ID: 905950685

View in Genome Browser
Species Human (GRCh38)
Location 1:41948070-41948092
Sequence CTCAAACCTATGCTGATTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905950683_905950685 -10 Left 905950683 1:41948057-41948079 CCACAAGTAATTGCTCAAACCTA 0: 1
1: 0
2: 0
3: 18
4: 139
Right 905950685 1:41948070-41948092 CTCAAACCTATGCTGATTGAGGG 0: 1
1: 0
2: 4
3: 29
4: 176
905950682_905950685 23 Left 905950682 1:41948024-41948046 CCAGACAATGAAGAAAGGAAAGA 0: 1
1: 2
2: 63
3: 99
4: 761
Right 905950685 1:41948070-41948092 CTCAAACCTATGCTGATTGAGGG 0: 1
1: 0
2: 4
3: 29
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905950685 Original CRISPR CTCAAACCTATGCTGATTGA GGG Intronic
900912184 1:5606308-5606330 CTCAAACCCATGTTGTTTGAGGG + Intergenic
905111915 1:35601427-35601449 CTCAAACCTATGCATATTCATGG + Intronic
905950685 1:41948070-41948092 CTCAAACCTATGCTGATTGAGGG + Intronic
907100938 1:51834895-51834917 CACAAACATATGCAGATTAATGG + Intronic
908605760 1:65795371-65795393 GTCCAAACTATGCTGTTTGAAGG - Intronic
911617323 1:100028730-100028752 CTCAAATCTTTGGTAATTGAAGG - Intergenic
912759304 1:112352748-112352770 TTCAAACCCATGCTGTTTAAGGG - Intergenic
913468712 1:119169733-119169755 CTCAAACCTATGCCACTCGAGGG - Intergenic
915924344 1:160004677-160004699 ATCATTCCTATGCTGATTTATGG - Intergenic
916591770 1:166198030-166198052 CTCAAACCCAAGCTGACAGAGGG + Intergenic
918708864 1:187703416-187703438 CTCATATCTATGCTGACTGATGG - Intergenic
919429131 1:197471221-197471243 CTTATAACTATGCTGATTGGGGG - Intronic
920059056 1:203215106-203215128 CTCAACCCTGTGCTGATGGGTGG + Intronic
920830125 1:209457025-209457047 CACCAACCTCAGCTGATTGAGGG - Intergenic
922338305 1:224635378-224635400 CTCAAAGCTATGCTGTGTGCTGG + Intronic
923797140 1:237168440-237168462 CTCATAACTCTGCTCATTGAAGG + Intronic
1064081802 10:12314027-12314049 AACAAGCCTGTGCTGATTGATGG + Intergenic
1064199834 10:13274977-13274999 CTCAAACTCATGGTGAGTGATGG + Intergenic
1067713213 10:48666733-48666755 CTCAAACCTATGCCACTTGAGGG - Intergenic
1069327553 10:67250103-67250125 CTCAAACCCATGCTGTTCAAGGG - Intronic
1070206396 10:74267158-74267180 TTCAAACCTGTGCTGTTTGAGGG - Intronic
1071521466 10:86333918-86333940 TTCAAACCAATGCTGTTTAAGGG + Intronic
1072471620 10:95718848-95718870 CTCAAACCTATGCCACTCGAGGG - Intronic
1074514455 10:114152392-114152414 CAGAAACATATTCTGATTGATGG + Intronic
1080448535 11:32359314-32359336 CTCAAAGCAATGTTTATTGATGG + Intergenic
1085601477 11:77859729-77859751 CTCAAACCTATGCCACTTGAGGG - Intronic
1086441691 11:86835008-86835030 CTCAAACCTATGCCACTTGAGGG - Intronic
1088265286 11:107982564-107982586 CTCAAACCTATGCCACTCGAGGG - Intergenic
1092111797 12:5969649-5969671 CTCAAACCAATGCTGAGGAAGGG - Intronic
1093744026 12:22719476-22719498 CTCTAACCTGTGCTCATTGCTGG - Intergenic
1093863246 12:24193983-24194005 CTCATCCCTCTACTGATTGATGG + Intergenic
1093920273 12:24851583-24851605 AACAAACCTATGATGGTTGATGG + Intronic
1096351782 12:50906665-50906687 CTCAAACCTGTGCTGCTCGAGGG - Intergenic
1096908635 12:54960461-54960483 CTCACAGCTATGCTCATTTAGGG - Intronic
1098676100 12:73291584-73291606 CTGGAACCTATTCTGCTTGATGG + Intergenic
1104462505 12:128967099-128967121 CTCAAACCTATTTTGCTTGGAGG + Intronic
1107497461 13:40941574-40941596 CTAAAACTAATGCTGATTGGGGG + Intronic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1108422593 13:50266209-50266231 CTGAAACCTTTGCAGCTTGAGGG + Intronic
1110943123 13:81377683-81377705 CTCCAACCTGTGCTGTTGGAAGG + Intergenic
1114384605 14:22242260-22242282 CTCAAACCTATGCCGCTCGAGGG + Intergenic
1116447157 14:45023218-45023240 CTCAAACCTATGCCGCTCGAGGG - Intronic
1117287641 14:54302357-54302379 ATCTAGCCTATCCTGATTGATGG - Intergenic
1117653423 14:57929802-57929824 TTCAGCCCTATGCTGACTGAGGG - Intronic
1117672729 14:58124683-58124705 CTCAAACCTACGCTGCTCGAGGG + Intronic
1118049139 14:62007075-62007097 TTCAACCCTTTGCAGATTGAAGG + Intronic
1121535598 14:94688517-94688539 CTCTAACCTATGTTGATTGATGG - Intergenic
1123454311 15:20405405-20405427 CTCAAACCTATGTTGTTAAAGGG - Intergenic
1127772151 15:62241118-62241140 ATCAAACCCATCCTGAATGATGG + Intergenic
1129155505 15:73714789-73714811 CTCAAACCTAGGCTTGTTTAGGG + Intergenic
1129883206 15:79020442-79020464 TTCAAACCTCTGCAGATTTAGGG - Intronic
1131077785 15:89506817-89506839 CTCAAACCTATGTTGTTAAAGGG - Intergenic
1132192603 15:99880768-99880790 TTCAAACCCATGCTGTTCGAGGG + Intergenic
1137739109 16:50748325-50748347 CTCAAACCTATTTTAACTGATGG - Intronic
1140023523 16:71262253-71262275 CCCAAATCTGTGCTGAATGATGG + Intergenic
1140252678 16:73307996-73308018 CTGCAACCTATGCTAAATGATGG + Intergenic
1146773238 17:35587842-35587864 CTCAAAGGTTTGCTCATTGATGG + Intronic
1149273793 17:55012853-55012875 CTCAAACCTATGCCACTCGAGGG - Intronic
1153401843 18:4690591-4690613 CTCAAACCTGTGCTGCTCAAGGG + Intergenic
1155838183 18:30613429-30613451 CTCAAACCTATGATTTTTTAAGG + Intergenic
1156801618 18:41121858-41121880 CCCAAAGTTTTGCTGATTGATGG + Intergenic
1158681588 18:59572225-59572247 CTCAAAAGCAAGCTGATTGAGGG - Intronic
1158731172 18:60024038-60024060 TTCAAACCTATGCTGTTCAAGGG - Intergenic
1158785971 18:60712262-60712284 CTCAAACCTATGCCGCTCAAGGG + Intergenic
1159066874 18:63579383-63579405 CTCAAACCCGTGTTGCTTGAGGG - Intergenic
1159464420 18:68762841-68762863 CAGAAACGTATTCTGATTGACGG + Intronic
1160483374 18:79263474-79263496 TTCAAACCTGTGTTGTTTGAGGG + Intronic
1162429005 19:10615705-10615727 CTCAAACCTGTGTTGTTGGAAGG + Intronic
1162810212 19:13159777-13159799 CTCAAACCTCAGATGGTTGAGGG + Intergenic
1164008342 19:21173396-21173418 ATAAAGCCTATGCTGATTGTTGG - Intronic
1164116517 19:22225564-22225586 ATGAAACCTATGCTGATTGTTGG - Intergenic
1168503591 19:56914274-56914296 TTCAAACCTGTGTTGTTTGAGGG + Intergenic
925510695 2:4622064-4622086 CTCACACCTATGCTGGTGGCTGG + Intergenic
926018232 2:9473479-9473501 CTCAAGCCTCTGCTGCTTGAAGG + Intergenic
926282659 2:11463166-11463188 TTCAAACCTGTGTTGTTTGAGGG - Intronic
926864766 2:17344803-17344825 CTCAAACCTATGCCACTCGAGGG + Intergenic
928014046 2:27637406-27637428 TTCAAACCTATGTTGTTTAAGGG + Intronic
930477352 2:51899836-51899858 CTCATAAATATGCTGAATGAAGG - Intergenic
932576826 2:72966966-72966988 CTCAAACACAGGCTGATTGAGGG + Intronic
932917975 2:75877601-75877623 CTCAAACCTGTGCAGCTAGAGGG + Intergenic
933439210 2:82289005-82289027 TTCAAACCCATGTTGTTTGAGGG - Intergenic
935935017 2:108172491-108172513 CACCAATTTATGCTGATTGATGG + Intergenic
938819430 2:134940229-134940251 TTCAAACCCGTGCTGTTTGAGGG - Intronic
939746717 2:145981009-145981031 CTCAAACTAATATTGATTGAAGG - Intergenic
940838048 2:158547369-158547391 CTCAAAAATCTGCTGAGTGAAGG + Intronic
941370660 2:164659359-164659381 CTCAAACCTATGCCACTCGAGGG - Intronic
943809923 2:192172091-192172113 CTCACATCTATGGTGATTAATGG + Intronic
945399099 2:209357431-209357453 CTTAAACCTTTTCTGATTCAAGG - Intergenic
946129170 2:217592284-217592306 CTCAAACGTATGCCACTTGAGGG - Intronic
948580228 2:238982104-238982126 CTCAAACCTACGCTGCTCGAGGG - Intergenic
1171445656 20:25202283-25202305 TTCAAACCCATGTTGTTTGAGGG + Intronic
1173060911 20:39660185-39660207 CACAAAGCTCTGCTGATTGATGG + Intergenic
1177263217 21:18754626-18754648 CTCAAACCTATGCCACTAGAGGG - Intergenic
1177896558 21:26860599-26860621 CTCAAACCTACACTGCTCGAGGG + Intergenic
1178611447 21:34085479-34085501 CTAAAACCAATGCAGATTGTTGG - Intronic
1178883892 21:36470099-36470121 CTCAAGCCTTAGCTGATTGTTGG + Intronic
1179258838 21:39740689-39740711 CTCAAACCTATGCCACTCGAGGG - Intergenic
1182010190 22:26994433-26994455 CCCAAACCAATGGTGATTTATGG + Intergenic
951299884 3:20983324-20983346 CTCAAACCCCTGTTGTTTGAGGG + Intergenic
953085153 3:39658614-39658636 CTCAAACCTATGCCGCTCAAGGG + Intergenic
953297907 3:41739511-41739533 CTCATATATATGCTGATTCATGG + Intronic
955695781 3:61634665-61634687 TTCAAACCTCTGCTGAGTGGTGG - Intronic
956999982 3:74874270-74874292 CTCAAACCTATGCTGCTCGAGGG - Intergenic
957220862 3:77380728-77380750 CTCACACCTGTGATGATGGAAGG - Intronic
959830853 3:110860622-110860644 CTGAAACCTATGTTGTTCGAGGG + Intergenic
961991675 3:131198309-131198331 CTCAAACCTATGCCACTTGAAGG - Intronic
962495751 3:135937447-135937469 CTCACACCTATGCCACTTGAGGG + Intergenic
963188262 3:142441825-142441847 CTCAAACCTAAGCCGCTCGAGGG + Intronic
963494338 3:146041467-146041489 ATAAAACATATACTGATTGAAGG - Intergenic
963809182 3:149757905-149757927 CTCAAACCTATGCCGCTCAAGGG - Intergenic
964606021 3:158561180-158561202 CTCAAAACTATGTTGATGGCAGG - Intergenic
964953728 3:162326904-162326926 CTCAAACCTATGCCACTTGAAGG + Intergenic
965054500 3:163696358-163696380 CTCAAACCTACACTGCTCGAGGG - Intergenic
965173959 3:165306176-165306198 CTCAAACCTGTGGTGAATAAGGG + Intergenic
966353805 3:179058372-179058394 CTCAAACCTATGCCACTCGAGGG + Intronic
967553183 3:190823735-190823757 TTCAAACCCATGTTGTTTGAGGG + Intergenic
967890068 3:194358689-194358711 CCCAAAACCAGGCTGATTGACGG + Exonic
969645265 4:8424769-8424791 CTCAAACCTACGCCGCTCGAGGG + Intronic
975068376 4:70098925-70098947 TTCAAACCTATGCTGTTCAAGGG + Intergenic
978155744 4:105488021-105488043 CTCAAACCTATGCTGCTCGAAGG + Intergenic
978529709 4:109701645-109701667 GTAAAACCTAAGCTGATTTAAGG - Intronic
978566597 4:110089282-110089304 TTCAAACCTATGTTGTTTGAAGG - Intronic
978586495 4:110280643-110280665 CTCAAACCTAGGCCGCTCGAGGG - Intergenic
978598583 4:110404599-110404621 TTCAAACCCATGTTGTTTGAAGG + Intronic
979097666 4:116572002-116572024 CTCAAACCTTAGCTGAATTATGG + Intergenic
980872500 4:138625933-138625955 CTCAAAGCTACGCTGCTCGAGGG - Intergenic
980906930 4:138957395-138957417 CGCTAACCTATCCTGATTGGTGG - Intergenic
981551712 4:145947997-145948019 CTTAAACCTCTCCTGATAGATGG + Intergenic
982849205 4:160290799-160290821 CTAAAACTTATGTTGACTGAAGG + Intergenic
983357055 4:166676011-166676033 GTATAACCTATGGTGATTGAAGG + Intergenic
984724040 4:183002944-183002966 CTCAAACCTATGCTGCTCTAGGG + Intergenic
984864249 4:184267756-184267778 TTCAAACCCATGTTGTTTGAGGG + Intergenic
986762535 5:10893358-10893380 CTCAAGCCAATGCTGATTAGGGG + Intergenic
987354975 5:17055816-17055838 CCCAAATCAATGCTGACTGATGG - Intergenic
987423286 5:17745971-17745993 CTCAATCTTATGCTGAATAAAGG - Intergenic
988595512 5:32586358-32586380 CTTCAGCCTTTGCTGATTGAGGG - Intronic
990892585 5:60664569-60664591 CTCAAACCTACGCTGCTCGAGGG + Intronic
994004503 5:94821877-94821899 TTCAAACTTATGTTGTTTGAGGG + Intronic
994442442 5:99826960-99826982 TTCAAACCGATGTTGTTTGAGGG - Intergenic
995007740 5:107221198-107221220 CTAAAAACAATGTTGATTGATGG + Intergenic
995465943 5:112449598-112449620 CTCAAACCTATTCCGCTTGAGGG + Intergenic
995609824 5:113897648-113897670 TTCAAACCCATGTTGCTTGAGGG - Intergenic
999262651 5:150247219-150247241 GTCAAACCTGTGCTGAATGCAGG + Intronic
1001711126 5:173779003-173779025 TTCAAACCTGTGTTGTTTGAAGG + Intergenic
1002890925 6:1331024-1331046 CTCAAACCTACGCCACTTGAGGG - Intergenic
1003238707 6:4322555-4322577 CTCACACCTATGCTCAGTGCTGG - Intergenic
1003947106 6:11086001-11086023 TTCAAACCTATGTTGTTTGAGGG + Intergenic
1005912513 6:30323472-30323494 TTCAAACCTATACTGTTTGTAGG + Intergenic
1006978693 6:38127864-38127886 CTGAAACCTAAGCTGAAGGAAGG - Intronic
1008738087 6:54571749-54571771 ATCAAACCCTTGTTGATTGATGG + Intergenic
1010340405 6:74744338-74744360 TTCAAACCCATGTTGTTTGATGG - Intergenic
1010893759 6:81342723-81342745 CTCAAACCTATGCCACTTGAAGG + Intergenic
1012007771 6:93735971-93735993 TTCAAATATATGTTGATTGATGG + Intergenic
1012308667 6:97693102-97693124 CTTACACCTATTCTTATTGAGGG + Intergenic
1013330021 6:109091126-109091148 TTCAAACCTATGCTGTTCAAGGG + Intronic
1013543856 6:111136638-111136660 CTCAAACCTACGCCGCTTGAGGG + Intronic
1016342945 6:143082363-143082385 CTCAAACCTATGCCGCTCAAGGG - Intronic
1016444408 6:144117764-144117786 CTCAAACCTATGCCACTCGAGGG - Intergenic
1018304012 6:162435361-162435383 TTCAAGTCTATGCTTATTGATGG + Intronic
1018761349 6:166896795-166896817 CTCAAACCTGTGCTGCTCGAGGG + Intronic
1020060577 7:5148799-5148821 TTCAAACCCATGGTGTTTGAGGG - Intergenic
1020167757 7:5821421-5821443 TTCAAACCCATGGTGTTTGAGGG + Intergenic
1020177875 7:5897532-5897554 CTCAATCAGAGGCTGATTGATGG + Intergenic
1020305039 7:6827442-6827464 CTCAATCAGAGGCTGATTGACGG - Intergenic
1020458136 7:8397334-8397356 CCCAAACCTGAGCTGATTTAGGG - Intergenic
1021649781 7:22822093-22822115 CGCACAGCTATGCTGACTGAGGG - Intronic
1023389917 7:39699856-39699878 CTCAAATCTGTGTTGTTTGAGGG - Intronic
1027837019 7:83257204-83257226 TTCAAACCCACGCTGTTTGAGGG + Intergenic
1028588275 7:92472097-92472119 CTCAAACCTATGCCACTCGAGGG - Intronic
1029167767 7:98606282-98606304 CTCAAAACAATTATGATTGAGGG - Intergenic
1038999619 8:32965275-32965297 CTCAAATCTGTACTAATTGAGGG - Intergenic
1039307103 8:36274595-36274617 CTCAAACCACTTTTGATTGATGG + Intergenic
1040527449 8:48237378-48237400 CTCAAACCTACGCCACTTGAAGG - Intergenic
1041078693 8:54192959-54192981 CTCAAATCTATGTTGTTTAAGGG - Intergenic
1041430863 8:57779199-57779221 CTCAACTCTTTGCTGATGGAGGG + Intergenic
1041601857 8:59727906-59727928 TTCAAACCTGTGCTGTTAGAGGG - Intergenic
1041663566 8:60421734-60421756 CTCAAACCTACGCTACTCGAGGG - Intergenic
1041863803 8:62545110-62545132 CTCAAACCCATGTTGTTTAAGGG + Intronic
1041867815 8:62596790-62596812 CTCAAACCTATGCTGTTCGAGGG - Intronic
1043015928 8:74940568-74940590 CTACTACCTATGCTCATTGAAGG + Intergenic
1043093822 8:75939032-75939054 CCCAAACCCATGAAGATTGATGG + Intergenic
1043490273 8:80741726-80741748 CTCAAACCTACGCCGCTCGAGGG + Intronic
1044362801 8:91308177-91308199 ATCAAACATATCCCGATTGAGGG - Intronic
1044622166 8:94201317-94201339 CTCCAACATATGCTTTTTGAGGG - Intronic
1044663915 8:94617136-94617158 CTCAAACCCATTCTGATTGCAGG - Intergenic
1045383004 8:101645439-101645461 CTCAAGCCTATGCAGATGGCGGG - Intronic
1045671266 8:104556010-104556032 CTCAAACCCATGCAAATGGATGG + Intronic
1046932860 8:119858426-119858448 CTCAAACCTCTGCTGGTTTCTGG + Intergenic
1047443723 8:124901309-124901331 CTCAAACCTACGCCACTTGAGGG - Intergenic
1050034491 9:1421176-1421198 TTCAGACCTCTGCTGATGGAAGG - Intergenic
1050266682 9:3898167-3898189 TTCAAACCTAGGCAGATGGAAGG + Intronic
1050436104 9:5612439-5612461 CTCAAACCTATGCTCACATATGG - Intergenic
1053352350 9:37422222-37422244 CTCATACCTCTGGTCATTGACGG + Intergenic
1055016911 9:71628603-71628625 CACAAGCCTATGCTCAATGAGGG + Intergenic
1055519520 9:77066170-77066192 TTCAAACCTATGCTGTTTAAGGG + Intergenic
1056024222 9:82475831-82475853 TTCAAACCTATGTTGTTTAAGGG + Intergenic
1056032042 9:82562987-82563009 CCCAGACCTATGCTGTTTGCTGG + Intergenic
1057977552 9:99622389-99622411 TTCAAATCTATGCTTATGGAAGG + Intergenic
1059558111 9:115301924-115301946 CTCACACATTTGCTGATTTAGGG - Intronic
1060603515 9:124894340-124894362 CTATGAGCTATGCTGATTGATGG + Intronic
1062189714 9:135241819-135241841 CTCAAACCTGTGCAGCTTCATGG - Intergenic
1185762820 X:2701316-2701338 CTTCAACCTATGCTGGCTGAAGG - Intronic
1187207181 X:17193924-17193946 CTCAGATCTATTCTGATTTATGG + Intergenic
1187663594 X:21577741-21577763 TTAAAGCCTATTCTGATTGAAGG + Intronic
1188577313 X:31667206-31667228 CTCAAAAATATGCTAAGTGATGG - Intronic
1188581274 X:31716914-31716936 CCCAAACCTATGCTGAAAGGAGG - Intronic
1189857104 X:45234326-45234348 CTCAGAGTTATCCTGATTGAGGG + Intergenic
1191173363 X:57473317-57473339 CTCAAAACTATGCTAATACATGG - Intronic
1191924902 X:66298515-66298537 CTCAAACCTACGCTGCTCGAGGG - Intergenic
1201905917 Y:19085618-19085640 CTCAAACCTACGCTGCTCAAGGG + Intergenic