAATGCTTAGAACAATGCCAGG + Intergenic
1042060372 8:64810200-64810222 AAATGACTTAGAACCAAAGCTGG - Intergenic
1043074932 8:75686273-75686295 AAAACACTTAAAACCAAGCCTGG - Intergenic
1043802106 8:84622414-84622436 TAAATACTTAGAACATAGCCTGG - Intronic
1044266112 8:90183605-90183627 AAATAACTTAGAACAGAGCCTGG + Intergenic
1044871262 8:96622140-96622162 AAAGCACTTAGAACAATGCCTGG + Intergenic
1045028684 8:98115079-98115101 AAATAACTTAGAACAGTGCCTGG + Intronic
1045505550 8:102775855-102775877 AAAGCACTTAGCACCATGCCTGG + Intergenic
1045857239 8:106778616-106778638 AAAGTACTTAGCTCCATGCCTGG + Intergenic
1046514002 8:115234898-115234920 ACATCACTTAGAAACATGCCTGG - Intergenic
1047074218 8:121381772-121381794 AAAGCACTTAGAACAAAGCCTGG - Intergenic
1047633042 8:126729006-126729028 AAATCATTTAGAACCATGCCTGG - Intergenic
1047643716 8:126847800-126847822 CAACTACATGGAACCAAGCCTGG + Intergenic
1049499286 8:142952976-142952998 AAAGCCCTTAGAACAAAGCCTGG + Intergenic
1049652340 8:143776968-143776990 AAATTAATTTGAACCAGGCATGG + Intergenic
1052571602 9:30231706-30231728 ACATTATTTATAACGAAGCCTGG + Intergenic
1052973049 9:34389640-34389662 AAAGTGCTGAGAACCACGCCCGG + Intronic
1055371294 9:75602434-75602456 AAATTATTTAAAACCCAGACAGG + Intergenic
1055423202 9:76165540-76165562 AAATTACTTTGGATGAAGCCTGG - Intronic
1055481411 9:76712177-76712199 AAAACCCTTAGAACCATGCCTGG - Intronic
1055718780 9:79148326-79148348 AAATTATTTAGAACCATGTCTGG + Intergenic
1057421309 9:94915223-94915245 AAAATACTTAGAACTTTGCCTGG + Intronic
1057798669 9:98175849-98175871 CAAGCACTTAGAACCCAGCCTGG + Intronic
1058501680 9:105625615-105625637 AAAGAACTTAGCACCATGCCTGG + Intronic
1058633899 9:107018117-107018139 AAAGTATTTAGAACCATTCCTGG - Intergenic
1058991546 9:110258451-110258473 AAAATGCTTAGAACCGTGCCTGG + Intergenic
1059041016 9:110815678-110815700 ACATTGCTTAGTGCCAAGCCTGG - Intergenic
1059403946 9:114088469-114088491 GAATTATTTAGAACAGAGCCTGG - Intronic
1060259229 9:122059322-122059344 AAAGTGCTTAGAGCCATGCCTGG - Intronic
1060435636 9:123590404-123590426 AGATTAATTAGAACCCAGACTGG - Intronic
1060584618 9:124778062-124778084 AAAGTACTTAGCACTAGGCCGGG + Intronic
1061662373 9:132138753-132138775 AAAGTACTTAAAACAGAGCCTGG - Intergenic
1186457621 X:9722407-9722429 AAGTCACTCAGAACCAAGGCTGG + Intergenic
1186698510 X:12064210-12064232 AAAGTACCTAGAACAATGCCTGG - Intergenic
1186881794 X:13873649-13873671 TAAGCAATTAGAACCAAGCCTGG + Intronic
1186995625 X:15118543-15118565 AAAACACTTAGAACAATGCCTGG + Intergenic
1189036163 X:37495489-37495511 AAATCACTTAGAGCAATGCCTGG + Intronic
1189459935 X:41232092-41232114 AAATTATTTAGACTCAAGTCTGG - Intronic
1189795587 X:44642935-44642957 AAAGCACTTAGAACAATGCCTGG + Intergenic
1192359280 X:70428776-70428798 AAAGTACTTAGAACACTGCCTGG + Intronic
1192576025 X:72243782-72243804 AAAGTCCTTAGAACAAGGCCTGG - Intronic
1193041793 X:77011688-77011710 AAAGTACTTAGCACAATGCCTGG + Intergenic
1193175313 X:78385289-78385311 AAATCACTAGGAACCAATCCTGG + Intergenic
1193311788 X:80018669-80018691 AAACCACTTAGGACAAAGCCTGG - Intronic
1193318550 X:80093546-80093568 AAAGAACTTAGAACAATGCCTGG + Intergenic
1194223949 X:91231428-91231450 AAATGGCTTATAACCAAGGCAGG + Intergenic
1195348005 X:103970391-103970413 AAAGCACTTAGAACAATGCCTGG + Intergenic
1195359437 X:104068450-104068472 AAAGCACTTAGAACAATGCCTGG - Intergenic
1195404181 X:104494643-104494665 AAATTACACAGAACTAGGCCGGG - Intergenic
1195715581 X:107815231-107815253 AAAGTGCTTAGAACAATGCCAGG + Intergenic
1195742221 X:108076394-108076416 AAAGTGCTTAGAACAGAGCCTGG - Intronic
1195798124 X:108675840-108675862 AAATTACTTAGCACAGTGCCTGG - Intronic
1195989360 X:110667379-110667401 AAATCACTTAGAGACCAGCCTGG - Intergenic
1196021067 X:110991550-110991572 AAAGTACTTATCACCATGCCTGG + Intronic
1197149745 X:123207317-123207339 AAATCACTTAGAAGGATGCCTGG - Intronic
1197997682 X:132396250-132396272 AAATCATTTAGAACCAAGGTCGG - Intronic
1198165934 X:134057048-134057070 CAAAGACTTAGAACCAACCCAGG - Intergenic
1198460078 X:136854856-136854878 AAAGTACTTAGAACAGAGTCTGG + Intronic
1198537304 X:137599360-137599382 AAATTACTTAGCACAGTGCCTGG - Intergenic
1198681608 X:139188896-139188918 ATAGTACTTAGGACAAAGCCTGG - Intronic
1199474048 X:148226816-148226838 AAAATGCTTAGAAACATGCCTGG + Intergenic
1199804115 X:151280825-151280847 AAATCACTTAGATCAATGCCTGG + Intergenic
1200412420 Y:2874366-2874388 AGTTTTCTTGGAACCAAGCCAGG + Intronic
1200560414 Y:4694809-4694831 AAATGGCTTATAACCAAGGCAGG + Intergenic
1200767999 Y:7097044-7097066 AAGTCACTCAGAACCAAGACTGG + Intergenic
1202301833 Y:23424070-23424092 AAACTACGCAGAACCATGCCTGG + Intergenic
1202568978 Y:26246528-26246550 AAACTACGCAGAACCATGCCTGG - Intergenic