ID: 905944476

View in Genome Browser
Species Human (GRCh38)
Location 1:41890187-41890209
Sequence AAATTACTTAGAACCAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 545
Summary {0: 1, 1: 0, 2: 6, 3: 52, 4: 486}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905944475_905944476 18 Left 905944475 1:41890146-41890168 CCTCATGGGTTGCTGTGTGGTTT 0: 1
1: 0
2: 4
3: 38
4: 235
Right 905944476 1:41890187-41890209 AAATTACTTAGAACCAAGCCTGG 0: 1
1: 0
2: 6
3: 52
4: 486
905944473_905944476 22 Left 905944473 1:41890142-41890164 CCTACCTCATGGGTTGCTGTGTG 0: 1
1: 0
2: 6
3: 39
4: 381
Right 905944476 1:41890187-41890209 AAATTACTTAGAACCAAGCCTGG 0: 1
1: 0
2: 6
3: 52
4: 486
905944472_905944476 23 Left 905944472 1:41890141-41890163 CCCTACCTCATGGGTTGCTGTGT 0: 1
1: 0
2: 0
3: 9
4: 189
Right 905944476 1:41890187-41890209 AAATTACTTAGAACCAAGCCTGG 0: 1
1: 0
2: 6
3: 52
4: 486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905944476 Original CRISPR AAATTACTTAGAACCAAGCC TGG Intronic