ID: 905947544

View in Genome Browser
Species Human (GRCh38)
Location 1:41916763-41916785
Sequence CCTGCTGAGCAGCCAGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 184}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905947544_905947553 22 Left 905947544 1:41916763-41916785 CCCTACACTGGCTGCTCAGCAGG 0: 1
1: 0
2: 1
3: 25
4: 184
Right 905947553 1:41916808-41916830 TGGCCTATTACCTTGGCTTCAGG 0: 1
1: 1
2: 2
3: 16
4: 140
905947544_905947547 -5 Left 905947544 1:41916763-41916785 CCCTACACTGGCTGCTCAGCAGG 0: 1
1: 0
2: 1
3: 25
4: 184
Right 905947547 1:41916781-41916803 GCAGGACCATGAAGAACAGCTGG 0: 1
1: 0
2: 4
3: 47
4: 224
905947544_905947548 -4 Left 905947544 1:41916763-41916785 CCCTACACTGGCTGCTCAGCAGG 0: 1
1: 0
2: 1
3: 25
4: 184
Right 905947548 1:41916782-41916804 CAGGACCATGAAGAACAGCTGGG 0: 1
1: 0
2: 4
3: 29
4: 255
905947544_905947550 2 Left 905947544 1:41916763-41916785 CCCTACACTGGCTGCTCAGCAGG 0: 1
1: 0
2: 1
3: 25
4: 184
Right 905947550 1:41916788-41916810 CATGAAGAACAGCTGGGACCTGG 0: 1
1: 0
2: 2
3: 26
4: 284
905947544_905947551 15 Left 905947544 1:41916763-41916785 CCCTACACTGGCTGCTCAGCAGG 0: 1
1: 0
2: 1
3: 25
4: 184
Right 905947551 1:41916801-41916823 TGGGACCTGGCCTATTACCTTGG 0: 1
1: 0
2: 0
3: 5
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905947544 Original CRISPR CCTGCTGAGCAGCCAGTGTA GGG (reversed) Intronic
904568812 1:31445355-31445377 TCTGCTGAGCAGCCAGAGGGCGG + Intergenic
905547928 1:38814701-38814723 TCGGCTGAACAGCCTGTGTAAGG + Intergenic
905947544 1:41916763-41916785 CCTGCTGAGCAGCCAGTGTAGGG - Intronic
906283441 1:44569694-44569716 CCTGCTGAGAAGCCAGGGTCTGG + Intronic
907271469 1:53293936-53293958 CCTGGTGAACACCCAGTGTCAGG + Intronic
908484408 1:64576437-64576459 CTTGCTGAGCAGCCTGGGTTTGG + Intronic
909349186 1:74629621-74629643 CCTGCTGGACATCCAGTGTCTGG + Intronic
913449980 1:118986664-118986686 CCTGCTGAACAGCCAGAGCTGGG - Intronic
917155935 1:171999032-171999054 TGGGCTGAGCAGCCAGTGGAGGG + Intronic
917643820 1:177009707-177009729 CCTCCAGAGCAGGCAGTGTAAGG + Intronic
918362212 1:183771044-183771066 TCAGCTGAGCAGCCAGGATAAGG - Intronic
920455510 1:206098152-206098174 CCTGCTGAGCAGGTAGTTGATGG - Exonic
921699577 1:218252866-218252888 CAAGCTGAGTAGCCAGTGCATGG + Intergenic
921762355 1:218930720-218930742 CCTGCTCAGCTGTCAGTGTTTGG + Intergenic
923091029 1:230741449-230741471 CCTGTGGAGCAGCGAGTGTGGGG + Intergenic
1063460375 10:6211808-6211830 CCTTCTCAGCAGGCAGAGTAAGG - Intronic
1064226914 10:13494542-13494564 TCTGCTGTGCAGCCAGAGTTGGG + Intronic
1064280155 10:13944145-13944167 CCTGCTGTGCAGCCAGTCTGTGG - Intronic
1067387144 10:45826586-45826608 CCAGCTGACCAGCCAGAGCAAGG - Exonic
1067590250 10:47502739-47502761 CCAGCTGACCAGCCAGAGTGAGG - Exonic
1067637371 10:48010841-48010863 CCAGCTGACCAGCCAGAGTGAGG - Intergenic
1070816230 10:79325256-79325278 CCTGCTGACAAGCCTGTCTAGGG - Intergenic
1071067079 10:81648387-81648409 ACTGTAGGGCAGCCAGTGTAAGG - Intergenic
1071607747 10:87009212-87009234 CCAGCTGACCAGCCAGAGTGAGG + Intergenic
1072605546 10:96979070-96979092 ACTGCTCAGAAGCCAGTGGAGGG + Intronic
1072685145 10:97532140-97532162 CCGGGAGAGCAGCCAGTGGAGGG + Intronic
1075799935 10:125147320-125147342 CCTGATGGGCAGCCAGGGTGGGG - Intronic
1076294370 10:129373342-129373364 ACAGATGAGCAGCCAGAGTACGG + Intergenic
1078296770 11:10078854-10078876 CCTCCTGAGTAGCCAGGGTGTGG - Intronic
1081872845 11:46391262-46391284 CCTGCTGAGCCGCCAGTGGGAGG + Intergenic
1082709864 11:56541613-56541635 CATTCTGAGCCTCCAGTGTATGG - Intergenic
1084322866 11:68383428-68383450 CCTGCTTAACAGCCACTGTGGGG - Intronic
1085280238 11:75325272-75325294 CATTCTGGGCAGCCAGAGTAGGG - Intronic
1086739725 11:90352378-90352400 CTTGGTGTGCAGCCTGTGTATGG + Intergenic
1087105581 11:94403677-94403699 CCTGCTGGGAAGCCAGTGTAAGG + Intergenic
1087134737 11:94705175-94705197 TCTGCTGAGCACCTACTGTATGG + Intergenic
1089002885 11:115067040-115067062 CCTCAGGAGCAGACAGTGTACGG - Intergenic
1090892616 11:130939084-130939106 CCTGCTTTGCTGCCAGGGTATGG - Intergenic
1092490924 12:8944243-8944265 CCTGCTGCTCAGCAATTGTATGG - Intronic
1093971722 12:25382173-25382195 CCTGTGGAGCTGCCAGTCTAGGG + Intergenic
1094471650 12:30807189-30807211 TCTGCTCAGCACCAAGTGTACGG + Intergenic
1096255443 12:50059285-50059307 GCTGCTGAGCACCCAGTTAAGGG + Intronic
1098035916 12:66302232-66302254 CCTGCAGAACCGCCAGTGCACGG - Intergenic
1100206948 12:92360523-92360545 CCTGCAGAGCAGCTAGAGAAAGG + Intergenic
1101355862 12:103977039-103977061 CCTGCTCAGGAACCAGTGCAAGG + Exonic
1103852967 12:123945403-123945425 CGTGCTGTGCAGACAGTGTTGGG - Intronic
1103959998 12:124603456-124603478 ACTGATGAGCAGCCAGGGCAGGG + Intergenic
1106083468 13:26519738-26519760 CCTGCAGAGCAGCCACTGGGAGG - Intergenic
1107559648 13:41547661-41547683 CTTGCTGAGCAGGCAGTGAAAGG - Intergenic
1111069461 13:83145676-83145698 CCTGCTGAGCATCCAGGAGAAGG + Intergenic
1111269022 13:85855317-85855339 CCTGTTGAGGAGACAGTGCAGGG - Intergenic
1121638029 14:95466818-95466840 GCTGCTGGGAAGCCAGTCTAAGG - Intronic
1121638415 14:95469192-95469214 GCTGCTGGGAAGCCAGTCTAAGG - Intronic
1122771114 14:104098418-104098440 CCTGCTCAGGAGCCCGTGTGGGG - Intronic
1124407610 15:29405665-29405687 CCTGCTGAGCAGCCAAAGGCAGG - Intronic
1125040675 15:35183288-35183310 CCTGCTGAGAAGGAAATGTAGGG - Intergenic
1125538459 15:40456289-40456311 CCTGCTGAGCAGACAGGGACGGG + Intronic
1128557746 15:68643230-68643252 CCTGATGAGGAGCCAGTGCTTGG + Intronic
1129328888 15:74816674-74816696 CCCTCTGAGCAGCCTGGGTAAGG + Exonic
1129509171 15:76108014-76108036 GCTGCTGGGTAGCCAGAGTAAGG - Intronic
1130171159 15:81516093-81516115 CCTGATGAGCAGCCAGGTTTAGG + Intergenic
1131252527 15:90839779-90839801 CCCGCTGACCATCCAGTGCAGGG + Intergenic
1134690949 16:16190843-16190865 CGTGCTGAGCAGGCAGAGGATGG + Intronic
1135407001 16:22206087-22206109 CCTGCTGAGTACACAGTGTCCGG - Intergenic
1135982789 16:27161432-27161454 CCTTCTGGTCAGCCAGTATATGG - Intergenic
1139432717 16:66919678-66919700 ACTGTTGAGTGGCCAGTGTAAGG - Intergenic
1140188248 16:72793390-72793412 GCTGCTGAGCTGCCAGTCCAAGG + Exonic
1141436329 16:84001828-84001850 CCTGCAGAGCCCCCTGTGTAAGG + Exonic
1141711535 16:85702274-85702296 GCTGCTAAGCAGGCAGTGGAGGG + Intronic
1143939572 17:10526030-10526052 ACTGCTGCGTAGCCAGTGTCTGG - Intronic
1145283651 17:21487517-21487539 CCTGAAGAGCAGCCAGTCTGCGG + Intergenic
1145393798 17:22477982-22478004 CCTGAAGAGCAGCCAGTCTGTGG - Intergenic
1146774097 17:35596841-35596863 CCTGCTGGGCGGCCTGTGTGCGG - Intronic
1149591310 17:57831827-57831849 CCTGGTGGTCTGCCAGTGTATGG - Intergenic
1150594223 17:66590108-66590130 CCTGCCCAGCTGCCAGTGTATGG - Intronic
1150951382 17:69805627-69805649 CCCGTTAAGCAGCCAGTGTTTGG + Intergenic
1151389221 17:73774524-73774546 TCTTCTGAGCAGCCAGTCTGTGG + Intergenic
1151965652 17:77429942-77429964 CCTACAGGGAAGCCAGTGTAAGG - Intronic
1152342776 17:79734338-79734360 CCTGCTCACCAGCCGGTGGAAGG - Intronic
1152880425 17:82811673-82811695 CATGCTGAGCACCCAGCGAAAGG - Intronic
1152928543 17:83098866-83098888 CCTGCTGAGGGGCCAGAGTCCGG + Intergenic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1157339375 18:46765751-46765773 CTTGGTGAGCAGAGAGTGTAGGG - Intergenic
1158407001 18:57168650-57168672 CCTGCTGGGCAGCCATTATCTGG + Intergenic
1160187934 18:76689920-76689942 CCTGCTTAGCAGCTAGTTTTTGG - Intergenic
1160501969 18:79406091-79406113 CTGGCTGAGCAGCCAGTTCAGGG + Intronic
1160800279 19:964469-964491 CACTCTGAGCAGCCAGTGCAAGG + Intronic
1161057059 19:2195946-2195968 CCTGCTGAGGAGACAGTGAGGGG - Intronic
1161086873 19:2339500-2339522 CCTGCTGAGCCGCCTGGGTCTGG + Intronic
1163684143 19:18701127-18701149 CCGGCTGAGCCGGCAGTGAAGGG - Intronic
1166917635 19:46206349-46206371 CCTGGAGAGCAGCCAGTGCCAGG - Intergenic
1167868970 19:52351658-52351680 CCTGCTCTGCAGCCTGTGTGAGG + Intronic
925448647 2:3950399-3950421 CCTGCAGAGCCGCCAGTGAAGGG + Intergenic
926059362 2:9795545-9795567 CCTGCTGAGCAGCCAGCATGAGG - Intergenic
927685038 2:25164667-25164689 CCTGGAGAGCAGCCAGTGTCAGG - Exonic
928358958 2:30647807-30647829 CCGGCTGAGAGGCCAGTGTATGG + Intergenic
928437098 2:31261760-31261782 CTGGCTGAGCAGCCTGAGTATGG + Intronic
928603838 2:32926277-32926299 GCTGCTGAGCACCCACTATAAGG + Intergenic
932107129 2:68954250-68954272 CCCACTGAACAGCCAGGGTAGGG - Intergenic
932357191 2:71076593-71076615 CCTGCTGAGCACCTGGGGTAGGG - Exonic
933081522 2:77993742-77993764 CCTGGTAAGCAGCCAGTTTATGG - Intergenic
933989230 2:87621760-87621782 CCTGATGAGCATCCAGTGGAAGG - Intergenic
934090873 2:88549655-88549677 CCTGCTGGGCAGCCAGAGGGTGG - Intergenic
936304613 2:111329066-111329088 CCTGATGAGCATCCAGTGGAAGG + Intergenic
937389769 2:121474762-121474784 CATACTGAGCAGCCAATGTAGGG + Intronic
939362402 2:141189862-141189884 CCTGGGGAGCAGCCAATGCAGGG + Intronic
939562533 2:143749934-143749956 CCTGGTGTGCAGCCAGGGTTAGG - Intronic
940345270 2:152622138-152622160 CCTGCTCAGCAGCCTGTCTCAGG - Intronic
941139993 2:161768286-161768308 CAGGCTCAGCAGCCAGAGTAGGG - Intronic
942399057 2:175581660-175581682 CCTGCTGTGTAGCCAGGGCAAGG - Intergenic
946054212 2:216886825-216886847 CATCCTGGGCAGCCAGTGTAGGG - Intergenic
946690653 2:222306259-222306281 CCGGCTGAGCAGCCAGTGCCAGG - Intergenic
946818198 2:223602136-223602158 GCTGCTCATCAGCCAATGTAAGG - Intronic
948422848 2:237871124-237871146 ACCTCTGAGCAGCCAGTGCAGGG - Intronic
948775258 2:240284691-240284713 CCAGCTGAGCAGCCTGGGTGGGG - Intergenic
1176121782 20:63457370-63457392 CCAGTTGAGCACCCAGTGTTTGG - Intronic
1179790565 21:43753804-43753826 CCTGCTGAGCTGACAGGGCATGG + Intronic
1180674933 22:17580706-17580728 CCTGCGGAGGAGCCAGAGGACGG + Intronic
1181684917 22:24521786-24521808 CCTGCTGAGCAGCCAGCCCTGGG - Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1184285436 22:43468466-43468488 CCTGATGAGTAGACAGTTTAGGG - Intronic
1184807419 22:46804058-46804080 GCTGCTGAGCTGCCATTGGATGG - Intronic
1184892984 22:47390741-47390763 CCTGCTGAGCAGCAGGTGGAGGG - Intergenic
1185119693 22:48958581-48958603 CCTGCCCAGCAGCCAGAGGAGGG - Intergenic
950370192 3:12522881-12522903 GCTGCTGAGTAGGGAGTGTAAGG - Intronic
953934140 3:47025113-47025135 CCTGCCTAGCAGCCACTGCAGGG + Intronic
954148226 3:48644871-48644893 GCTGCTGACCAGCCCATGTATGG + Intronic
954330186 3:49885679-49885701 CCCCCTCAGCAGTCAGTGTAGGG + Intergenic
954694060 3:52410840-52410862 CCTGCCGGGCGGCCAGTGCAGGG - Exonic
955596118 3:60592581-60592603 CCTGCTGCCCAGGCAGTGAATGG - Intronic
956312607 3:67897938-67897960 CCTGCTGAGCAGCGAGCCCACGG - Intergenic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
966532526 3:180996684-180996706 CCTGCTGAGCTGTCAGCGAATGG + Intergenic
969869562 4:10096149-10096171 CCTGCTGAGCACCCTGTGCTGGG + Intronic
969993623 4:11289859-11289881 CCTGTTGAGGAGCCAGGGAAAGG + Intergenic
971611325 4:28730595-28730617 CCTGCTGAGCCCCTAGGGTATGG + Intergenic
972120365 4:35694304-35694326 CTGACTCAGCAGCCAGTGTATGG - Intergenic
981751579 4:148097427-148097449 GCTGCTGAGCTGCCCCTGTAGGG + Intronic
984902311 4:184596194-184596216 CCTTGTGAGCAGCCCGTGTAGGG - Intergenic
986316558 5:6592793-6592815 TCTGCTGAGCTGTCAGTGTCAGG - Intergenic
990312608 5:54554044-54554066 CCTGGTGAGCAGGCAGAGCATGG - Intergenic
992457169 5:76926497-76926519 CCTGAGGAGCAGCCAGTCCAGGG - Intergenic
993835757 5:92818246-92818268 CCTTCTCAGAAGCCACTGTAAGG + Intergenic
995851563 5:116551624-116551646 CCTGCAGAGAAGCCAGTGCCTGG - Intronic
995868769 5:116722876-116722898 CCTCCACAGCAGCCAGTCTAGGG + Intergenic
998108311 5:139482220-139482242 CATCCAGAGCAGCCAGTGTCCGG - Exonic
998558317 5:143147503-143147525 CCAGCTGAGCTCCCAGTTTAGGG - Intronic
998898031 5:146821054-146821076 CCTGGTGAGAAGCCAGGGTGTGG - Intronic
999287896 5:150405076-150405098 CCTGCTGACCTTCCAGTCTATGG + Exonic
1001028501 5:168244535-168244557 GCTGCTGGGCAGCCAGAGGAAGG - Exonic
1002177838 5:177411817-177411839 CCTGCAGAGAAGCCCATGTAGGG + Intronic
1002197260 5:177508278-177508300 GGTGCTGAGCAGCCAGTAGATGG + Exonic
1002575531 5:180171843-180171865 CCTGCTCGGCAGCCAGGGTGTGG + Intronic
1002664424 5:180811775-180811797 CCGGCTCTGCAGCCATTGTAAGG - Intronic
1002780301 6:359877-359899 CCTTCTGAGGAGCCAGGGTTGGG + Intergenic
1002931447 6:1637729-1637751 CATTCTGAACAGCCAGTGCAGGG - Intronic
1004035222 6:11917062-11917084 TCTGCTGCGGAGCCAGTGCATGG + Intergenic
1004759696 6:18652877-18652899 TCTAATGAGCAGCCAGGGTATGG + Intergenic
1006376445 6:33674099-33674121 GCTGCTGTGCAGCCAGTGCAGGG + Intronic
1007002198 6:38324530-38324552 CCTGCTGAGCAGACAGACTATGG + Intronic
1007096305 6:39215311-39215333 CCTTCAGAGCAGCGAGTGGAAGG - Intronic
1008408519 6:51145845-51145867 CTTGCTGACCAGCAAGTGAAGGG + Intergenic
1009061241 6:58400102-58400124 ACTGGTGAGCAGTCTGTGTATGG + Intergenic
1009318504 6:62255486-62255508 CCTGCTCTGCAGCTAGTGCATGG - Intronic
1009916833 6:70006188-70006210 CCTGCTGAGCTCCCAGGGTGAGG - Intronic
1010915558 6:81613708-81613730 CCTGCTGAACAGTCACTGGATGG + Intronic
1011246029 6:85322185-85322207 GCTGCTGAGCAGCTAGTGAGAGG + Intergenic
1011295606 6:85824402-85824424 GCTTCTGAGCAGCCTGTTTATGG + Intergenic
1018051931 6:160016663-160016685 CCTTCTGAGTAGCCAGGGTGTGG - Intronic
1019056757 6:169229277-169229299 TCTGCTGAGGAGCCAGTGATGGG - Intronic
1019531118 7:1504001-1504023 CCTGCGGAGGAGCCAGCGTGCGG + Exonic
1019911951 7:4106149-4106171 CCTTCTGAGCAGCGAGTGTCTGG - Intronic
1020120723 7:5501767-5501789 CCAGCTGAGCAGCGAGTGCAAGG - Exonic
1020941574 7:14545645-14545667 CCTGCTGAGCAGCTATTGTGAGG - Intronic
1021502716 7:21347951-21347973 CCTGCTGATCACCCAGTTTCAGG + Intergenic
1023227754 7:37989281-37989303 CATGCTTTGCTGCCAGTGTAAGG + Intronic
1023640430 7:42251449-42251471 CCTGCTGTGCAGCTGGAGTAGGG + Intergenic
1027214858 7:76177165-76177187 CCTGCTCAGCACCCAGGGTCAGG + Intergenic
1027961528 7:84952265-84952287 CCTGCTGAGGAGCCAGACTTGGG - Intergenic
1028896512 7:96047763-96047785 CCTGAAGAGGAGCCAGTGAAAGG + Intronic
1029698755 7:102232402-102232424 CCTTCTTAGAAGCCAGTGTGTGG + Intronic
1030822056 7:114106030-114106052 CCTGCTGAGCCTCCACTGTGTGG - Intronic
1035189197 7:157151027-157151049 GCTGCTGAGCAGACAGAGCAGGG + Intronic
1035546047 8:483211-483233 ACTGCCGAACAGCCAGTGGAGGG - Intergenic
1035781027 8:2228687-2228709 CCTCCTTAGCAGCCAGTGAGTGG + Intergenic
1038884808 8:31651563-31651585 CCTGCTGAGATGCCAGTGTTGGG + Intronic
1038892754 8:31745201-31745223 CCTGCTGAGTAGCTGGTGGAAGG + Intronic
1039615725 8:38953571-38953593 TCTGCTTAGGAGCCAGAGTAAGG - Intronic
1041770719 8:61469731-61469753 TCTTCTGAGCAGCCAGGGCAAGG + Intronic
1045385749 8:101669742-101669764 CTTTCTGTGCAGCCAGTGTTGGG + Intergenic
1047721997 8:127649660-127649682 GCTGTTGAGCAGCCATTGAATGG + Intergenic
1049326980 8:142026832-142026854 CCTGCTCAGCAGGCATTGAAGGG - Intergenic
1049932487 9:470333-470355 CCTGCTCAGCAGCGAGTGGTTGG + Intronic
1050602976 9:7271551-7271573 CCTGCTAAGCAGCCAAGGCATGG - Intergenic
1051174907 9:14351118-14351140 CCTGCTTAGCAGCTAGTCTGGGG - Intronic
1052274181 9:26659213-26659235 ACTGCTGAGATGCCAGTGGAAGG - Intergenic
1058995143 9:110292244-110292266 CCTGGGGAGCAGGCAGTGGATGG - Intergenic
1060126605 9:121053682-121053704 CCTGCTGTGCAGCCTGTGGTTGG - Intergenic
1060721483 9:125982515-125982537 CATGCTGAACAGCCAGGGTGTGG - Intergenic
1060890588 9:127185444-127185466 CCAGTTGAGCAGCCAGTGAACGG - Intronic
1061054499 9:128215234-128215256 CATGCTGAGGAGCCAGTGCCAGG - Intronic
1061804638 9:133131200-133131222 CCAGCTGAGCAGACAGTTCAGGG + Intronic
1062444551 9:136588159-136588181 CCTGCTCAGGAGCCAGGGTCTGG - Intergenic
1062618078 9:137407098-137407120 CCTGCGGAGCAGCCAGTCCCGGG + Intronic
1186591534 X:10935142-10935164 CCTGCTCAGCATCCATTGTTGGG + Intergenic
1186887126 X:13925115-13925137 CCTGCTGAGTAGCAAACGTATGG - Intronic
1188263018 X:28040062-28040084 CCTGGTGAGCAGTCAGACTATGG + Intergenic
1193511782 X:82411076-82411098 ACTGCAGAGCATCCAGAGTAGGG - Intergenic
1196502308 X:116399668-116399690 TCTGGTGAGCAGCCTGTTTAAGG + Intergenic
1197548143 X:127853690-127853712 CTTGCTAAACAGCCAGTGCATGG + Intergenic
1200084000 X:153593951-153593973 CCTTCTGAGCTGCCCGTGCATGG + Intronic