ID: 905944495

View in Genome Browser
Species Human (GRCh38)
Location 1:41890340-41890362
Sequence TAGGGTAGAAAAGATGCTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905944486_905944495 28 Left 905944486 1:41890289-41890311 CCTCCAAGGTACTTACAGCCTAA 0: 1
1: 1
2: 2
3: 30
4: 195
Right 905944495 1:41890340-41890362 TAGGGTAGAAAAGATGCTCGGGG 0: 1
1: 0
2: 1
3: 5
4: 95
905944487_905944495 25 Left 905944487 1:41890292-41890314 CCAAGGTACTTACAGCCTAAAGG 0: 1
1: 0
2: 1
3: 10
4: 126
Right 905944495 1:41890340-41890362 TAGGGTAGAAAAGATGCTCGGGG 0: 1
1: 0
2: 1
3: 5
4: 95
905944490_905944495 10 Left 905944490 1:41890307-41890329 CCTAAAGGGAGAAACAGAAAAGT 0: 1
1: 1
2: 21
3: 131
4: 872
Right 905944495 1:41890340-41890362 TAGGGTAGAAAAGATGCTCGGGG 0: 1
1: 0
2: 1
3: 5
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905944495 Original CRISPR TAGGGTAGAAAAGATGCTCG GGG Intronic
903742861 1:25568421-25568443 CAGGATGGAAAAGATGCTGGAGG - Exonic
905604722 1:39287544-39287566 TTGGGTAGAAGAGATGCAGGTGG + Exonic
905944495 1:41890340-41890362 TAGGGTAGAAAAGATGCTCGGGG + Intronic
907932813 1:59016014-59016036 TAGGATAGCAAAGAGGCTCTGGG + Intergenic
908186586 1:61658170-61658192 TAGGCTAGATAAGATGGTGGTGG + Intergenic
908881057 1:68733914-68733936 AAGGCTAGAAAAGATGCACATGG - Intergenic
911684422 1:100758326-100758348 GAGGGAACAAAAGATGCTTGAGG - Intergenic
913377572 1:118170680-118170702 GCGGGTAAGAAAGATGCTCGAGG + Intronic
915316801 1:155033365-155033387 TGGGGCAGAAGAGATGCTGGAGG - Intronic
919473597 1:198008825-198008847 TAGAGTGAAAAGGATGCTCGGGG + Intergenic
922465535 1:225843717-225843739 TAGGGTGGAAATGGTGGTCGTGG + Intronic
923039191 1:230307757-230307779 TTGGGTAGAGAGGATGCTCAGGG + Intergenic
923410202 1:233700595-233700617 TGGGGTAGAAAGGAGGCTGGGGG - Intergenic
1065069917 10:22012907-22012929 AAGGATTAAAAAGATGCTCGGGG - Intergenic
1072831893 10:98667112-98667134 TAGAATAGAAAAGATCCTCAGGG + Intronic
1075608240 10:123831805-123831827 TAGGGTAGAAAAGATTTTTCTGG - Intronic
1078587335 11:12603865-12603887 GAGGGGAGAAAAGATGTTAGTGG - Intergenic
1080297195 11:30743962-30743984 TAGGGTAGAAGAGGTAGTCGTGG + Intergenic
1082890877 11:58137385-58137407 GAGGGTAGAAGAGATGCTCAGGG - Intronic
1086253486 11:84846309-84846331 TGGGGTAGAAAAGAGGTTTGAGG - Intronic
1089918514 11:122183976-122183998 TAGGGTAGTAATGCTGCTTGGGG - Intergenic
1093082598 12:14830377-14830399 TAAGGTAGAAAAGATGTTTCTGG + Intronic
1097605198 12:61745366-61745388 AGGGGTAGAAATGATGCTTGTGG - Intronic
1102410821 12:112716744-112716766 TAGGGGAGGAAAGATGTTGGGGG + Intronic
1112302141 13:98240091-98240113 AAGGGTAGAAGAGATGATCAAGG - Intronic
1113244446 13:108378351-108378373 TAGGAAAGAAAAGATGATCTTGG - Intergenic
1113515345 13:110891615-110891637 TAAGGTAGAAAAGATGATGTTGG + Intronic
1119853107 14:77880143-77880165 TAGGGAAGAAAAGAAGCCAGGGG - Intronic
1120387501 14:83864626-83864648 TAGGGCAGAACACATGCTAGAGG - Intergenic
1130924708 15:88376195-88376217 TGGGGGAGAAAAGATGACCGGGG + Intergenic
1131901407 15:97092067-97092089 CAGGGCAGAAAAGATGATGGTGG - Intergenic
1133816410 16:9200787-9200809 AAGTGTAGAAAATGTGCTCGTGG - Intergenic
1143634950 17:8159281-8159303 AAGGGTAGGAGAGATGCTGGAGG - Exonic
1147500244 17:40956118-40956140 TAGAGCAGAAAAGGGGCTCGTGG - Intergenic
1154389749 18:13926197-13926219 CAGGTGAGAAAAGATGCTGGTGG + Intergenic
1155429160 18:25737597-25737619 CAGGGTAGAAAATATGCTAATGG - Intergenic
1155633446 18:27922545-27922567 TAGGGGACAAAAGAGCCTCGGGG - Intergenic
1159650657 18:70973895-70973917 TAAGTTAGAAAAGAAGCTCAAGG + Intergenic
1162606071 19:11709061-11709083 TTGGGAAAAAAAGATGCTAGAGG - Intergenic
1165313780 19:35042708-35042730 TAGGGTAGAAGGGAGGCTGGTGG - Intronic
1166929705 19:46294910-46294932 TGGGGTAGAAGAGATGTTCAAGG - Intergenic
927005485 2:18843789-18843811 TAGAGCTGAATAGATGCTCGAGG + Intergenic
930320269 2:49845409-49845431 TAGGGTTGAAAAGAGGGTGGAGG + Intergenic
931623290 2:64232432-64232454 TAAGGAAGAAAAGGTGCCCGAGG + Intergenic
937495631 2:122416267-122416289 CAGCGTATAAAAGATGCTCTAGG + Intergenic
941990429 2:171550696-171550718 TAGGGTAGTTAAGTTGCTCAGGG + Intronic
943137420 2:183932218-183932240 TAGGGTAGAAAGGAGGATTGAGG + Intergenic
945391641 2:209272610-209272632 TCATGTAGAAAAGATGTTCGAGG - Intergenic
947214347 2:227736430-227736452 AAGGGGAGCAAAGATGCTTGAGG + Intergenic
947709231 2:232301507-232301529 TAGGGTAGAAGAGAGGCTACCGG + Intronic
1169919590 20:10720450-10720472 TAGGTTAGAAAACCTGCTGGAGG - Intergenic
1169949868 20:11032111-11032133 TGGGGTATAAAGGATGCTTGAGG + Intergenic
1170451107 20:16484903-16484925 TAGAGAAAAAAGGATGCTCGTGG + Intronic
1172832015 20:37844013-37844035 TAGGGTAGAAAAGATGGAAACGG - Intronic
1175249581 20:57601133-57601155 TAGGGTGGAAATGGTGCTCTAGG - Intergenic
1182588431 22:31360479-31360501 TAGGTTACAAAAGATTCTAGAGG + Intergenic
1184403752 22:44288332-44288354 TCAGGTAGAAAAGCTGCTCCAGG + Intronic
1185021487 22:48379308-48379330 TCAGGAAAAAAAGATGCTCGTGG - Intergenic
950413513 3:12854675-12854697 TAGAGTGGAAAAGATGGTCAAGG - Intronic
957421558 3:79978317-79978339 TATGGTAGCAAAGATGCACCTGG - Intergenic
958747028 3:98148912-98148934 TAGTGTAGAAAATATGCTGCGGG - Intergenic
958750656 3:98191028-98191050 TAGTGTAGAAAATATGCTGTGGG - Intronic
963470654 3:145737626-145737648 TAGGACAGAAAATATGTTCGTGG + Intergenic
974846654 4:67359129-67359151 TAAGATAGAAAAGATGCACAGGG - Intergenic
976741286 4:88360207-88360229 GAGGGTAGAATTGATGCTAGTGG - Intergenic
977644371 4:99395551-99395573 AAGGGTAGAAAAGATAGTCATGG + Intergenic
979579923 4:122345733-122345755 CAGGAAAGAAAAGATGCTTGAGG + Intronic
981576892 4:146214866-146214888 TCAGGTAGACAAGATGCTAGTGG + Intergenic
984866467 4:184284397-184284419 TAGGGCAGAGAAGAAACTCGCGG - Intergenic
988233791 5:28512408-28512430 TAGGTTAGAAAAGTTGATCCAGG - Intergenic
989695356 5:44194144-44194166 TAGAGAAGAAAATATGCTCAAGG - Intergenic
990008199 5:50966541-50966563 GAGGGTAAAAAAGAAGCTAGAGG + Intergenic
991655144 5:68896487-68896509 TAAGGTAGAAGAGATGCCTGTGG - Intergenic
994724719 5:103420983-103421005 TTGGGTAGAATAGATTCTCCTGG - Intergenic
997926488 5:138035108-138035130 TAGGGTAGGAATGCTGCTGGAGG - Intronic
998469482 5:142372333-142372355 TTGTGTAGAATAGATGCTCCAGG + Intergenic
1001043915 5:168356592-168356614 TAAGGTAGAAAGGATCCTTGTGG - Intronic
1002761801 6:208291-208313 TAGAGTAGAAATGATGCTCTGGG + Intergenic
1002941185 6:1717561-1717583 AGGGGTAGAAAGGATGATCGTGG - Intronic
1009937642 6:70252296-70252318 TAGGGTAGCACAGGTGCTCCAGG - Exonic
1010950365 6:82030016-82030038 TAGGATAGGAAAGATGCTCTTGG - Intergenic
1012513746 6:100034345-100034367 TAGGCTAGAAATGATGCTTTTGG + Intergenic
1020605020 7:10326445-10326467 GAGGGCAGAAAAGATCCACGGGG + Intergenic
1027231216 7:76273826-76273848 TGGGCTAGAAAAGTTGGTCGGGG - Intronic
1027336162 7:77152728-77152750 TAGGCTGGAAAAGATGATCTGGG - Intronic
1028227724 7:88268400-88268422 TAGTGAAGAAAAGATGCTTGGGG - Intergenic
1028490549 7:91406661-91406683 TAGGGTAGAAAAAAGGCTCGAGG - Intergenic
1029779627 7:102718374-102718396 TAGGCTGGAAAAGATGATCTGGG + Intergenic
1030615572 7:111734749-111734771 AAGGTTAGAGAAGATGCTAGTGG + Intronic
1031169842 7:118279183-118279205 TAGGGTAAAAAGGAGGCTGGTGG + Intergenic
1032691973 7:134296205-134296227 GAGGGCAGAAGAGATGCTAGTGG - Intronic
1034468358 7:151242924-151242946 TAGGGTACAAAAGATGTCAGGGG + Intronic
1044776849 8:95698941-95698963 TAGGGTAGAATAGATCATGGGGG + Intergenic
1045950929 8:107850831-107850853 TATGGTGGAAAAGATGCTGGAGG + Intergenic
1052968446 9:34361153-34361175 TAGGGAAGAAAAGAGGCAGGAGG + Intergenic
1054822706 9:69539514-69539536 CAGGTAAGAAAAGATGCTGGTGG - Intronic
1059419770 9:114183571-114183593 TAGGGTGGAAAGGATGGTGGTGG + Intronic
1060270596 9:122137952-122137974 TATGGAAGAAAAGATGCTAAAGG + Intergenic
1188212717 X:27443720-27443742 TAGGGCAGAGAAGATGCCTGGGG + Intergenic
1192495583 X:71614870-71614892 CAGGGTAGTCAAGATGCTTGTGG - Intergenic
1193263620 X:79440842-79440864 TGGGGGAGAAAAGATGGTGGTGG + Intergenic
1195900238 X:109789938-109789960 TATGGTAGAAAAGATGATTCAGG + Intergenic