ID: 905949997

View in Genome Browser
Species Human (GRCh38)
Location 1:41942217-41942239
Sequence CACAATTAACACATCCATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905949993_905949997 20 Left 905949993 1:41942174-41942196 CCATCTTTATGTGGATGTACGAT 0: 1
1: 0
2: 0
3: 4
4: 82
Right 905949997 1:41942217-41942239 CACAATTAACACATCCATATGGG 0: 1
1: 0
2: 0
3: 8
4: 157
905949992_905949997 23 Left 905949992 1:41942171-41942193 CCACCATCTTTATGTGGATGTAC 0: 1
1: 0
2: 0
3: 17
4: 137
Right 905949997 1:41942217-41942239 CACAATTAACACATCCATATGGG 0: 1
1: 0
2: 0
3: 8
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905949997 Original CRISPR CACAATTAACACATCCATAT GGG Intronic
903293554 1:22329676-22329698 CACAAGGAACACATCCTCATGGG - Intergenic
905949997 1:41942217-41942239 CACAATTAACACATCCATATGGG + Intronic
906042621 1:42800138-42800160 GATAATTTACACATCCAAATGGG - Intergenic
907055954 1:51368205-51368227 CACACTTTACACATTCAAATGGG - Intronic
910170901 1:84375963-84375985 CACATTTAACACCTCCAAAAAGG + Intronic
912887957 1:113496430-113496452 CACATTTAACAAACACATATAGG - Intronic
917997142 1:180452179-180452201 CACAATTAAAACAACTATGTGGG + Intronic
921717756 1:218435764-218435786 GACAATTAACACTTCTAAATGGG - Intronic
922816618 1:228453711-228453733 CACACTTCACACATCCCTATGGG - Intergenic
922962244 1:229658223-229658245 CACACTTACCACATCCATTCAGG - Intronic
923462045 1:234216139-234216161 CCCAATTCACACATGCATGTGGG - Intronic
924687440 1:246309106-246309128 CACAATTAAAAAATACATATTGG - Intronic
1062974559 10:1673966-1673988 CACATTTAACACATTTATGTTGG - Intronic
1063026602 10:2185013-2185035 AAAGATGAACACATCCATATTGG + Intergenic
1063120123 10:3099957-3099979 CACAGTTAACACATACACACGGG - Intronic
1064647947 10:17479228-17479250 CACATTGAACACAACCAAATAGG + Intergenic
1066354727 10:34671408-34671430 CTCAAGTAACACATTCATCTAGG + Intronic
1066381392 10:34905097-34905119 CACAATTAAAACACAAATATGGG - Intergenic
1066404975 10:35109870-35109892 CATAATTAAAATATCCATAGTGG + Intergenic
1066678783 10:37916237-37916259 TACAATTAGCACACCAATATTGG + Intergenic
1067664770 10:48267934-48267956 CAGAATAAACAAATCCATAGAGG + Intronic
1072255327 10:93615301-93615323 CACAATCCACAAAACCATATTGG + Intronic
1078564832 11:12405360-12405382 CAAATTTAACACATGCGTATAGG + Intronic
1078636303 11:13053595-13053617 CACAATGAAAACAACCACATGGG - Intergenic
1078929624 11:15903016-15903038 CACATGAAACACATCCATAGAGG - Intergenic
1079511900 11:21220696-21220718 CAAAATTAACACATAAAAATGGG - Intronic
1081115415 11:39193144-39193166 CACATATCACACATGCATATTGG - Intergenic
1082625797 11:55483870-55483892 CACAGTCAACACAACCATATTGG + Intergenic
1084929925 11:72546937-72546959 ATCAATTAACAAATCCATAGGGG + Intergenic
1086972311 11:93096389-93096411 CAGAATTAACACATGCCTCTAGG + Intergenic
1087491376 11:98831401-98831423 AACAATTAAGAAATCCATTTTGG + Intergenic
1088429228 11:109740114-109740136 CACAAGTAACACATCTGCATGGG + Intergenic
1092354225 12:7781501-7781523 CACAATTAATTAATCAATATTGG - Intergenic
1095801538 12:46274174-46274196 CTTAATTAACACATTCTTATAGG - Intergenic
1096574414 12:52543751-52543773 GAAAATTAACACAGACATATAGG + Intergenic
1098322417 12:69259028-69259050 CACCACCAACAGATCCATATGGG + Exonic
1099007010 12:77246187-77246209 CATACTTAAAACATCCATTTGGG - Intergenic
1101971717 12:109318854-109318876 CACAAGTAAGACATCCACTTTGG - Intergenic
1102650855 12:114441358-114441380 CACAATATACACATCCTAATGGG - Intergenic
1105316735 13:19272324-19272346 CACAATTAAAAGATACAGATTGG + Intergenic
1108287037 13:48918755-48918777 CATAATTATCATATCCATAAAGG - Intergenic
1111780970 13:92723433-92723455 CACCATTATTACAGCCATATTGG + Intronic
1112263470 13:97900132-97900154 CACCGTGAACACATCCATACTGG + Intergenic
1112851837 13:103715599-103715621 CCCAATTAACTTCTCCATATAGG - Intergenic
1113741010 13:112712400-112712422 CACAATGAAGACATCCAGGTAGG - Intronic
1114029377 14:18562898-18562920 CACAAACAACACATCAATACTGG - Intergenic
1114374260 14:22126765-22126787 CACAATCAAAACACCCATTTTGG - Intergenic
1115373160 14:32642232-32642254 CAAAATAAACACAACCATTTTGG - Intronic
1116515650 14:45801946-45801968 CAAAATAACCACATCAATATAGG - Intergenic
1116965099 14:51006201-51006223 CACAATTAGAAAATACATATTGG + Intronic
1120110032 14:80543055-80543077 CACAAGAAATTCATCCATATAGG - Intronic
1120442143 14:84555356-84555378 CTCAACTAACACATCTATAAAGG + Intergenic
1122215430 14:100200507-100200529 CAGAATCAACAAATCCATAGAGG - Intergenic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1125091849 15:35802151-35802173 CACAATTTAAAAATCAATATGGG - Intergenic
1125962492 15:43843794-43843816 CACAATTAGCAAATAAATATGGG - Intronic
1126864404 15:52921484-52921506 CACAATTTAACCATCCATTTGGG + Intergenic
1127209868 15:56762534-56762556 CATAATTCACATAACCATATAGG + Intronic
1127981995 15:64042135-64042157 CATACTTCACACATCCATGTGGG + Intronic
1130859234 15:87871892-87871914 CATTATTAAGACATCAATATGGG - Intronic
1136049426 16:27639976-27639998 CACAACCCACACAACCATATGGG + Intronic
1137223913 16:46483176-46483198 CACAACTAAGAAATCCATAGAGG + Intergenic
1137565082 16:49527746-49527768 CTCAAGTAACACAGCCAGATGGG + Intronic
1152001465 17:77648101-77648123 CACAATTAATTAATCCATATTGG + Intergenic
1153897686 18:9581595-9581617 CACATTTAACATATACATAATGG + Intronic
1155937406 18:31767931-31767953 CAAAATGTAGACATCCATATGGG - Intergenic
1157387748 18:47273453-47273475 CAGAATTGACAAATCCATAGAGG - Intergenic
1157633012 18:49119212-49119234 CTCATTTAATAGATCCATATTGG + Intronic
1158125188 18:54093018-54093040 CATAATTAAGAAATCTATATGGG + Intergenic
1160426927 18:78784014-78784036 CACACTACACACATGCATATGGG + Intergenic
1161640387 19:5419026-5419048 CACACTCAACACAGCCATGTCGG - Intergenic
1165731471 19:38148426-38148448 CACAGTTAACACAGCCACAGAGG - Intronic
1168104563 19:54158745-54158767 GACAATTAAAACAGCCATAAAGG + Intronic
925121240 2:1420124-1420146 CAGAATTAAAACATTCTTATAGG - Intronic
926616160 2:14998685-14998707 CACATTTAACATATGCATTTGGG - Intergenic
927393227 2:22619969-22619991 CACAATTAACACTTGTATTTTGG - Intergenic
929087170 2:38179996-38180018 CAAAAATAAAACATCTATATAGG - Intergenic
930267573 2:49217840-49217862 GACAATTAACTCATCCAGAGAGG - Intergenic
933556846 2:83840736-83840758 AACAATTAAAACATTTATATAGG + Intergenic
933793457 2:85902103-85902125 CACATTTTTCACACCCATATAGG + Intergenic
934078778 2:88450552-88450574 CACAATATACATATCCAGATAGG - Intronic
934682898 2:96298119-96298141 TAGAATCAACACATCCACATTGG - Intronic
936231491 2:110704537-110704559 CAAAATTTACACATGCATTTTGG + Intergenic
937566030 2:123290110-123290132 CCCAGTTAACAAATCCAGATCGG + Intergenic
938418336 2:131123204-131123226 GAAAATTAACCCATACATATGGG - Intronic
941415456 2:165215555-165215577 CACAATTAACATTTCCCTACGGG - Intergenic
942531603 2:176916035-176916057 AACAATTAACAAATGCATGTTGG + Intergenic
942917886 2:181334377-181334399 CACCAGTAACACACCGATATAGG - Intergenic
945627711 2:212231761-212231783 CAAAATAAATACATGCATATTGG - Intronic
946624621 2:221597365-221597387 CATAAATAATACATCCATGTTGG + Intergenic
947312563 2:228820314-228820336 CACAATTAATAAATGAATATGGG + Intergenic
947325693 2:228973921-228973943 CACAATTAATGAATCCATACTGG - Intronic
1175180833 20:57146009-57146031 CACAACTACCACATCCAAAGAGG + Intergenic
1180030203 21:45201742-45201764 CATAATTTACAGATCCATGTTGG - Intronic
1180453492 22:15489961-15489983 CACAAACAACACATCAATACTGG - Intergenic
1182687209 22:32130463-32130485 CACAATAAACATATCCACATTGG + Intergenic
1184964824 22:47963740-47963762 CACACTGGACACATCCTTATAGG + Intergenic
951807887 3:26666672-26666694 CACAATTAAGACTCCAATATGGG + Intronic
952229156 3:31411544-31411566 CACAATTAAGAAATCAACATTGG - Intergenic
952713145 3:36452535-36452557 CTCACTTAACAAATTCATATTGG - Intronic
952766004 3:36955033-36955055 CAGAATTAGCCCATCCATGTGGG - Intergenic
955463111 3:59207353-59207375 CATACTTATCACATCCATTTAGG + Intergenic
956573689 3:70726689-70726711 CACTATTAAAACATCATTATTGG - Intergenic
958640614 3:96800436-96800458 CACAAGAAACCCATCCAAATAGG - Intergenic
959329881 3:104990902-104990924 CACGATTATCACATTCATAAAGG + Intergenic
962664708 3:137642398-137642420 CAGAATTAAAAAATCCATCTGGG + Intergenic
964413173 3:156420554-156420576 CACAAATAAAACTTCCAAATTGG - Intronic
965342435 3:167506665-167506687 CACAATAAAGAAATCAATATTGG + Intronic
967353933 3:188546744-188546766 ATCAATTAACTCTTCCATATTGG + Intronic
969503206 4:7567231-7567253 TAACATTAACGCATCCATATTGG - Intronic
971115096 4:23636672-23636694 CACAATTAACAAATGCAGAAAGG + Intergenic
972327934 4:38035663-38035685 CAGAAAGAACACATCCATATTGG + Exonic
974065131 4:57070481-57070503 CACACTTAACAAATCCCTTTGGG + Intronic
975571557 4:75823110-75823132 CAAAGTTAACACTTTCATATAGG - Intergenic
978402367 4:108344111-108344133 CACAAGTAACGCATCCATCTAGG - Intergenic
978984370 4:114992097-114992119 CACAATTAACGAACCAATATTGG + Intronic
980556172 4:134408504-134408526 CACACTGAACACAATCATATTGG - Intergenic
981925238 4:150132012-150132034 TACAATTTGCACATCCATAAAGG + Intronic
983276709 4:165626769-165626791 AACAATTAACAGAGCCACATGGG + Intergenic
983778237 4:171635583-171635605 CACAAACAACACATACATACAGG - Intergenic
986238886 5:5939208-5939230 CAGAATTAACTCATTCATAAGGG - Intergenic
987104451 5:14623573-14623595 CAAAATTAACAAATGCATAATGG + Intergenic
988260930 5:28885388-28885410 CCCACTTAAGACATACATATTGG + Intergenic
989628539 5:43457182-43457204 CAAAAATAACATATCAATATTGG + Intronic
993886833 5:93424756-93424778 CAGAATTAACACATCAAACTGGG + Intergenic
994747895 5:103701909-103701931 CACAATAAACACATCCAAGGTGG + Intergenic
995907910 5:117148263-117148285 CATAATCAATACATGCATATTGG + Intergenic
996094401 5:119382831-119382853 CACAATTATCAGATGCAAATAGG - Intronic
996117400 5:119633651-119633673 CACAAATAACACATCAATGATGG + Intronic
996834735 5:127778096-127778118 AACAAATAAGACATCCACATTGG - Intergenic
996840265 5:127840477-127840499 CAAAATAAAGACATACATATAGG + Intergenic
997203162 5:132025017-132025039 CACAATTTACACATGCTTCTCGG + Intergenic
998901867 5:146864141-146864163 CACAATTATTACAGCAATATTGG + Intronic
999009930 5:148024986-148025008 CTCAAGTAACACATCAATTTGGG + Intergenic
999479386 5:151932670-151932692 CAAAATTAAAAAATCAATATTGG + Intergenic
999787221 5:154902177-154902199 CACAATTAACAGAGCGCTATAGG + Intronic
1003223478 6:4183039-4183061 CACAATTAACATGACCAGATGGG - Intergenic
1007113605 6:39327987-39328009 CTCAATAGACATATCCATATGGG + Intergenic
1010917361 6:81636678-81636700 CACAATGAATTCATTCATATAGG + Intronic
1011007293 6:82660706-82660728 CACAATTGTCACAGCCATAATGG + Intergenic
1011613247 6:89173933-89173955 AACAATGAACAGATCCTTATTGG - Intergenic
1014303780 6:119715267-119715289 CACAATAAAAAAATCCATGTGGG + Intergenic
1015820083 6:137251672-137251694 CATATTAAACACATACATATGGG + Intergenic
1018278222 6:162156148-162156170 AACAACTAACACAGCAATATTGG + Intronic
1022185403 7:27962604-27962626 CAGAACTAACAAATCCATAGAGG + Intronic
1024519685 7:50294132-50294154 CCCCCTTAACACATCCAGATGGG + Intergenic
1029855454 7:103511575-103511597 CACATTTAAAACATACATCTTGG + Intronic
1031042733 7:116855691-116855713 CACAATTTACACTGCCATATAGG + Intronic
1035707888 8:1691081-1691103 TAGAAAAAACACATCCATATGGG - Intronic
1036984185 8:13508365-13508387 CAGAATTAACAGAGCCATGTGGG + Intronic
1040932603 8:52750575-52750597 CACAATTAAAACATAGAAATAGG + Intergenic
1041531477 8:58872882-58872904 CACAATTAATGAATCAATATTGG - Intronic
1047100314 8:121668534-121668556 CACAATTAAAATATCTATGTGGG - Intergenic
1047639024 8:126798423-126798445 CTAAAATAACACATCCATAGTGG + Intergenic
1048261800 8:132951613-132951635 CACAATACACACACACATATAGG - Intronic
1055204288 9:73708744-73708766 CACAAATGACACACTCATATTGG - Intergenic
1056242812 9:84666710-84666732 CCCAATGAACACATACATAAAGG - Intergenic
1057821939 9:98339062-98339084 CACAATAGACAAATCCATAAAGG + Intronic
1059821039 9:117972399-117972421 CACATTTAACCCATCCATTGGGG - Intergenic
1191793504 X:64996611-64996633 CAAAATTAAAATATTCATATAGG + Intronic
1193828235 X:86253657-86253679 CACAAATAACACATTCTTCTGGG - Intronic
1193987223 X:88258571-88258593 CAGGATAAACACATCAATATAGG - Intergenic
1196611779 X:117723433-117723455 CACAATACACACATGCACATGGG - Intergenic
1197047351 X:122013637-122013659 CATAATTAGCACAACCATAGAGG - Intergenic
1197915932 X:131535359-131535381 TACAATTAATACATCATTATGGG + Intergenic
1201735138 Y:17251696-17251718 CACAACTAACACAAACACATGGG - Intergenic