ID: 905946249

View in Genome Browser
Species Human (GRCh38)
Location 1:41903824-41903846
Sequence TAGGGATGCAAAGATGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905946249_905946253 4 Left 905946249 1:41903824-41903846 CCATCAGCATCTTTGCATCCCTA 0: 1
1: 0
2: 1
3: 21
4: 193
Right 905946253 1:41903851-41903873 CCATTTCCTGCCCAGCACACTGG 0: 1
1: 0
2: 3
3: 44
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905946249 Original CRISPR TAGGGATGCAAAGATGCTGA TGG (reversed) Intronic
901160978 1:7176626-7176648 TTGGGATAGACAGATGCTGAGGG + Intronic
902191546 1:14766636-14766658 TGGGAAGACAAAGATGCTGAGGG + Intronic
902383688 1:16064625-16064647 TTGGGTTGCCAGGATGCTGACGG - Intronic
902571383 1:17349081-17349103 TGGAGATGCAGAGATGCTGTTGG + Intronic
903752904 1:25640108-25640130 GAGGGATGCTAAGTAGCTGAAGG + Intronic
905946249 1:41903824-41903846 TAGGGATGCAAAGATGCTGATGG - Intronic
907545326 1:55254735-55254757 TAGGGATGCAAAGATTAAGCTGG + Intergenic
907821437 1:57973825-57973847 TAGGGAGGCAAGAATGGTGATGG - Intronic
907984895 1:59520995-59521017 TATGGATCCAAAGAGGCAGACGG + Intronic
908712708 1:67034985-67035007 TAGGGATGCAAGGATGGTTCAGG - Intronic
909493525 1:76252115-76252137 TAGTGATGCAGAATTGCTGATGG + Intronic
913185024 1:116363055-116363077 TAGGGATGCAGGGAAGCTGGAGG - Intergenic
913200910 1:116494723-116494745 TGGGGATGCACAGAGCCTGAGGG - Intergenic
915181343 1:154063380-154063402 TAGGGATCTAAAGTTGTTGAGGG + Intronic
915283940 1:154841085-154841107 TAGGGCTGCAGAGATGGTGAGGG + Intronic
915448196 1:155986722-155986744 GAGACATGCAAAGATGCTGATGG + Intronic
915855928 1:159386517-159386539 TTGGTATGCAAAGAGACTGATGG + Intergenic
915947678 1:160165892-160165914 AAAAGATGCAAAGATCCTGAGGG + Intronic
918349379 1:183637295-183637317 AAGAGATGGAAAGATTCTGAAGG + Intronic
919319924 1:196022933-196022955 TTGGGATCCAAAGAAACTGAGGG - Intergenic
919859640 1:201730941-201730963 TGGGGGTCCAAAGATGCTGAAGG + Intronic
920844842 1:209585038-209585060 TGGGGTTGCAAAGCTGGTGATGG + Intronic
923770029 1:236930462-236930484 TAGGGAGGGAAAGGGGCTGAGGG - Intergenic
1062905710 10:1178282-1178304 AAGGGAAGCGAAGAGGCTGAGGG + Exonic
1064517779 10:16169233-16169255 TAGGGATGCAATGTTGTTTATGG + Intergenic
1067178088 10:43964231-43964253 TAGGGATGGAAATATGCTCAGGG - Intergenic
1067552902 10:47247649-47247671 TATGGAGGCAGAGATGGTGACGG + Intergenic
1069065493 10:63937912-63937934 TAGTGATCCAAAGCCGCTGAGGG - Intergenic
1069278974 10:66629628-66629650 TGGGGATGGAAAGGTGATGATGG - Intronic
1069848739 10:71391291-71391313 TGGGGATGCAAAGACATTGAAGG + Intergenic
1070627701 10:78062947-78062969 AAGGGAAGGAAAGATGATGAGGG - Intergenic
1071382906 10:85087161-85087183 TAGGGATGCACACATGCCCAGGG + Intergenic
1073429964 10:103479472-103479494 TGGTGAGGAAAAGATGCTGATGG + Intergenic
1075329163 10:121560275-121560297 GCTGGAGGCAAAGATGCTGAGGG - Intronic
1077352156 11:2098006-2098028 AAGGGAGGCAGAGATGCTGGAGG - Intergenic
1078962960 11:16301004-16301026 TAGGGAAGAAAAGTTGATGAGGG - Intronic
1080450395 11:32374566-32374588 CAGGGCTGCAAAGTGGCTGAGGG - Intergenic
1083064718 11:59913057-59913079 AAGGGTTGAAAACATGCTGATGG - Intergenic
1083583616 11:63840325-63840347 GAGGGATCCAAAGACTCTGAAGG - Intronic
1084762609 11:71283478-71283500 TGGGGATTCAAAAATGATGAAGG - Intergenic
1085733715 11:79021018-79021040 CAGGGATGCAAAGATGAATAAGG - Intronic
1087200415 11:95339097-95339119 AAAGGATCTAAAGATGCTGAAGG + Intergenic
1088609341 11:111562377-111562399 AAGGGAAGGGAAGATGCTGAGGG - Intergenic
1089201712 11:116728526-116728548 TGGGGATGCAAAGCTGCAGATGG - Intergenic
1090487612 11:127127984-127128006 TAGTGGTGCAAAGCTTCTGAGGG - Intergenic
1095223537 12:39650352-39650374 CAGGTAAGCAAAGATGCTGAAGG + Exonic
1096899479 12:54860123-54860145 AAAGGATTCAAAGGTGCTGAAGG - Intergenic
1099097947 12:78399234-78399256 TAGAGATGTAAAGAACCTGAGGG - Intergenic
1100025353 12:90121787-90121809 GAGGAATGCACAGATGCTGGTGG + Intergenic
1101027328 12:100623934-100623956 TTGGGATGAGAAGATGCTGCTGG - Exonic
1106818911 13:33441193-33441215 CAGGGATGAAAAGAAGCAGATGG - Intergenic
1106846837 13:33745873-33745895 GAGTGTTTCAAAGATGCTGATGG + Intergenic
1106865370 13:33958796-33958818 TAGGGCAGCCAAGATGCAGAGGG - Intronic
1106882326 13:34144983-34145005 TTGGGGTGCAAAGAGGGTGAAGG - Intergenic
1107051107 13:36050827-36050849 TCAGGATTCAAAGATGCTCAAGG + Intronic
1108147199 13:47491081-47491103 TGAAGATGCAAAGATGCAGAAGG - Intergenic
1110162203 13:72392075-72392097 TACCGTTGCAAAGATGCTTATGG - Intergenic
1112367883 13:98771446-98771468 TGGGGATGTGAAGAGGCTGAGGG - Intergenic
1112671198 13:101641119-101641141 TTAGGATGCAAACATGCTGATGG + Intronic
1112712831 13:102150164-102150186 TCGAGATTCAAAGATGCTAAGGG - Intronic
1114592315 14:23877392-23877414 TAGGGATGGCTAAATGCTGAAGG + Intergenic
1116647867 14:47552594-47552616 CAGGGGTGAAAAGATGGTGATGG - Intronic
1118709502 14:68508108-68508130 AGGGGACCCAAAGATGCTGATGG + Intronic
1120074735 14:80142762-80142784 TAGGAATGGACAGATGATGAAGG - Intergenic
1121232764 14:92369921-92369943 TAAGGAGGAAAAGATACTGATGG + Intronic
1121504492 14:94466179-94466201 TAAGGATGAAGAGATGCTGCAGG - Intronic
1122292642 14:100687866-100687888 GAGGGATGGAGAGATGATGACGG - Intergenic
1122292647 14:100687894-100687916 GAGGGATGGAGAGATGATGACGG - Intergenic
1122292658 14:100687950-100687972 GAGGGATGGAGAGATGATGACGG - Intergenic
1122292663 14:100687978-100688000 GAGGGATGGAGAGATGATGACGG - Intergenic
1122984138 14:105204448-105204470 CCTGGATGCACAGATGCTGAGGG - Intergenic
1125979952 15:43991387-43991409 TATGGATGCACCGATGCTGTGGG - Intronic
1126386341 15:48097258-48097280 TAGGGATGCTGAGAGGCTCAGGG - Intergenic
1128321047 15:66694577-66694599 TAGGGGTGCAGAGATGAGGAGGG + Intergenic
1131121171 15:89824136-89824158 CAGGGAGGCAAAGAGCCTGATGG - Intergenic
1131602465 15:93863398-93863420 GGGTGATGCAAAGATTCTGAGGG + Intergenic
1132199936 15:99944343-99944365 CAGGGATGGAAAGGTGCTGAGGG + Intergenic
1138381526 16:56606243-56606265 CAGGGATGCAAACATGCACATGG + Intergenic
1140137691 16:72222306-72222328 TTGGAATGAAAAGAAGCTGAGGG - Intergenic
1140496451 16:75393415-75393437 CAGGGCTGCAAAGATGGGGAAGG + Intronic
1143413380 17:6726457-6726479 GAAGGAGGAAAAGATGCTGATGG + Intergenic
1144382340 17:14714581-14714603 TAGTGATTCAAAGGTGCTGCTGG - Intergenic
1145268707 17:21392908-21392930 TGGAGATGCACAGATGGTGAGGG + Intronic
1146581772 17:34044832-34044854 ATGGGATGCCAAGATGATGAGGG - Intronic
1146709069 17:35025091-35025113 TAGGGAGGCAGAGATGAAGAAGG - Intronic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1149647666 17:58252084-58252106 TCTGGATGCAAAGATGCTGATGG - Intronic
1152370973 17:79888414-79888436 TAGAGAAGCAGAGATGCAGAGGG - Intergenic
1155344969 18:24848857-24848879 TAGGGAAGAACAGATGTTGAGGG - Intergenic
1156150791 18:34240421-34240443 TAGGGATGCATAAATTCTCATGG + Intergenic
1157758719 18:50242776-50242798 GAGGGATGCAAAAAGGATGAAGG - Intronic
1160225189 18:77006603-77006625 TGGGGAAGCAAGGATTCTGAGGG - Intronic
1160435440 18:78848684-78848706 TACGGATACAAAGATGTTGATGG - Intergenic
1164867493 19:31616978-31617000 CAGGGATGAAAAGATGAGGATGG - Intergenic
1166595112 19:44040733-44040755 TATCGATGCAAGTATGCTGATGG - Intergenic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1167108612 19:47446055-47446077 GAGAGATGCAGAGATGCAGAGGG + Intronic
1167576371 19:50319937-50319959 GAGGGAGGCAGAGATGTTGATGG + Intronic
1167965514 19:53142379-53142401 TATCAATGCAGAGATGCTGAAGG - Exonic
925759303 2:7168953-7168975 TATGGAACCAAAGGTGCTGAGGG + Intergenic
926621947 2:15054632-15054654 GAAGGATACAGAGATGCTGATGG - Intergenic
929604992 2:43227684-43227706 TGGGGCTGCACAGACGCTGATGG + Intergenic
931510396 2:62985510-62985532 TAGGAATGCAGAGATACTGGTGG - Intronic
932563361 2:72890941-72890963 TCGGGATGTGTAGATGCTGAAGG + Intronic
933215910 2:79629717-79629739 GAGGGAGGAAAGGATGCTGAAGG + Intronic
934497837 2:94824922-94824944 CAGTGTTGCAAAGATGCTGCAGG + Intergenic
935347882 2:102125250-102125272 TCTTGATGCAAAGATGATGAAGG - Intronic
935656547 2:105428482-105428504 CAGGGATGGAAAGATCCCGAAGG - Intronic
935695080 2:105764251-105764273 TGCGGATGCAAAGGTGCTGAAGG - Intronic
935817475 2:106860135-106860157 AAGGGATGCAAACATGCTGGAGG - Intronic
935925026 2:108058715-108058737 CAGGGAGGCAAAGAGGCTGGAGG + Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938692617 2:133806230-133806252 TGCTGATGCAAAGATGCTTATGG - Intergenic
939398959 2:141667042-141667064 TAGAGAGGCAAAGTTCCTGAGGG + Intronic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
943371656 2:187023477-187023499 GAGGGGTGAACAGATGCTGATGG - Intergenic
944021430 2:195109788-195109810 AGGGAATGCAAACATGCTGAAGG - Intergenic
944129790 2:196335414-196335436 TAAATATGCAAGGATGCTGATGG + Intronic
944331213 2:198468501-198468523 TGGGAATGCAAAGAGGCTTAAGG - Intronic
946202802 2:218080743-218080765 GAGGGAGGGAAGGATGCTGATGG - Intronic
946234004 2:218311159-218311181 TGGGGAGGCAAATAGGCTGAAGG - Intronic
946478354 2:220030457-220030479 TAGGGATGCTAGGCTACTGAAGG + Intergenic
947405236 2:229769268-229769290 TTGGGATGCAAAGACACTGATGG - Exonic
947790842 2:232868117-232868139 TAGGGATCAAAACATTCTGATGG + Intronic
1169046109 20:2535816-2535838 CAGGGAGGAAAAGCTGCTGAGGG + Intergenic
1171568718 20:26223756-26223778 TAAGGAAGAAAAGTTGCTGATGG + Intergenic
1172184642 20:33023717-33023739 TAGGTATGCAAAGAGGTTGCTGG - Intergenic
1173124981 20:40328293-40328315 TTGGGGTGCAAAGTTGCTTAGGG - Intergenic
1175016360 20:55795416-55795438 TAAGGAAACAAAGATGATGAGGG + Intergenic
1178720234 21:35002297-35002319 TGGGGGTGCAAAGCTGGTGAAGG - Intronic
1183594024 22:38798909-38798931 ATGGGATGCAAAGATGAAGAGGG - Intergenic
1184920168 22:47600515-47600537 CAGGGATGCACAGAGGCTGGGGG - Intergenic
1184938863 22:47746140-47746162 TAGAGAAGCAAAGATGATGATGG - Intergenic
949796210 3:7854105-7854127 TAGGGAGGAGAAGCTGCTGAAGG + Intergenic
950111953 3:10424460-10424482 TAGGGATGCCAAGCACCTGAAGG + Intronic
951278957 3:20723716-20723738 GAGGGTTGCAAAAATACTGAAGG - Intergenic
954218173 3:49135912-49135934 AAGGGATGTAAAGGAGCTGAGGG + Intergenic
954285519 3:49616382-49616404 TAGGGATGGGCAGATGCTGTGGG - Intronic
955548104 3:60053349-60053371 TAGGGACACAAAGATGCAAAAGG - Intronic
957110129 3:75944596-75944618 TAAGGAAGAAAAGTTGCTGATGG - Intronic
961054302 3:123774936-123774958 TGGGGATGCAAAGAAGGTTAAGG + Intronic
961487452 3:127226976-127226998 TAGGGAACCCCAGATGCTGAAGG + Intergenic
961816181 3:129551627-129551649 TCGGGATGCAAAGGGGCTGATGG + Intergenic
963353784 3:144184899-144184921 TATGCAGGCAAGGATGCTGAAGG - Intergenic
963702601 3:148644970-148644992 TTGGGATTCAAAGATGCAGTGGG - Intergenic
963853830 3:150234019-150234041 TAGGGATGCCAACATGTTGTTGG - Intergenic
963899671 3:150721996-150722018 TGGGGATGCAAAGGTGAAGATGG - Intergenic
964055633 3:152452728-152452750 TAGGTAAGCAAAAATGGTGATGG - Intronic
966470775 3:180286447-180286469 GAGGGATTTAAAGATGTTGAGGG + Intergenic
967755470 3:193163490-193163512 TGGGGATGCAAAGATGGGGAAGG + Intergenic
967888133 3:194346937-194346959 TAGGGGAGCAGAGATTCTGAGGG + Intronic
968901776 4:3435469-3435491 CAGGCCTGCAAAGCTGCTGAGGG + Intronic
969119786 4:4899682-4899704 GAGGCATGCAAGGATGCTGCGGG + Intergenic
972865708 4:43229518-43229540 AAGGGATGAAATAATGCTGAAGG + Intergenic
972944265 4:44234772-44234794 TAGGAATGTAAAGACCCTGAGGG - Intronic
975508165 4:75162299-75162321 TTGGGATGCCAAAAAGCTGAAGG + Intergenic
976492403 4:85686958-85686980 TAGGGATACAAAGAAGTTAATGG - Intronic
978349760 4:107809259-107809281 CAGGGAAGCAAAGATGATCACGG + Intergenic
982289746 4:153767578-153767600 TAGAGATGCCAAGATGTGGATGG + Intergenic
983265988 4:165508548-165508570 TAGAAATGCAAAGATGCCGCTGG + Intergenic
983518755 4:168684733-168684755 TAGAGATGCTAGGATGCTAATGG - Intronic
983643443 4:169965690-169965712 TGAGGATGCATAGATGCTCAAGG + Intergenic
985045757 4:185938917-185938939 AAAGGATGCAAATGTGCTGATGG + Intronic
992162221 5:74014714-74014736 TGGGGATGCCAAGATGCCTAAGG - Intergenic
993413964 5:87602456-87602478 AAGGGTTGCAAAGATCCTGTGGG + Intergenic
995725749 5:115179357-115179379 TAGGGAGGGGAAGATGCTGGAGG - Intronic
995782937 5:115797159-115797181 TGGCAATGCAAAGATGGTGAAGG + Intergenic
1000893551 5:166827770-166827792 TGGGGATGCAAAGATTTAGATGG + Intergenic
1003039514 6:2674038-2674060 TAGGGATGGGAAGATCCTGGTGG + Intronic
1003905510 6:10695527-10695549 TGGAGATGCAAAGATGCTGGAGG + Intronic
1007617973 6:43193314-43193336 TTGGAATGGAAAGATGCAGATGG + Intronic
1011784666 6:90830498-90830520 TAGGGATGCATTGAGGCAGATGG + Intergenic
1014198392 6:118583513-118583535 TGGGGCTGTAAAGATGCTGCAGG - Intronic
1014515302 6:122370418-122370440 TAGCTATGCAAAGATGCTAAGGG + Intergenic
1015114652 6:129634656-129634678 TAGGGAGGGAAAGATGGGGAAGG + Intronic
1016620485 6:146103771-146103793 CAGGGATGCAGAGATGATTAAGG + Intronic
1016676614 6:146777685-146777707 TTAGGATTCAAAGAAGCTGAAGG - Intronic
1016792201 6:148077714-148077736 CTGGGATGCAGAGATGCTGGTGG + Intergenic
1018219608 6:161565171-161565193 GAGGGAGGCTAAGAAGCTGAGGG - Intronic
1021805418 7:24349825-24349847 TAGGGTGGCAAAGGTGCGGATGG + Intergenic
1022423635 7:30246941-30246963 AAGGGAAGCAAAGATGGAGACGG - Intergenic
1022966771 7:35481443-35481465 TAGAAATAGAAAGATGCTGAAGG - Intergenic
1024243108 7:47450562-47450584 TAGGGAGGCAGAGATGCTAAGGG - Intronic
1030471726 7:109972536-109972558 TAGGGTTGTAAATATGCTAAAGG - Intergenic
1030597416 7:111556659-111556681 GAAAGATGTAAAGATGCTGAAGG - Intronic
1030869096 7:114733609-114733631 TAGGGATGTGAAGATGCAGTGGG + Intergenic
1036015592 8:4780156-4780178 TAGGTTGTCAAAGATGCTGAAGG - Intronic
1038372255 8:27006123-27006145 TAGTGATTCACAGATTCTGAGGG - Intergenic
1040385774 8:46914158-46914180 GAGGGAAGCAGAGGTGCTGAGGG - Intergenic
1040559707 8:48513817-48513839 AAAGGAGGCAAAGATGCTGGAGG - Intergenic
1042649769 8:71026421-71026443 TAGGGATACAAAGATACATAAGG + Intergenic
1044014240 8:87031211-87031233 TAAGGATGGAAAAATGGTGAAGG + Intronic
1044915683 8:97110735-97110757 TGGGGGTGCAGAGATGATGAAGG - Intronic
1045045525 8:98272320-98272342 TGGGGATGCAAAGATGAGTAAGG - Intronic
1046911240 8:119630083-119630105 TAGGGAAGAAATGATGATGAAGG - Intronic
1049149429 8:141024904-141024926 GAGGGATGGACTGATGCTGATGG + Intergenic
1049210704 8:141385212-141385234 TAGGGATGCAACAATGCAGAGGG - Intergenic
1050307006 9:4314926-4314948 CAGGGATTCAGAGCTGCTGAGGG + Intronic
1051158662 9:14180847-14180869 TAGGCAAGCAAAGAGGCTGCTGG - Intronic
1051505991 9:17828336-17828358 TAGAAATGCATAGTTGCTGAAGG - Intergenic
1052671046 9:31557710-31557732 TAGGGATACAAGGAAGCTAATGG - Intergenic
1053294022 9:36900475-36900497 TAAGGATGTTAAGATGCTCAGGG - Intronic
1053516713 9:38736346-38736368 AAGAAATGCAAAGATGCTGAAGG - Intergenic
1059517659 9:114910716-114910738 TAAAGATGCAAATATGCTCAAGG + Intronic
1059896634 9:118873447-118873469 TAGAGATGCAAAAATGATTAAGG + Intergenic
1060270596 9:122137952-122137974 TATGGAAGAAAAGATGCTAAAGG + Intergenic
1061871036 9:133520667-133520689 CAAGGAAGCACAGATGCTGAAGG - Intronic
1062036349 9:134384304-134384326 TTGGGGTTCAAAGATGATGAGGG - Intronic
1188551508 X:31369578-31369600 TAGGGAGGGAAAAATGTTGAGGG + Intronic
1189012818 X:37063460-37063482 TAAGACTGCAAAGATGCAGAAGG - Intergenic
1191865678 X:65701909-65701931 TAGGGAGGCCAAGGTGCAGAGGG + Intronic
1198911496 X:141620039-141620061 TGGGGATGCAGAGAGGCTGAAGG - Intronic
1199070946 X:143474955-143474977 TAAGGATACAAAGATGCATAAGG - Intergenic